Skip to main content
The Plant Pathology Journal logoLink to The Plant Pathology Journal
. 2025 Oct 1;41(5):566–582. doi: 10.5423/PPJ.OA.05.2025.0064

Intraspecific Grafting of Tomatoes: Impact of Disease-Resistant Rootstocks on Fusarium Wilt Prevention, Plant Growth, and Fruit Quality under Naturally Infested Field Conditions

Praphat Kawicha 1, Prakob Saman 1, Phatcharin Suwannachairob 1, Pancheewan Ponpang-nga 1, Juthaporn Saengprajak 2, Aphidech Sangdee 2,*, Thanwanit Thanyasiriwat 1,*
PMCID: PMC12488384  PMID: 41033671

Abstract

Fusarium oxysporum f. sp. lycopersici (Fol) is a soil-borne pathogen that causes vascular wilt in tomatoes, severely affecting yield and quality. Grafting susceptible scions onto resistant rootstocks is a promising control strategy. This study evaluated four resistant tomato accessions (LE314, LE472, LE482, and LE501) for their ability to suppress Fol translocation and support scion performance. PCR analysis showed that all resistant accessions restricted Fol movement beyond the roots, with no detection in shoot tissues, indicating effective containment of the pathogen. Gene expression profiling revealed distinct temporal and accession-specific responses of LRR, WRKY41, and PR-1 genes. In field trials, heterografted tomatoes remained symptomless across planting years, while self-grafted plants exhibited severe wilt symptoms. All grafted combinations achieved 100% success without signs of incompatibility. Growth parameters (plant height, branch number, and canopy diameter), fruit size, and yield did not differ significantly between self- and heterografted plants. Importantly, fruit quality assessment indicated that specific traits, particularly total soluble solids and fruit firmness, were influenced by scion-rootstock interactions, while fruit pH and color attributes (L*, a*, b*) remained stable across grafted treatments. These results confirm that resistant rootstocks can prevent Fol infection and maintain agronomic performance, supporting intraspecific grafting as an effective and sustainable approach for managing Fusarium wilt in tomato production.

Keywords: disease resistance, Fusarium oxysporum f. sp. lycopersici, gene expression, intraspecific grafting, rootstocks


Tomatoes (Solanum lycopersicum L.) are among the most extensively cultivated vegetable crops worldwide, valued for their economic and nutritional importance. They are a rich source of vitamins, minerals, and antioxidants in human diets (Ali et al., 2020). However, tomato production is often constrained by soil-borne pathogens caused by bacteria, fungi, or oomycetes, which affect a wide range of economically significant crops globally (Planas-Marquès et al., 2020). Among vascular wilt diseases, Fusarium oxysporum f. sp. lycopersici (Fol) is particularly destructive. Fol causes vascular wilt, a disease that disrupts water and nutrient transport, leading to wilting, reduced productivity, and often plant death (Michielse and Rep, 2009). This pathogen thrives in warm climates and intensively cultivated soils, posing a persistent threat to tomato production in such regions (Di Pietro et al., 2003). Once Fol penetrates the root tissue and colonizes xylem vessels, it blocks vascular tissues, causing dark brown discoloration and leaf chlorosis (Gordon, 2017). Prolonged Fol infection can result in wilting, collapse, and plant death due to fungal mycelial accumulation, mycotoxin production, and suppression of the host defense mechanisms (Srinivas et al., 2019).

Several strategies have been developed to combat Fol, including cultural practices (Ajilogba and Babalola, 2013), biological controls (Castaldi et al., 2021; Pengproh et al., 2023), chemical treatments (Song et al., 2004), and host resistance (Molagholizadeh et al., 2023), each varying in effectiveness. Among these, host resistance is the most effective strategy for managing Fol (Chitwood-Brown et al., 2021). Genetic resistance has been a key focus in tomato breeding programs, with the identification of I (immunity) genes, such as I-1, I-2, I-3, and I-7, which confer resistance to specific Fol races (Gonzalez-Cendales et al., 2016). These genes activate localized and systemic defense responses to limit pathogen colonization (Takken and Rep, 2010). Once the pathogen invades plant cells, the immune system recognizes pathogen-associated molecules and responds through signal transduction pathways involving various genes and their products (Andersen et al., 2018). The key disease-responsive genes across tomato roots provide insight into the layered nature of resistance responses to Fol. These genes are involved in distinct stages of the immune response, from early pathogen recognition to downstream signal transduction and systemic acquired resistance (SAR). The LRR gene, which encodes an LRR receptor-like serine/threonine-protein kinase, plays a crucial role in recognizing pathogen-associated molecular patterns (Andersen et al., 2018). Prior studies have linked similar receptor genes to resistance, including CC-NBS-LRR (e.g., Solyc04g015210.2.1 and Solyc04g007050.2.1) and LRR-repeat proteins (Solyc07g066240.2.1) in tomatoes resistant to F. oxysporum f. sp. radices-lycopersici. In contrast, Solyc01g009690.1.1, a receptor-like serine/threonine gene, was found to be downregulated in susceptible genotypes, highlighting the divergent transcriptional regulation in resistant versus susceptible plants (Manzo et al., 2016). The WRKY transcription factors, which regulate defense-related genes under stress conditions, exhibit tissue- and time-specific expression. Aamir et al. (2018) reported that WRKY genes such as SolyWRKY33 and SolyWRKY37 were upregulated in tomato roots upon Fol infection, with fold increases peaking at 48 hours post-infection (hpi). In contrast, SolyWRKY4 expression was consistently suppressed in both root and leaf tissues as infection progressed, indicating its potential negative regulation under Fol stress. The pathogenesis-related (PR) proteins encoded by host plants are induced under pathological or stress-related conditions, with several PR proteins, such as PR-1, PR-2, PR-3, PR-4, and PR-5, shown to inhibit fungal growth (Sudisha et al., 2012). Among these, the PR-1 gene serves as a key marker for SAR and salicylic acid-mediated disease resistance (Breen et al., 2017). According to Aimé et al. (2008), PR-1a transcript levels in tomato leaves increased as early as 6 hpi with Fol8, peaking at 17 days. These dynamics reflect a rapid and sustained defense activation in response to pathogen presence. However, Fol’s ability to adapt and colonize xylem vessels, even in resistant plants, highlights the limitations of single-gene resistance strategies. Although resistant plants restrict pathogen movement, Fol often persists within vascular tissues, posing a potential source for disease spread (Šimkovicová et al., 2024). Additionally, Molagholizadeh et al. (2023) evaluated the resistance levels of 29 tomato cultivars/lines against Fol and identified nine cultivars as the most resistant, which were subsequently utilized as rootstocks.

