Sodium butyrate targets VWF to inhibit cigarette smoke extract-induced endothelial cell-macrophage crosstalk in regulating inflammatory response

Abstract

Previous studies have shown that cigarette smoke-induced inflammation is a key driver of chronic obstructive pulmonary disease (COPD) progression. Sodium butyrate (NaB), a short-chain fatty acid that can be endogenously produced or exogenously supplemented, has been reported to exhibit anti-inflammatory effects. This study investigated the therapeutic effects and mechanisms of NaB in cigarette smoke extract (CSE)-induced inflammation. Through network pharmacology analysis, von Willebrand factor (VWF) was identified as a potential key target of NaB in the regulation of COPD. qRT-PCR and Western blot analysis showed that CSE significantly upregulated VWF expression in human umbilical vein endothelial cells (HUVECs), while NaB treatment markedly suppressed this upregulation. Using small interfering RNA (si-VWF), we knocked down VWF expression in HUVECs and co-cultured these cells with THP-1 cells in CSE-containing medium. ELISA, qRT-PCR, and Western blot analysis revealed that CSE enhanced the inflammatory response and activation of the PI3K-AKT signaling pathway in the THP-1. However, VWF knockdown reversed these effects of CSE. Furthermore, NaB pre-treatment of HUVECs significantly inhibited the inflammatory response and PI3K-AKT signaling activation in THP-1 cells, whereas VWF overexpression partially reversed the inhibitory effects of NaB. This study elucidated the critical regulatory role of VWF in CSE-induced endothelial cell-macrophage crosstalk and demonstrated that NaB suppresses CSE-induced VWF upregulation in HUVECs, thereby mitigating macrophage inflammation. Our findings reveal a novel mechanism by which NaB inhibits CSE-induced inflammation and highlight the therapeutic potential of NaB in COPD.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12931-025-03338-y.

Background

Chronic obstructive pulmonary disease (COPD) is a progressive disease characterized by inflammation and remodeling of the small airways and lung parenchyma caused by the inhalation of harmful particles, such as tobacco smoke and environmental pollutants [1]. COPD has become the third leading cause of death worldwide [2]. It is estimated that the number of COPD cases among individuals aged 25 years and older will increase by 23% globally between 2020 and 2025, approaching nearly 600 million patients, highlighting the increasing burden of COPD [3]. Currently, COPD treatment mainly relies on symptomatic relief with bronchodilators or broad-spectrum anti-inflammatory corticosteroids, but these approaches fail to address the underlying pathogenesis and often exhibit limited efficacy [4]. Although anti-inflammatory therapies are not currently considered first-line treatment, they may represent a potential direction for precision medicine in COPD in the future [5].

An increase in macrophages is a hallmark feature of chronic inflammation in COPD [6]. Cigarette smoke can activate the inflammatory responses of macrophages, promoting the secretion of inflammatory mediators such as TNF-α, CXCL1, CXCL8, and CCL2, which further enhance monocyte chemotaxis. Additionally, macrophages can interact with CXCR3 and release chemokines such as CXCL9 and CXCL10, which exert chemotactic effects on CD8 + Tc1 and CD4 + Th1 cells [7]. Studies have shown that corticosteroid resistance in COPD patients may be attributed to reduced HDAC2 activity in macrophages, which fails to suppress the overactivation of inflammatory gene expression. This suggests that potential HDAC2 activators may enhance the sensitivity to corticosteroid therapy [8]. Therefore, investigating the mechanisms regulating macrophage-driven inflammation in COPD may help identify novel anti-inflammatory targets.

Sodium butyrate (NaB), a short-chain fatty acid, is a metabolic product generated by gut microbiota through the fermentation of dietary fiber and plays a crucial role in maintaining intestinal health [9]. Numerous studies have demonstrated that NaB promotes immune homeostasis, making it a promising candidate for anti-inflammatory therapy [10, 11]. NaB has shown potential preventive and therapeutic effects in diseases such as colorectal cancer [12], fatty liver disease [13], inflammatory bowel disease [14], and COPD [15]. However, NaB regulates inflammation through multiple targets, and further elucidating its mechanisms in COPD treatment is essential for its translation into therapeutic applications for COPD.

Early studies established that von Willebrand Factor (VWF) is a marker of endothelial injury and primary role in coagulation, but more recent research has revealed its involvement in inflammatory processes [16]. VWF levels and activity are elevated in the serum of COPD patients and contribute to the progression of systemic inflammation [17, 18]. Notably, VWF levels increase significantly during acute exacerbations of COPD [19, 20]. However, to date, no studies have specifically investigated the role of VWF in regulating COPD progression. Given the critical role of macrophages in COPD-related inflammation, this study aims to investigate the role of VWF in cigarette smoke extract (CSE)-induced endothelial cell–macrophage crosstalk and to demonstrate how NaB targets VWF to regulate inflammation in COPD. These findings will provide new insights into the mechanism by which NaB exerts its therapeutic effects in COPD.