Among resistance strategies, grafting has emerged as an alternative method that utilizes resistant rootstocks to control pathogens (Guan et al., 2012). Grafting involves attaching a susceptible scion to a resistant rootstock, creating a physical and biochemical barrier against pathogen invasion (Bai et al., 2022). One of the most significant advantages of grafting is its reliability and environmental safety, as it reduces reliance on chemical fungicides for managing soil-borne pathogens (Chitwood-Brown et al., 2021; Nordey et al., 2020). Resistant rootstocks not only limit Fol translocation (Awu et al., 2023; Ganiyu et al., 2018; McAvoy et al., 2012) but also improve plant vigor, yield, and tolerance to abiotic stresses such as heat (Musa et al., 2020; Nordey et al., 2020). A comprehensive meta-analysis by Grieneisen et al. (2018) synthesized global findings on grafted tomato performance and demonstrated that grafting significantly improves yield and fruit quality while reducing disease incidence and dependence on soil fumigants. Their findings emphasize that the benefits of grafting are consistent across different environmental conditions and tomato cultivars, further supporting the practice as a robust and scalable solution for sustainable tomato production.

Field evaluation of Fol resistance is critical for validating the performance of resistant rootstocks under natural conditions, where environmental factors and pathogen pressure closely mimic commercial production systems. Such evaluations assess pathogen translocation, disease severity, and defense mechanisms over time. Moreover, field trials allow a thorough examination of grafting compatibility, scion growth, fruit yield, and quality, ensuring that resistant rootstocks do not adversely affect productivity or marketability. Our previous research (Saman et al., 2022) evaluated intraspecific grafted tomatoes under greenhouse conditions and proposed field testing of grafted plants under high disease pressure. In this study, resistant rootstocks LE314, LE472, LE482, and LE501 were evaluated for their ability to restrict Fol infection at the molecular level. The grafting of susceptible scion Sidathip 3 (SDT3) onto resistant rootstocks were conducted to evaluate Fol prevention and support scion performance in field conditions. This research provides insights into the practical application of grafting as a sustainable strategy for managing Fusarium wilt while maintaining high-quality tomato production.

Materials and Methods

Plant materials and growth conditions

According to previous research by Saman et al. (2022), four Fol-resistant tomato accessions, LE314, LE472, LE482, and LE501, were used as rootstocks, while a susceptible tomato cultivar, SDT3, served as the scion. This cultivar is a table tomato type, producing small fruits measuring approximately 3 × 4 cm, with a fruit weight exceeding 20 g. Seeds of all Fol-resistant tomato accessions and the susceptible SDT3 were sown directly into 50-cell plug trays filled with a ready-to-use substrate mixture (Kekkilä Professional, Vantaa, Finland). For grafting, seed sowing of the four resistant rootstocks was conducted, and eight days later, SDT3 seeds were sown using the same method. Twenty-one-day-old seedlings at the three- to four-true-leaf stage were transplanted into 6 × 8-inch plastic pots containing a soil mixture composed of topsoil and a ready-to-use soil mix in a 2:1 ratio by volume. All seedlings were grown in a greenhouse for 30 days under natural sunlight, with day/night temperatures of 30–33°C and 25–28°C, respectively. Seedlings were watered once daily. To evaluate the impact of rootstocks on preventing Fol infection, rootstocks seedlings were inoculated with Fol to assess pathogen translocation from root to shoot and analyze gene expression. Grafting was performed later using the grafting procedure described below.

Fungal material and plant inoculation

The preparation of the pathogen Fol isolate TFPK401, race 1 and inoculation methods followed the protocol of Kawicha et al. (2023). Briefly, Fol was cultured on potato dextrose agar for 14 days, after which spores were harvested. The collected spores were quantified and prepared as a suspension at a concentration of 1 × 106 spores/mL.