Materials and methods

Prediction of potential targets of sodium butyrate for COPD

In this study, the GSE38974 dataset was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/), which included 9 cases of healthy individuals lung tissue samples and 23 cases of patients with COPD lung tissue samples of RNA sequencing data. The dataset is based on the GPL4133 platform, Agilent-014850 Whole Human Genome Microarray 4× 44 K G4112F, and contains gene expression microarray data. Differentially expressed genes (DEGs) between COPD and normal samples were identified using the R package “limma” (version 3.56.2) with thresholds of |log₂FC| >0.6 and False discovery rate (FDR) < 0.05.

Drug targets of NaB were retrieved and collected using the Swiss Target Prediction database (http://swisstargetprediction.ch/) and the PharmMapper database (https://www.lilab-ecust.cn/pharmmapper/). The intersection of NaB targets and COPD related DEGs was taken to identify potential targets of NaB in COPD.

Construction of protein-protein interaction (PPI) networks and Random Walk with Restart (RWR) analysis

The DEGs and NaB target genes were jointly uploaded to the STRING online platform (https://cn.string-db.org/), with the species set to “Homo sapiens” and the interaction score threshold set to ≥ 0.4, while keeping all other parameters as default. A protein-protein interaction (PPI) network was then constructed. Subsequently, the NaB-targeting COPD potential target gene VWF was used as a seed for Random Walk with Restart (RWR) analysis to identify genes related to VWF within the PPI network. The top 50 genes ranked by affinity score to VWF were selected, and the “clusterProfiler” R package (version 4.8.3) was used to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses to identify potential signaling pathways.

Cell culture

Human umbilical vein endothelial cells (HUVECs, iCell Bioscience, China) were cultured in endothelial cell medium (ECM, iCell Bioscience, China) supplemented with 10% fetal bovine serum (FBS, iCell Bioscience, China) and 1% penicillin/streptomycin solution. Cells were maintained in a Humidified incubator at 37 °C with 5% CO₂.

THP-1 cells (purchased from iCell Bioscience, China) were cultured in RPMI 1640 medium (iCell Bioscience, China) supplemented with 10% FBS, 1% penicillin/streptomycin solution, and 0.05 mM 2-mercaptoethanol. To induce differentiation into macrophages for subsequent co-culture experiments, THP-1 cells were treated with 100 ng/mL phorbol-12-myristate-13-acetate (PMA) for 24 h in a Humidified incubator at 37 °C with 5% CO₂.

CSE Preparation 

The smoke from one unfiltered Furong cigarette was bubbled through 10 mL of PBS. The resulting suspension was adjusted to pH 7.4 using 1 mmol/L NaOH and then filtered through a 0.22 μm pore filter (Merck, Germany) to remove bacteria and large particles. The absorbance of the solution was measured at 320 nm to define 100% CSE. CSE was diluted with culture medium to the desired concentration and used in experiments within 30 min.

Cell transfection

Small interfering RNA targeting VWF (si-VWF), small interfering RNA negative control (si-NC), plasmid overexpressing VWF (oe-VWF) and blank plasmid (oe-NC) were constructed and transfected into HuVECs using Lipofectamine™ 3000 Transfection Reagent (Invitrogen, USA). The specific operation is as follows: This study employed the pLVX-EGFP-IRES-Puro plasmid for oe-VWF. The expression cassette is driven by the CMV strong promoter to ensure high-efficiency transcription, with real-time monitoring of transfection efficiency via EGFP fluorescence and puromycin resistance (puro+). Transfection was performed when HuVECs grew to 70–90% confluence. Lipofectamine™ 3000 was diluted with Opti-MEM medium and mixed thoroughly. Then the nucleic acid to be transfected was diluted with Opti-MEM medium and P3000™ was added and mixed. The diluted Lipofectamine™ 3000 was mixed with the diluted nucleic acid in a 1:1 ratio and incubated at room temperature for 5 min. Add the mixture to the culture medium, shake well, and incubate at 37 °C for 3 days. and the transfection efficiency was detected by qRT-PCR and Western blot after 3 days of culture.