For inoculation, 21-day-old rootstock and SDT3 plants were carefully uprooted, rinsed with clean water, and had 1 cm of their root tips cut. The roots were then immersed in a conidial suspension of Fol for 30 min, using the root-dip method. After inoculation, plants were transplanted into 3 × 6-inch plastic bags filled with sterile soil. For the uninoculated control, the roots of tomato plants were dipped in sterile distilled water. Plants were arranged in a completely randomized design with five replicates per treatment. They were maintained in a greenhouse under the natural sunlight and temperature of 30–33°C/25–28°C (day/night). When SDT3 plants exhibited wilting at a severity level of 5, disease symptoms were evaluated. Symptoms were assessed using a five-grade severity scale: (1) symptomless, (2) chlorotic plants, (3) chlorotic and wilting plants, (4) wilting plants, and (5) plant death (Kawicha et al., 2023; Saman et al., 2022).

Detection of Fol translocation in tomato rootstocks

Twenty-one days after inoculation (DAI), shoot, stem, and root samples were collected for Fol translocation studies. The translocation of Fol to roots, stems, and shoots was assessed using a PCR technique. Each tomato accession consisted of 5 plants. Samples were divided into two parts, underground (roots) and aboveground (stems and shoots). Infected tomato plants were carefully uprooted, and the roots were cut at the stem base, thoroughly washed with running water to remove soil particles and fungal components and dried on tissue paper. For the aboveground portion, the stem was cut 15 cm from the base to represent stem samples, while the remaining upper portion was designated as shoot samples. Leaves were removed from all the aboveground samples. All sample parts were surface sterilized with 0.05% sodium hypochlorite, rinsed with water, and air-dried before DNA extraction.

Total DNA was extracted from the sample segments using the CTAB method (Mace et al., 2003). The concentration and purity of the extracted DNA were evaluated using a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and DNA integrity was confirmed by agarose gel electrophoresis. PCR reaction was carried out to detect Fol DNA. Each 25 μL PCR reaction mixture contained 0.4 mM dNTPs, 0.4 μM SP13 primers (forward: 5′-GTCAGTCCATTGGCTCTCTC-3′ and reverse: 5′-TCCTTGACACCATCACAGAG-3′) (Hirano and Arie, 2006), 2 mM MgCl2, 1× PCR buffer (Vivantis, Subang Jaya, Malaysia), 1 unit of Taq polymerase (Vivantis), and 50 ng of template DNA. The thermal cycling conditions were set as follows: initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 60 s, annealing at 58ºC for 60 s, and elongation at 72°C for 2 min; followed by a final extension at 72°C for 7 min. The PCR amplification products were resolved using 1% agarose gel prepared in 1× TBE buffer (10.8 g Tris-base, 5.5 g boric acid, and 2 mM EDTA) with Visafe Green Gel Stain DNA dye (Vivantis) added to the agarose solution. Gel electrophoresis was performed at 100 volts for 90 min to separate the PCR products. The size of each DNA band was estimated using a 100 bp DNA ladder RTU (Bio-Helix Co., Ltd., New Taipei City, Taiwan) and photographed under an ultraviolet transilluminator. All PCR assays were performed in duplicate to validate the results.

Expression analysis of LRR, WRKY41, and PR-1 genes in tomato rootstocks

The Fol-susceptible tomato cultivar SDT3 and the resistant accessions LE314, LE472, LE482, and LE501 infected with Fol were used for gene expression analysis. Root samples from SDT3, LE314, LE472, LE482, and LE501 were collected 1, 3, 7, and 14 DAI. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the protocol described by Saman et al. (2022). Complementary DNA (cDNA) was synthesized using a 2-step RT-PCR Kit (Vivantis). The expression levels of the LRR (Solyc11g011180.1.1), WRKY41 (Solyc01g095630.2.1), and PR-1 (Solyc09g007020.1.1) genes were analyzed through qRT-PCR. The primers used for amplifying these Fol resistance-related genes and the housekeeping gene, 18S rRNA (X51576) are listed in Table 1.

Table 1.

Primers used for quantitative PCR analysis

Gene ID Sequence (5′–3′) Ta (°C) Annotation Reference
Solyc11g011180.1.1 Forward: GTCGTAGAGTTGTCCGTTATTG
Reverse: TTTCCTCAGTGGTCTCAGTTTC
60 LRR receptor-like serine/threonine-protein kinase, RLP In this study
Solyc01g095630.2.1 Forward: TCCTCATTTGGTGGAGAAGG
Reverse: TAGCTTAGGATCAATTAGGC
61 WRKY41 transcription factor Zhao et al. (2018)
Solyc09g007020.1.1 Forward: GTGCGGACATTATACTCAAG
Reverse: ACCCAATTGCCTACAGGATC
62 Pathogenesis-related protein Zhao et al. (2018)
18S rRNA Forward: GGGCATTCGTATTTCATAGTCAGA
Reverse: GTTCTTGATTAATGAAAACATCCT
60 18S rRNA Mascia et al. (2010)

To determine primer efficiency, two-fold serial dilutions were prepared using cDNA from a representative sample. Standard curves were generated, and the threshold cycle (Cq) values for the housekeeping gene (18S rRNA) and target genes were recorded. Primer efficiency was calculated using the following equation:

Efficiency=[10(-1slope)-1]×100.