Transwell co-culture

HUVECs were transfected with the corresponding nucleic acids in advance according to the experimental grouping. For NaB pre-treatment, HuVECs were treated with 2 mM NaB (Merck, Germany) for 24 h. HUVECs and THP-1 cells were co-cultured using transwell chambers with 3 μm pore polycarbonate membranes (Merck, Germany). THP-1 cells were seeded in the upper chamber, while HuVECs from different treatment groups were seeded in the lower chamber. After 24 h of co-culture, the culture medium and THP-1 cells were collected for subsequent detection and analysis.

Cell viability analysis

Cell viability was measured using a Cell Counting Kit-8 (CCK-8) assay (Dojindo Laboratories, Japan). Briefly, HuVECs from different groups were seeded into 96-well plates and treated with 0%, 0.5%, 1%, 2.5%, 5%, and 10% CSE for 24 h. Subsequently, 10 µL of CCK-8 solution was added to each well containing complete medium, and the cells were incubated for 1 h. The absorbance of each well was measured at 450 nm using a microplate reader.

Apoptosis detection

Cell apoptosis was detected using an Annexin V/FITC apoptosis detection kit (Beijing Sizhengbai Biotechnology, China). Briefly, HuVECs were treated with 2.5% CSE, 2.5% CSE, and 2mM NaB for 24 h, respectively, and then the cells were digested with EDTA-free trypsin, washed twice with PBS, and resuspended in binding buffer to adjust the cell concentration to 1–5 × 10⁶/mL. 100 µL of the cell suspension was taken into a 5mL flow tube, 5 µL Annexin V/FITC was added, mixed, and incubated at room temperature in the dark for 5 min. 10µL of propidium iodide (PI) solution was added, and 400 µL PBS was added, and cell apoptosis was immediately detected by flow cytometry.

Elisa

According to the manufacturer’s instructions, the Human interleukin 1β (IL-1β) detection kit, Human interleukin 6 (IL-6) detection kit, Human interleukin 8 (IL-8) detection kit, human tumor necrosis factor α (TNF-α) detection kit, and human von Willebrand factor (VWF) detection kit (Elabscience, China) were used to measure the levels of IL-1β, IL-6, IL-8, TNF-α, and VWF in the supernatant of the co-culture medium.

qRT-PCR

Total RNA was extracted from cells using Trizol reagent (Invitrogen USA), and RNA was reversed into cDNA using SuperScript III First-Strand Synthesis System (invitrogen USA), followed by real-time quantification of cDNA using Maxima SYBR Green qPCR mix (invitrogen USA). Finally, gene expression was quantified using the 2^−ΔΔCt method, with β-Actin or GAPDH as the internal reference gene. The primer sequences are shown in Table 1.

Table 1.

Primer information required for qRT-PCR

Gene Name	Primer sequence (5, − 3,)
β-Actin	F	TCCTCCTGAGCGCAAGTACTCC
	R	CATACTCCTGCTTGCTGATCCAC
GAPDH	F	AGGTCGGTGTGAACGGATTTG
	R	GGGGTCGTTGATGGCAACA
IL-1β	F	TTTGAGTCTGCCCAGTTCCC
	R	GTTATATCCTGGCCGCCTT
TNF-α	F	GCTCTTCTGCCTGCTGCACTT
	R	ACATGGGCTACAGGCTTGTCAC
IL-6	F	CACAGACAGCCACTCACCT
	R	GCCTCTTTGCTGCTTTCACAC
IL-8	F	CAGAGACAGCAGAGCACACA
	R	CTCCTTGGCAAAACTGCACC

F Forward primer, R Reverse primer

Western blot

The cells were lysed by ultrasonic disruption, and the supernatant of the lysate was collected. The protein concentration was determined using the BCA protein assay kit (Beyotime, China). The protein samples were diluted with protein loading buffer to a final concentration of 5 mg/mL. Then, 10 µL of protein sample was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Beyotime, China), and the separated products were transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, USA) using a wet transfer method. The PVDF membrane was blocked with 5% skim milk for 1 h. Subsequently, the membrane was incubated overnight at 4 °C with the following primary antibodies: VWF Antibody (1:1000, Affinity, China), VE-Cadherin Antibody (1:500, Abcam, USA), PI3K p85 alpha Antibody (1:500, Affinity, China), Phospho-PI3K p85 alpha (Tyr607) Antibody (1:2000, Affinity, China), pan-AKT1/2/3 Antibody (1:1000, Affinity, China), and Phospho-AKT1/2/3 (Ser473) Antibody (1:1000, Affinity, China). After washing the PVDF membrane with PBST (phosphate-buffered saline containing Tween-20), the samples were incubated with Goat Anti-Mouse IgG H&L (1:5000, Abcam, USA) for 2 h. The membrane was developed using enhanced chemiluminescence (ECL) reagents (Beyotime, China) for 10 min, and images were captured using an infrared laser imaging system (Odyssey, LI-COR Biosciences, USA). The relative expression levels of the target proteins were analyzed using Image-Pro Plus software (Media Cybernetics, USA), with β-Actin or GAPDH specified as the internal reference.