For gene expression analysis, the cDNA template was diluted to a 1:2 concentration. Each qRT-PCR reaction mixture (10 μL) consisted of 1 μL of diluted cDNA, 5 μL of 2× SensiFast SYBR NO-ROX Mix (Meridian Bioscience, London, UK), 0.4 μL of each forward and reverse primer (10 μM), nuclease-free water to adjust the final volume. Reactions were performed in triplicate for each cDNA sample, with a no-template control included for each gene. All reactions were processed using the PCRmax ECO 48 Real-Time PCR system (PCRmax, Staffordshire, UK). The qRT-PCR reaction consisted of a two-step thermal cycling program including enzyme activation at 95°C for 2 min, 40 cycles of denaturation at 95°C for 5 s, and annealing/extension at 60–62°C for 20 s. After 40 cycles, dissociation curve analysis was performed to assess the presence of primer dimers and ensure the specificity of amplification. The housekeeping gene 18S rRNA was used as an internal control to normalize gene expression levels. Relative gene expressions were calculated using the 2−DDCq method (Livak and Schmittgen, 2001), as described by Mascia et al. (2010).

Grafting method

The cleft grafting method was conducted as described by Saman et al. (2022). Thirty days after germination, cultivar SDT3 (scion) was grafted onto four disease-resistant accessions, LE314, LE472, LE482, and LE501 (rootstocks). The grafted plants were kept in the evaporative greenhouse with watering twice a day and applying 20 g of dry pelleted fertilizer with N-P-K of 15-15-15 once a week until one month before transplanting to the open field.

Open field experiment and growth conditions

The experiment to evaluate the impact of disease-resistant rootstocks on Fol prevention was conducted on a farmer’s field in Sakon Nakhon Province, northeastern Thailand, during the winter seasons (November–February) of 2020–2021 and 2021–2022. Additionally, the evaluation of rootstocks grafted with the susceptible SDT3 cultivar for Fol prevention and scion performance was conducted during the winter of 2021–2022. Both experiments aligned with the farmers’ production calendar. Agricultural practices followed standard routines used by local farmers. The field had a history of soil pathogen accumulation, including Fol (Fusarium wilt) and Ralstonia solanacearum (bacterial wilt).

During each experimental period, rootstocks (LE314, LE472, LE482, and LE501) or intraspecific grafted tomato plants, including self-grafted plants (SDT3/SDT3) and heterografts (SDT3/LE314, SDT3/LE472, SDT3/LE482, and SDT3/LE501), were transplanted into the field. The experiment used a randomized complete block design with three replications (blocks), each containing 13 plants. Rootstock plants were planted in rows and distributed randomly within each block to ensure uniformity and reduce spatial bias. Additionally, SDT3 plants were used as border rows and were also randomly interspersed among treatment plots to minimize edge effects. Fourteen days after planting, a 15-15-15 (N-P-K) chemical fertilizer was applied at a rate of 4.48 kg/ha and subsequently reapplied every 15 days at the same rate. Irrigation was provided twice daily, at 7:00 AM and 4:00 PM, from the first week after transplanting until harvest. Watering was conducted through furrow irrigation between the ridges where the tomatoes were planted.

Measurements of the grafting incompatibility

The grafting incompatibility (GI) was measured between scion and rootstock at 14, 28, 35, and 49 days after grafting. The diameter of the grafting point (GP), the scion (SC), and the rootstock (RS) at 1 cm above and below the GP was measured using the formula (Zeist et al., 2018):

GI={[(GP-RS)+(GP-SC)/2]+(RS-SC)}/2

Scion growth evaluation

The effects of grafted tomatoes on various parameters were evaluated under open field conditions, including plant height (PH), measured from the base of the scion stem to the apex (cm); number of branches (NB); canopy diameter (measured the widest part of the foliage at four weeks after transplanting); fruit weight; fruit size; and total fruit yield.

Fruit quality assessment

Ripened tomato fruits of uniform size were randomly harvested from five grafted tomato plants, with 10 fruits collected per block. The following parameters, fruit color, firmness, pH, and total soluble solids (TSS) were assessed.

Fruit color

The measurement was performed at four locations on each fruit using an EZ colorimeter (Hunter Associates Laboratory Inc., Reston, VA, USA) based on the CIE system. The parameters recorded included L*, a*, and b* values, where L* represents brightness (0 = black, 100 = white), a* indicates the green-to-red spectrum (negative = green, positive = red), and b* represents the blue-to-yellow spectrum (negative = blue, positive = yellow).

Fruit firmness

The firmness was evaluated using a TA.XTplus Texture Analyzer (Stable Micro Systems, Godalming, UK) with a P/2 compression probe. Measurement settings included pre-test speed (1 mm/s), test speed (1 mm/s), post-test speed (10 mm/s), target mode (distance), distance (5 mm), trigger type (auto, force in kg), and trigger force (5 g). Firmness was measured at four points per fruit, and numerical data were recorded for analysis.

pH value

The pH of the tomato flesh was determined by thoroughly blending ten tomato fruits using a blender. The homogenized sample was measured using a digital pH meter, CyberScan pH 510 (Eutech Instruments, Thermo Fisher Scientific).

Total soluble solids

The TSS concentration was determined by thoroughly blending 10 tomato fruits. The juice extracted from the blended pulp was analyzed using a hand refractometer, and the results were expressed in degrees Brix (°Brix).

Evaluation of Fol resistance

Fol resistance in rootstocks or grafted tomatoes grown in the field were assessed based on disease incidence, disease symptoms, disease severity score (DSS), and disease severity index (DSI). The evaluation criteria followed the methodology described by Saman et al. (2022). Disease symptoms were scored using a five-grade severity scale, as follows: (1) symptomless, (2) chlorotic plants, (3) chlorotic plants with wilting, (4) wilting plants, and (5) plant death. Disease scoring was conducted when the non-graft (SDT3) and self-graft control (SDT3/SDT3) exhibited disease symptoms at a severity level of 5. The DSI was calculated using the following formula: DSI = [(SSi × Ni)/(S × Nt)] × 100, where Si is the DSS, Ni is the number of tested tomatoes Si with severity score, S is the highest DSS and Nt is the total number of tested tomatoes. The inoculated tomatoes were categorized for their Fusarium wilt resistance type based on the percentage of DSI described by Thanyasiriwat et al. (2023) as follows: 0%–20% DSI = resistant (R), 21%–40% DSI = moderately resistant (MR), 41%–60% DSI = moderately susceptible (MS), and 61%–100% DSI = susceptible (S).

Statistical analysis

An analysis of variance (ANOVA) was performed to evaluate the data from tomato accessions, including self-grafted (SDT3/SDT3) and intraspecific heterografts (SDT3/LE314, SDT3/LE472, SDT3/LE482, and SDT3/LE501) plants. The scion-rootstock interaction was analyzed between self-grafted, intraspecific heterografted combinations, and non-grafted control group for both the susceptible and resistant genotypes. The analysis was conducted using Statistix 8.0 software (Statistix, Tallahassee, FL, USA). Mean comparisons were carried out using the Tukey test, with significance set at α = 0.05.

Results

Translocation of Fol in Fol-infected resistant tomato accessions

The selected tomato accessions, including LE314, LE472, LE482, and LE501, were evaluated for resistance to Fol. All accessions were symptomless, with a DSS of 1.0, in contrast to the susceptible SDT3 cultivar (Fig. 1). The translocation of Fol was assessed using a PCR assay. Root, stem, and shoot samples from Fol-resistant tomato plants 21 DAI were collected for analysis (Fig. 2). The susceptible cultivar SDT3 exhibited systemic colonization, with Fol DNA detected in 100% of root and stem samples, and 40% of shoot samples, indicating extensive pathogen movement within the plant. Among the resistant accessions, LE314 showed partial resistance, with Fol detected in 80% of root samples, 20% of stem samples, and complete absence (0%) in shoot tissues. LE472 displayed a more variable pattern, with 40% of root and 60% of stem samples testing positive, but no detection in the shoots. In LE482, Fol DNA was present in only 20% of root and 40% of stem samples, with no detection in shoot tissues, suggesting improved restriction of vertical pathogen movement. LE501 exhibited the highest resistance, with Fol detected in only 20% of root and stem samples, and no detection in the shoot, indicating effective suppression of Fol translocation beyond the root zone. These results support the hypothesis that resistant accessions, particularly LE501, possess mechanisms that restrict Fol colonization and movement, potentially through physical or biochemical barriers.

Fig. 1.

Fig. 1

Visual response of tomato accessions to Fusarium oxysporum f. sp. lycopersici (Fol) infection. (A) Mock-inoculated plants (control group) of five tomato accessions: SDT3 (susceptible cultivar) and four accessions used as potential resistant rootstocks (LE314, LE472, LE482, and LE501). (B) Plants of the same accessions at 21 days after inoculation with Fol race 1.

Fig. 2.

Fig. 2

Detection of Fusarium oxysporum f. sp. lycopersici (Fol) DNA in tomato tissues by PCR. (A) Diagram showing tissue sections sampled for PCR detection of Fol DNA, including root (belowground), mid-stem (15 cm aboveground), and shoot (aboveground) sections. Samples were collected at 21 days after inoculation (DAI). (B) Detection of Fol DNA in roots, stems, and shoots of five tomato accessions (SDT3, LE314, LE472, LE482, and LE501). DNA was extracted from five individual plants per accession and amplified using race 1-specific SP13 primers. Black bars (■) indicate the number of samples with detectable Fol DNA; white bars (□) indicate samples without detectable DNA. Percentages above bars represent the proportion of PCR-positive samples.

Gene expression analysis revealed distinct temporal and accession-specific expression patterns in the potential tomato rootstocks

The expression of three key disease-responsive genes (LRR, WRKY41, and PR-1) was analyzed in the potential tomato rootstocks LE314, LE472, LE482, and LE501, along with the susceptible cultivar SDT3, following inoculation with Fol. Samples were collected 1, 3, 7, and 14 DAI. The temporal expression patterns of these genes varied significantly across the accessions, reflecting their differential responses to Fol infection.

LRR gene expression

The LRR gene showed distinct temporal and accession-specific expression patterns (Fig. 3A). In LE314, LRR expression peaked at 3 DAI, with a 7-fold upregulation relative to the mock plants, followed by a steady decline at 7 and 14 DAI. LE472 exhibited an early defense activation, with a 4-fold increase in expression at 1 DAI, but the levels gradually decreased to their lowest point by 14 DAI. LE482 displayed the highest LRR expression among the accessions, with a dramatic 12-fold upregulation at 3 DAI, which rapidly declined to baseline levels at 7 and 14 DAI. LE501 demonstrated a fluctuating expression profile, with 8-fold increases observed at 1 and 14 DAI, interspersed with reduced levels at 3 and 7 DAI. The susceptible cultivar SDT3 showed a peak in LRR expression at 7 DAI, with a 5-fold increase, but the levels declined sharply to their lowest point at 14 DAI.

Fig. 3.