Fluorescein isothiocyanate (FITC)-dextran assay

HUVECs were seeded into transwell chambers and cultured until confluence. The medium was removed, and cells were washed twice with PBS. Serum-free medium containing FITC-dextran (20 µg/mL, Yeasen Biotechnology, China) was added to the upper chamber, and serum-free medium was added to the lower chamber. After incubating for 1 h, the medium from the lower chamber was collected. Fluorescence intensity was measured using a fluorescent microplate reader (SpectraMax M5, Molecular Devices, USA) with FITC settings (Ex = 495 nm, Em = 525 nm). Permeability coefficient (P) is calculated using the formula:

• D_L: glucose concentration in the lower chamber (µg/mL).

• D_U: glucose concentration in the upper chamber (µg/mL).

• V: volume of the lower chamber (cm³).

• A: effective area of the transwell membrane (cm²).

• T: incubation time (s).

Statistical nalysis

Statistical analysis was performed using GraphPad Prism 10.0. Data are presented as the mean ± standard deviation from three independent experiments. Statistical comparisons between two groups were conducted using the t-test. P < 0.05 was considered statistically significant.

Result

VWF is a potential target for sodium butyrate in the treatment of COPD

A total of 1764 COPD-related DEGs were identified in this study, including 658 upregulated genes and 1106 downregulated genes (Fig. 1A). Subsequently, the potential targets of NaB were predicted using an online database, resulting in 35 potential targets (Supplementary Table 1). The intersection of the predicted targets and DEGs revealed that GABBR1 and VWF might be potential targets of NaB in regulating COPD (Fig. 1B). Since increased VWF levels in COPD patients have been associated with epithelial injury, emphysema, exacerbation, and an elevated risk of mortality [18], we selected VWF as a potential target of NaB in COPD for further analysis.

Fig. 1.

VWF is a potential target for NaB to regulate COPD. A Volcano plot of differentially expressed genes in chronic obstructive pulmonary disease (COPD); B Venn diagram of differentially expressed genes in COPD and potential targets of sodium butyrate (NaB); C Gene Ontology (GO) enrichment analysis of VWF-related genes; D Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of VWF-related genes

We constructed a PPI network using the DEGs and NaB potential targets, then performed RWR analysis using VWF as a seed. The top 50 genes based on affinity scores (Supplementary Table 2) were selected as genes closely related to VWF for functional enrichment analysis. The results indicated that regulation of angiogenesis, cell-substrate junction, cytokine activity, and the PI3K-AKT signaling pathway were closely associated with VWF (Fig 1C-D).

Sodium butyrate alleviates CSE-induced HUVEC apoptosis and VWF expressions

Since VWF is primarily produced by vascular endothelial cells [21], this study conducted preliminary exploration using HuVECs. To simulate the COPD research environment, HuVECs were treated with CSE for 24 h. First, HUVECs were treated with different concentrations of CSE (0.5–10%) for 24 h to determine the optimal concentration of CSE. The results showed that CSE inhibited HuVECs viability in a concentration-dependent manner, with concentrations of 1%, 2.5%, and higher significantly reducing cell viability (Fig. 2A). Therefore, 2.5% CSE was selected for subsequent experiments. Subsequently, we investigated the impact of NaB on HUVECs viability. The results demonstrated that NaB significantly enhanced HUVEC viability and maintained this protective effect even under CSE stimulation (Fig. 2B). In addition, CSE treatment significantly promoted HUVECs apoptosis, while the addition of NaB partially reversed this effect (Fig. 2C). qRT-PCR and Western blot analyses revealed that CSE significantly upregulated the expression of VWF, whereas NaB treatment markedly reversed the effect of CSE (Fig. 2D-E).

Fig. 2.