Fig. 3

Relative expression of defense-related genes in root tissues of the susceptible cultivar SDT3, and resistant accessions, LE314, LE472, LE482, and LE501 following inoculation with Fusarium oxysporum f. sp. lycopersici (Fol). The expression levels of LRR (A), WRKY41 (B), and PR-1 (C) genes were quantified by quantitative reverse transcription polymerase chain reaction at 1, 3, 7, and 14 days after inoculation (DAI) and compared to mock-inoculated control plants. Values are presented as fold change (mean ± standard deviation) from three biological replicates. Different letters above bars indicate significant differences among time points within each treatment according to Tukey’s test (α = 0.05).

WRKY41 gene expression

Distinct differences in the expression of the WRKY41 gene were observed among the accessions (Fig. 3B). In LE314, the highest expression occurred at 7 DAI, with a 2.5-fold increase compared to the control, followed by a noticeable decrease at 14 DAI. LE472 showed a rapid and strong response, with a 3-fold upregulation at 1 DAI. This early activation was followed by a steady decline, returning to baseline levels at 3, 7, and 14 DAI. LE482 showed no significant change in WRKY41 expression at 1, 3, or 7 DAI compared to mock plants, but a marked late response was observed at 14 DAI, with a 7-fold upregulation. The expression profile in LE501 fluctuated, with WRKY41 expression increasing 4-fold at 3 DAI, dropping to 7 DAI, and then rising again to 4-fold at 14 DAI. In SDT3, WRKY41 expression was transient, with a 3-fold increase at 1 DAI, followed by a marked reduction at subsequent time points.

PR-1 gene expression

The PR-1 gene exhibited variable expression among tomato accessions in response to Fol infection (Fig. 3C). LE314 showed the highest PR-1 expression at 3 DAI, with a 9-fold increase compared to the mock plants, but the expression declined significantly at 1, 7, and 14 DAI. In LE472, an early response was observed, with a 3-fold upregulation at 1 DAI. The expression levels then decreased gradually over time, returning to baseline by 3, 7, and 14 DAI. LE482 exhibited minimal changes in PR-1 expression, with no significant difference from the mock plants at 1, 3, or 14 DAI, although a modest 2-fold increase was observed at 7 DAI. LE501 displayed the strongest response, with a 12-fold increase in PR-1 expression at 7 DAI. However, this was followed by a sharp decline to control levels at 14 DAI. In contrast, no significant differences in PR-1 expression were detected in SDT3 at any time point, indicating its lack of an effective defense response.

Rootstocks persist in combating Fol under field conditions across different planting seasons

The DSS indicated that all tested rootstock accessions (LE314, LE472, LE482, and LE501) exhibited complete resistance to Fol under field conditions across planting years (2020–2021–2021–2022), with a consistent DSS of 1.0. In contrast, the susceptible cultivar SDT3 showed severe disease symptoms, with DSS values of 4.47 in 2020–2021 and 4.59 in 2021–2022. Statistical analysis showed that the differences in DSS between the years were not significant (P = 0.35), indicating stable disease pressure across seasons. The rootstock was highly significant (P = 0.00), confirming that resistance levels were dependent on genotype. The interaction between year and rootstock (Y × R) was also not significant (P = 0.48), suggesting that the resistance observed in the rootstocks were consistent across different planting years (Table 2).

Table 2.

Disease severity scores (mean ± SD) of rootstock accessions and the Fol-susceptible SDT3 cultivar exposed to Fol under field conditions across different planting years

Rootstocks Disease severity score

Year 2020–2021 Year 2021–2022
LE314 1.0 ± 0.0 b 1.0 ± 0.0 b
LE472 1.0 ± 0.0 b 1.0 ± 0.0 b
LE482 1.0 ± 0.0 b 1.0 ± 0.0 b
LE501 1.0 ± 0.0 b 1.0 ± 0.0 b
SDT3 (Fol-susceptible cultivar) 4.47 ± 0.5 a 4.59 ± 0.6 a
Year (Y) 0.35
Rootstocks (R) 0.00
Y × R 0.48

Three replicates (blocks) were taken to calculate the mean disease severity score. Different letters above each line and column indicate statistically significant differences (α = 0.05) according to Tukey’s test.

SD, standard deviation; Fol, Fusarium oxysporum f. sp. lycopersici.

Intraspecific grafting of susceptible scion SDT3 with rootstocks enhanced resistance to Fol under high Fol pressure field conditions

The susceptible cultivar SDT3 (scion) was grafted onto tomato rootstock accessions LE314, LE472, LE482, and LE501 to evaluate resistance to Fol. Self-grafted (SDT3/SDT3), intraspecific heterografted (SDT3/LE314, SDT3/LE472, SDT3/LE482, and SDT3/LE501), and non-grafted tomatoes were naturally exposed to Fol in the field. The evaluation revealed that all intraspecific heterografted tomatoes remained symptomless, in contrast to the self-grafted tomatoes, which displayed severe disease symptoms. Furthermore, all intraspecific heterografted tomatoes exhibited significantly reduced Fol disease severity. The heterografted plants achieved a DSS of 1 and a DSI of 0%, compared to self-grafted plants, which had a DSS of 5 and a DSI of 95% (Fig. 4).

Fig. 4.

Fig. 4

Disease resistance evaluation of grafted tomatoes under field conditions naturally infested with Fusarium oxysporum f. sp. lycopersici (Fol). The figure shows visual disease symptoms and quantifies disease severity scores (DSS, scale 1–5) and disease severity index (DSI, %) in self-grafted (SDT3/SDT3) and intraspecific heterografted combinations (SDT3/LE314, SDT3/LE472, SDT3/LE482, and SDT3/LE501). Values represent means ± standard deviation. Different letters indicate significant differences in DSS among treatments based on Tukey’s test (α = 0.05).