Sodium butyrate alleviates CSE-induced HUVEC apoptosis and VWF expressions. A, B Cell Counting Kit-8 (CCK-8) was used to detect cell viability following treatment with cigarette smoke extract (CSE) and sodium butyrate (NaB); C flow cytometry was used to detect cell apoptosis, and the apoptosis rate was equal to the sum of the Q1-2 and Q1-4 cell ratios; qRT-PCR (D) and Western blot (E) were used to detect the expression level of von Willebrand Factor (VWF). n = 3. The control group represented normal cell culture, the CSE group represented the culture medium with 2.5% CSE added, and the CSE + NaB group represented the culture medium with 2.5% CSE and 2 mM NaB added. Cells in each group were tested after 24 h of culture. Data were analyzed using one-way ANOVA, ns not significant, * p < 0.05

CSE-induced high expression of VWF in HUVECs can promote the inflammatory response of macrophages

Due to the intercellular communication between vascular endothelial cells and macrophages, we found through literature review that VWF plays a critical role in macrophage activation and inflammatory responses [22]. We constructed HUVECs transfected with si-NC and si-VWF (Fig. 3A-B) and selected the HUVECs with the best transfection efficiency for co-culture with THP-1 macrophages. As shown in Fig. 3C, VWF knockdown significantly attenuated VWF protein exocytosis in endothelial cells. When co-cultured with macrophages, these VWF-deficient endothelial cells further suppressed macrophage secretion of the pro-inflammatory cytokines IL-1β, TNF-α, IL-6, and IL-8 (Figs. 3D-G). In addition, under CSE treatment, the levels of VWF and inflammatory factors IL-1β, TNF-α, IL-6, and IL-8 in the co-culture system were significantly elevated (Fig. 3H-L). Moreover, the expressions of IL-1β, TNF-α, IL-6, and IL-8 were also significantly upregulated in macrophages (Fig. 3M-P). Interestingly, when VWF in HUVECs was knocked down using si-VWF prior to co-culture, the levels of IL-1β, TNF-α, and IL-6 in both macrophages and the co-culture system were partially restored, while the levels of IL-8 exhibited no significant change (Fig. 3I-P). These findings suggest that under CSE stimulation, VWF overexpressed in HUVECs can promote the inflammatory response of macrophages. Moreover, VWF secreted by CSE-induced HUVECs appears not to affect IL-8 production in macrophages.

Fig. 3.

CSE induces VWF produced by HUVEC to promote macrophage inflammatory response. A, B qRT-PCR (A) and Western blot (B) were used to detect the transfection efficiency of si-VWF; C-G Elisa was used to detect the levels of von Willebrand Factor (VWF, C), interleukin-1 beta (IL-1β, D), Tumor Necrosis Factor-α (TNF-α, E), interleukin-6 (IL-6, F), and interleukin-8 (IL-8, G) after VWF knockdown; H-L Elisa was used to detect the levels of VWF (H), IL-1β (I), TNF-α (J), IL-6 (K), and IL-8 (L) in the co-culture system; M-P qRT-PCR was used to detect the mRNA levels of IL-1β (M), TNF-α (N), IL-6 (O), and IL-8 (P) in macrophages after co-culture. n = 3. The Control group represents cells cultured under normal conditions. The cigarette smoke extract (CSE) group represents the co-culture system supplemented with 2.5% CSE in the culture medium. The CSE + si-NC group represents HuVECs pre-transfected with si-NC and then co-cultured in medium supplemented with 2.5% CSE. The CSE + si-VWF group represents HuVECs pre-transfected with si-VWF and then co-cultured in medium supplemented with 2.5% CSE. All groups were tested after 24 h of co-culture. Data were analyzed using one-way ANOVA or t-test, ns not significant, * p < 0.05

CSE-induced high expression of VWF in HUVECs can activate the PI3K-AKT signaling pathway in macrophages

Based on RWR and functional enrichment analysis, we find the PI3K-AKT signaling pathway as a potential mechanism through which NaB targets VWF to treat COPD. Therefore, we first examined the impact of endothelial VWF knockdown on macrophage PI3K-AKT signaling. Results demonstrated that VWF deficiency in endothelial cells significantly reduced phosphorylation levels of PI3K (p-PI3K) and AKT (p-AKT) in macrophages (Figs. 4A-B). In addition, we found that under CSE stimulation, the expression of p-AKT and p-PI3K proteins in macrophages was significantly increased. However, when VWF in HUVECs was knocked down, the expression of p-AKT and p-PI3K in macrophages within the co-culture system was suppressed (Fig. 4C-G). These results suggest that under CSE stimulation, VWF produced by HUVECs can activate the PI3K-AKT signaling pathway in macrophages.

Fig. 4.