Intraspecific grafted tomatoes exhibited grafting compatibility between scion and rootstock under field conditions

GI was measured 14, 28, 35, and 49 days after transplanting (DAT). An increase in GI was observed across all grafted tomatoes, ranging from an average of 0.08–0.11 units at 14 DAT to 0.28–0.33 units at 49 DAT. Statistical analysis indicated no significant differences in GI among all grafted combinations. However, self-grafted plants exhibited slightly lower GI values compared to heterografted combinations (Fig. 5A). Notably, a 100% grafting success rate was achieved for self-grafted and heterografted tomatoes (Fig. 5B).

Fig. 5.

Fig. 5

Grafting compatibility assessment between the susceptible scion SDT3 and four resistant tomato rootstock accessions (LE314, LE472, LE482, and LE501). (A) Grafting incompatibility (GI) values measured at 14, 28, 35, and 49 days after transplanting (DAT). Bars represent mean ± standard deviation. No significant differences in GI were observed among graft combinations throughout the measurement period. (B) Representative images of graft unions at 49 DAT showing successful vascular connections (indicated by white arrows) in both self-grafted (SDT3/SDT3) and heterografted plants. All combinations showed proper graft union formation, indicating high compatibility.

Intraspecific grafting in tomatoes maintains scion growth and yield under field conditions

Scion growth

The scion SDT3, grafted onto itself (self-graft) and different rootstock accessions (heterografts), was evaluated for PH, NB, and canopy diameter at 14, 28, 35, and 49 DAT. No significant differences were observed in PH between self-grafted and heterografted tomatoes, with an average height of 85.17–89.58 cm at 49 DAT (Fig. 6A). Similarly, NB ranged from 14.50 to 15.75 at 49 DAT (Fig. 6B), and canopy diameter averaged between 58.16 and 63.33 cm at 49 DAT, with no significant differences across treatments (Fig. 6C).

Fig. 6.

Fig. 6

Scion growth performance in self- and heterografted tomatoes under field conditions. Plant height (cm) (A), number of branches (B), and canopy diameter (cm) (C) of the susceptible cultivar SDT3 grafted onto itself (SDT3/SDT3) or onto four resistant rootstock accessions (LE314, LE472, LE482, and LE501). Measurements were taken at 14, 28, 35, and 49 days after transplanting. Bars represent mean ± standard deviation. No significant differences were observed among treatments, indicating that grafting did not adversely affect scion vegetative growth.

Fruit size and yield

The fruit size ranged from 3.24–3.40 cm in width and 3.57–3.82 cm in length, while the fruit yield averaged 1.63–2.43 kg/plant (21.4–31.9 tons/ha). No statistically significant differences were observed between self-grafted and heterografted plants (Table 3).

Table 3.

Fruit size (cm), and fruit yield (kg/plant and ton/ha) of self-grafted and intraspecific grafted tomatoes

Scion/rootstock combination Fruit size (cm) Fruit yield, kg/plant (t/ha)

Width (W) Length (L)
SDT3/SDT3 3.24 ± 0.35 3.57 ± 0.24 1.72 ± 0.61 (22.6)
SDT3/LE314 3.30 ± 0.24 3.78 ± 0.27 1.95 ± 0.41 (25.6)
SDT3/LE472 3.40 ± 0.25 3.82 ± 0.21 2.43 ± 0.12 (31.9)
SDT3/LE482 3.27 ± 0.18 3.79 ± 0.21 1.67 ± 0.15 (22.0)
SDT3/LE501 3.34 ± 0.18 3.73 ± 0.18 1.63 ± 0.10 (21.4)
F ns ns ns
C.V. (%) 7.42 5.89 18.27

F, the probability of F statistic from ANOVA; ns, nonsignificant differences; C.V., coefficient of variation.

Fruit quality is influenced by both rootstock genotype and scion-rootstock interactions

To assess the influence of grafting and rootstock genotype on tomato fruit quality, 6 parameters including pH, TSS, firmness, and color traits (L*, a*, and b*), were compared among self-grafted SDT3, heterografted combinations, non-grafted SDT3, and non-grafted resistant accessions used as rootstocks (Figs. 7 and 8). The comparison of fruit pH among non-grafted SDT3, self-grafted SDT3, and heterografted combinations revealed no significant differences between the grafted treatments, with all showing similar pH values (Fig. 7A). In contrast, the non-grafted resistant rootstock accessions produced fruit with significantly lower pH values in LE472 and LE482, while LE501 exhibited a higher pH than all other groups. It is important to note that in grafted plants, the fruit quality reflects the scion genotype (SDT3) with potential modulation by the rootstock, whereas in non-grafted rootstock plants, the fruit traits directly reflect the inherent genotype of each accession. This distinction highlights the biological differences between grafted and non-grafted fruit production.

Fig. 7.

Fig. 7

Comparison of fruit quality parameters between two distinct groups: (1) the scion and grafted combinations (comprising non-grafted SDT3, self-grafted SDT3, and heterografted combinations) and (2) the non-grafted resistant rootstocks. Fruit pH (A), total soluble solids (°Brix) (B), and firmness (kg) (C). This analysis was designed to distinguish the effects of scion-rootstock interactions from the inherent fruit characteristics of the rootstocks themselves. Mean comparisons were performed using Tukey’s test, with significance set at α = 0.05. Different letters above bars indicate statistically significant differences.