CSE-induced VWF produced by HUVEC activates PI3K-AKT signaling pathway in macrophages. A Western blot detection of protein kinase B (AKT), phosphorylated AKT (p-AKT), phosphoInositide-3 kinase (PI3K), and phosphorylated PI3K (p-PI3K) in macrophages after VWF knockdown and co-culture; B Statistics of the gray value ratio of p-AKT/AKT and p-PI3K/PI3K; C Western blot detection of AKT, p-AKT, PI3K, and p-PI3K in macrophages after cigarette smoke extract (CSE) treatment and co-culture; D-G Statistics of the gray value ratio of AKT (D), p-AKT (E), PI3K (F), and p-PI3K (G) to the internal reference β-Actin. n = 3. The Control group represents cells cultured under normal conditions. The CSE group represents the co-culture system supplemented with 2.5% CSE in the culture medium. The CSE + si-NC group represents HuVECs pre-transfected with si-NC and then co-cultured in medium supplemented with 2.5% CSE. The CSE + si-VWF group represents HuVECs pre-transfected with si-VWF and then co-cultured in medium supplemented with 2.5% CSE. All groups were tested after 24 h of co-culture. Data were analyzed using one-way ANOVA or t-test, ns not significant, * p < 0.05

Sodium butyrate reduces CSE-induced macrophage inflammatory responses and PI3K-AKT signaling pathway activation by inhibiting VWF

To further investigate whether VWF is a key target for NaB in regulating endothelial cell–macrophage crosstalk, we performed functional rescue experiments using HUVEC cell lines transfected with oe-VWF (Fig. 5A-B). First, HuVECs in each group were pretreated with NaB or normal saline for 24 h, and the pretreated HUVECs were then co-cultured with THP-1 macrophages. The results showed that NaB pretreatment significantly downregulated the expression of VWF, IL-1β, TNF-α, and IL-6 in the co-culture system. However, VWF overexpression reversed the expression levels of VWF, IL-1β, TNF-α, and IL-6 (Fig. 5C-F). qRT-PCR analysis revealed that the mRNA levels of IL-1β, TNF-α, and IL-6 in macrophages after co-culture exhibited the same trends (Fig. 5G-I). Meanwhile, NaB pretreatment significantly inhibited the activation of the PI3K-AKT signaling pathway in macrophages, while VWF overexpression reactivated the PI3K-AKT signaling pathway. VWF overexpression partially reversed the inhibitory effect of NaB on the PI3K-AKT signaling pathway (Fig. 6A-E). These findings demonstrate that NaB can alleviate CSE-induced endothelial cell–macrophage crosstalk by targeting VWF, thereby reducing macrophage inflammatory responses and PI3K-AKT signaling pathway activation.

Fig. 5.

Sodium butyrate inhibits VWF to reduce CSE-induced macrophage inflammatory responses. A, B qRT-PCR (A) and Western blot (B) were used to detect the transfection efficiency of oe-VWF. C-F ELISA was used to measure the levels of von Willebrand Factor (VWF, C), interleukin-1 beta (IL-1β, D), Tumor Necrosis Factor-α (TNF-α, E), and interleukin-6 (IL-6, F) in the co-culture system. G-I qRT-PCR was used to detect the mRNA levels of IL-1β (G), TNF-α (H), and IL-6 (I) in macrophages after co-culture. n = 3. The oe-NC group represents HUVECs pre-transfected with oe-NC. The NaB + oe-NC group represents HuVECs pre-transfected with oe-NC and pretreated with 2 mM sodium butyrate (NaB) for 24 h. The oe-VWF group represents HUVECs pre-transfected with oe-VWF. The NaB + oe-VWF group represents HuVECs pre-transfected with oe-VWF and pretreated with 2 mM NaB for 24 h. After completing the pretreatment, HUVECs and THP-1 macrophages were co-cultured in medium containing 2.5% cigarette smoke extract (CSE) for 24 h, followed by subsequent analysis. Data were analyzed using one-way ANOVA, ns not significant, * p < 0.05

Fig. 6.

Sodium butyrate inhibits VWF and reduces CSE-induced activation of PI3K-AKT signaling pathway in macrophages. A Western blot was used to detect the expression levels of protein kinase B (AKT), phosphorylated AKT (p-AKT), phosphoInositide-3 kinase (PI3K), and phosphorylated PI3K (p-PI3K) in macrophages after co-culture. B-E The grayscale intensity ratios of AKT (B), p-AKT (C), PI3K (D), and p-PI3K (E) to the internal control GAPDH were quantified. n = 3. The oe-NC group represents HUVECs pre-transfected with the empty vector plasmid. The NaB + oe-NC group represents HuVECs pre-transfected with the empty vector plasmid and pretreated with 2 mM sodium butyrate (NaB) for 24 h. The oe-VWF group represents HUVECs pre-transfected with oe-VWF (von Willebrand Factor-overexpressing plasmid). The NaB + oe-VWF group represents HuVECs pre-transfected with oe-VWF and pretreated with 2 mM NaB for 24 h. After completing the pretreatment, HUVECs and THP-1 macrophages were co-cultured in medium containing 2.5% CSE for 24 h, followed by subsequent analysis. Data were analyzed using one-way ANOVA, ns not significant, * p < 0.05

Sodium butyrate reduces CSE-induced endothelial cell injuries by inhibiting VWF

To investigate the regulatory role of macrophages in endothelial cell injury, we examined the effects of macrophage presence/absence and NaB on VE-cadherin expression and cellular permeability in CSE-exposed endothelial cells. As shown in Fig. 7A, CSE reduced VE-cadherin expression in endothelial cells, whereas NaB upregulated it. Under basal conditions, macrophage co-culture did not affect VE-cadherin expression in endothelial cells. However, in CSE-treated groups, this co-culture significantly downregulated VE-cadherin protein levels. NaB restored the CSE/macrophage-induced suppression of VE-cadherin. Notably, VWF overexpression not only exacerbated the inhibitory effects of CSE and macrophages on endothelial VE-cadherin but also abolished the restorative effect of NaB. Conversely, CSE significantly increased endothelial permeability, whereas NaB exerted no direct effect on this parameter (Fig. 7B). Macrophage co-culture further potentiated the permeability elevation, with this effect being markedly amplified under CSE stimulation. Importantly, NaB effectively suppressed the CSE/macrophage-induced enhancement of endothelial permeability. Notably, VWF overexpression not only potentiated the synergistic effect of CSE and macrophages on permeability augmentation but also abrogated the protective action of NaB. Collectively, NaB primarily protects endothelial barrier integrity by targeting VWF to inhibit CSE-triggered macrophage inflammation.

Fig. 7.

Sodium butyrate reduces CSE-induced endothelial cell injuries by inhibiting VWF. (A) Western blot was used to detect the expression levels of VE-cadherin in HUVECs. (B) The fluorescein isothiocyanate (FITC)-dextran assay was employed to quantify endothelial cell permeability, serving as an indicator of endothelial injury. n = 3. The oe-VWF represents von Willebrand Factor-overexpressing plasmid. Data were analyzed using one-way ANOVA or t-test, ns not significant, * p < 0.05

Discussion

The prevalence and mortality of COPD are continuously rising worldwide, and the inflammatory response of macrophages plays a key role in the progression of COPD. This study found that CSE induces high expression of VWF in endothelial cells, and VWF produced by endothelial cells can activate the inflammatory response of macrophages. Conversely, the macrophage inflammatory response further exacerbates CSE-induced endothelial cell injury. NaB can inhibit VWF, thereby alleviating CSE-induced endothelial cell–macrophage crosstalk.

Elevated VWF levels are significantly associated with lung epithelial injury, emphysema, acute exacerbations, and increased mortality risk in COPD patients [18]. Previous studies have shown that inhibiting VWF in alveolar epithelial cells can suppress epithelial cell p38 MAPK phosphorylation, thereby mitigating pulmonary fibrosis in COPD [23]. Multiple mouse models of inflammatory diseases have demonstrated the pro-inflammatory role of VWF [24–26]. This study is the first to demonstrate that CSE-induced high expression of VWF in endothelial cells plays a critical role in CSE-induced endothelial cell–macrophage crosstalk and macrophage inflammatory activation. Previous research has shown that VWF drives macrophage metabolism toward glycolysis, promotes M1 polarization in a p38-dependent manner, and triggers inflammatory signaling, thus establishing a link between VWF and innate immunity [22]. Furthermore, the cholesterol crystal-C1q-VWF complex can mediate the upregulation of phagocytic receptor expression in macrophages and contribute to the secretion of the pro-inflammatory cytokine IL-1β [27]. Our study, along with these reported findings, highlights the various mechanisms by which VWF activates macrophage inflammatory responses.

In our study, we observed that the PI3K/AKT signaling pathway was activated during the process of VWF-induced macrophage activation. Previous research has shown that PI3K-AKT is critical for macrophage activation and the secretion of inflammatory cytokines in COPD [28]. Early studies have demonstrated that AKT is involved in macrophage activation induced by pro-inflammatory signals [29, 30]. Specifically, AKT2 alone has been shown to contribute to M1 polarization [31–33]. Therefore, we speculate that PI3K/AKT may be an important downstream signaling pathway in VWF-induced macrophage inflammatory responses.

NaB, as an endogenous short-chain fatty acid, has been shown to have inhibitory effects on COPD [15]. A study revealed that lung cancer patients with COPD have lower butyrate levels in their guts compared to lung cancer patients without COPD and healthy controls [34]. Additionally, an increase in butyrate levels in the gut has been observed during COPD treatment [35, 36]. These studies establish a link between NaB and the phenotypic manifestations of COPD. The anti-inflammatory role of NaB is mediated through various molecular targets. For example, NaB can inhibit the PI3K/AKT/NF-κB pathway, thereby suppressing autophagy and NLRP3 inflammasome activation in THP-1 cells, which alleviates oxidative stress, inflammation, and metabolic disorders induced by glycation end products [37]. NaB has also been shown to regulate inflammation associated with atopic dermatitis via HDAC3 inhibition [38]. Emerging mechanisms linking NaB to the gut-lung axis in lung diseases are being uncovered. For instance, NaB can promote M2 polarization of alveolar macrophages to prevent MRSA pneumonia [39]. Cell and animal studies have demonstrated that NaB activates GPR43, thereby inhibiting the NF-κB/MAPKs signaling pathway and mitigating cigarette smoke-induced COPD inflammation [15]. These findings collectively indicate the potential application of NaB in treating COPD-related inflammation.

The direct regulatory effects of NaB on macrophages have been widely reported [40, 41]. However, this study reveals an alternative pathway through which NaB treats COPD, namely by indirectly inhibiting macrophage activation through the suppression of VWF production in HUVECs. Previous studies have found that extracellular vesicles secreted by endothelial cells under inflammatory conditions can be easily absorbed by THP-1 cells, thereby establishing targeted crosstalk between endothelial cells and monocytes [42]. Despite the significant gap in understanding the mechanisms of crosstalk between endothelial cells and macrophages in COPD, this study unveils a specific mechanism of targeted crosstalk between endothelial cells and macrophages in COPD. Furthermore, it provides evidence that NaB is a potential therapeutic intervention.

However, this study has several limitations that require further investigation. First, the proposed mechanism has only been demonstrated in an in vitro cell model, lacking validation in vivo using animal models. Second, it remains unverified whether VWF-mediated macrophage activation is dependent on the PI3K-AKT pathway. This study also does not clarify whether HUVECs directly secrete VWF to act on macrophages or if VWF regulates other secreted substances that influence macrophage inflammation. These mechanisms require further exploration. Although it has been observed that NaB levels are reduced in COPD patients and supplementation with NaB can reduce inflammation in COPD animal models, whether NaB supplementation offers superior anti-inflammatory effects compared to conventional COPD treatments remains to be further studied. Notably, ensifentrine—a drug recently approved for COPD treatment—has been shown to mitigate MRSA-induced endothelial injury by stabilizing VE-cadherin junctions and suppressing pro-inflammatory signaling [43]. Interestingly, this mechanism exhibits significant parallels to the protective effects of NaB observed in our study. Therefore, investigating their potential synergistic effects may hold considerable therapeutic value.

Conclusion

This study demonstrated that VWF expressed by CSE-induced HUVECs can activate macrophage inflammatory responses and the PI3K-AKT signaling pathway. These activated macrophages further exacerbate CSE-induced endothelial injury. NaB can inhibit CSE-induced VWF, thereby suppressing CSE-induced endothelial cell–macrophage crosstalk and alleviating macrophage inflammation and endothelial damage (Fig. 8).

Fig. 8.

Sodium butyrate targets VWF to inhibit cigarette smoke extract-induced endothelial cell-macrophage crosstalk in regulating inflammatory response

Abbreviations

COPD

Chronic obstructive pulmonary disease

NaB

Sodium Butyrate

CSE

Cigarette smoke extract

HUVECs

Human umbilical vein endothelial cells

VWF

Von Willebrand Factor

Authors’ contributions

Xiaolong Ma: Conceptualization, Methodology, Data Curation, Validation, Visualization, Writing - Original Draft.Jiaqi Zhou: Conceptualization, Methodology, Data Curation, Validation, Formal Analysis.Shuyou Yang: Methodology, Data Curation, Writing - Original Draft.Yingqing Zhang: Resources, Methodology.Chaoping Zhu: Methodology, Visualization.Yuejiao Sun: Writing - Original Draft.Jinli Miao: Formal Analysis.Hongyan Mo: Supervision, Writing - Review & Editing.

Funding

This research was supported by National Oncology Clinical Key Speciality (2023-GJZK-001), Jiaxing Key Laboratory of Precision Treatment for Lung Cancer, Key Construction Disciplines of Provincial and Municipal Co construction of Zhejiang (NO.2023-SSGJ-002).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Not applicable.

Competing interests

The authors declare no competing interests.