Fig. 8.

Fig. 8

Comparison of fruit color (L*, a*, and b*) between two distinct groups: (1) the scion and grafted combinations (comprising non-grafted SDT3, self-grafted SDT3, and heterografted combinations) and (2) the non-grafted resistant rootstocks. This analysis was designed to distinguish the effects of scion-rootstock interactions from the inherent fruit characteristics of the rootstocks themselves. Mean comparisons were performed using Tukey’s test, with significance set at α = 0.05. Different letters above bars indicate statistically significant differences.

The TSS content of tomato fruits varied significantly among the evaluated groups (Fig. 7B). The non-grafted SDT3 scion exhibited an intermediate TSS value (~5.0°Brix), which was significantly higher than that of the self-grafted SDT3 (SDT3/SDT3), indicating that self-grafting slightly reduced fruit sweetness. In contrast, the heterografted combinations maintained TSS values that were significantly higher than the self-grafted SDT3 and comparable to or slightly exceeding the non-grafted SDT3 control. This suggests that heterografting not only preserved but potentially enhanced fruit sweetness relative to self-grafting. In the non-grafted rootstock group, clear genotype effects were observed: LE314 produced the highest TSS, followed by LE501, LE482, and LE472, with all rootstock fruits differing significantly from both grafted and non-grafted SDT3. These findings highlight that both grafting type and genotype contribute to TSS variability. Self-grafting may negatively impact this quality trait, while heterografting with resistant rootstocks sustains or improves sweetness.

Fruit firmness significantly differed across the tested groups (Fig. 7C). In the grafted tomatoes, significant differences were observed between the self-grafted SDT3 (SDT3/SDT3) and some heterografted combinations, with heterografting onto resistant rootstocks such as LE482 and LE501 resulting in significantly higher fruit firmness. All grafted plants exhibited higher firmness than the non-grafted SDT3 control. In contrast, the non-grafted resistant rootstocks produced fruits with higher firmness values, with LE501 showing the firmest fruits. These results suggest that grafting SDT3 onto resistant rootstocks enhances fruit firmness over non-grafted SDT3, but that the intrinsic genotype of the rootstock independently influences this trait when grown as individual plants.

Fruit color parameters, including L* (lightness), a* (red-green), and b* (yellow-blue), were assessed across non-grafted SDT3, self-grafted SDT3 (SDT3/SDT3), heterografted combinations, and non-grafted resistant rootstocks. Overall, grafting had limited effects on fruit color, with only minor variations observed among genotypes (Fig. 8). For the L* value, no overall trend was detected among grafted tomatoes. However, a significant difference was observed between the heterografted combinations SDT3/LE314 and SDT3/LE482, with SDT3/LE314 exhibiting lower L* values, indicative of slightly darker fruit. Despite this difference, most grafted treatments produced fruits with comparable lightness. In terms of a* values, which reflect the red coloration of the fruit, SDT3/LE314 exhibited significantly higher redness compared to SDT3/LE472. This suggests that specific rootstock genotypes may subtly influence the intensity of red pigmentation in the scion’s fruit. The b* values, representing yellowness, did not differ significantly across any grafted combinations or non-grafted controls, indicating that this color attribute remained stable regardless of grafting. In contrast, the non-grafted resistant rootstocks displayed distinct L*, a*, and b* values, highlighting inherent genetic variation in fruit color when these accessions were grown independently. Collectively, these results suggest that while scion fruit color remains largely unaffected by grafting, certain rootstock genotypes can induce minor but statistically significant changes in specific color parameters.

Discussion

The impact of tomato Fol-resistant rootstock accessions

The translocation of Fol in tomatoes reveals resistance mechanisms and highlights the role of toxins in disease progression. Proposed mechanisms include nutrient competition, root necrosis, vascular blockage, and toxin production (Davis, 1954). Using tomato rootstocks grafted with various solanaceous scions, Davis (1954) demonstrated that Fol-induced symptoms, such as wilting and vascular discoloration, appeared in non-tomato scions before in tomato stock, despite the pathogen’s absence in these tissues. This supports the hypothesis that a translocated toxin, rather than the pathogen itself, drives disease symptoms. Previous studies have shown that while immune responses are activated, Fol can colonize the xylem in resistant tomatoes but remains confined to the vessels without causing disease symptoms (Šimkovicová et al., 2024). Similar to this study, LE501 exhibited the lowest detection in both roots and stems, indicating the strongest resistance, possibly due to effective structural barriers or enhanced immune responses such as SAR (Beckman, 2000; Takken and Rep, 2010). Interestingly, no Fol DNA was detected in the shoot tissues of any resistant accession, whereas 40% of SDT3 (susceptible) samples showed Fol presence in shoots. This suggests that resistant rootstocks are capable of restricting pathogen movement beyond the stem, likely through xylem reinforcement mechanisms like tyloses or callose deposition (Beckman, 2000) or biochemical defenses (Di Pietro et al., 2003). These results reinforce the view that resistance to vascular wilt pathogens like Fol is quantitative and based on multilayered defense mechanisms that limit, rather than eliminate, pathogen spread (Šimkovicová et al., 2024; Takken and Rep, 2010). The containment of Fol in lower plant tissues by resistant rootstocks plays a crucial role in preventing systemic wilt and maintaining plant health and yield under high disease pressure. Resistance to Fol in tomatoes is primarily localized in the roots. Although the fungus can move beyond the roots into the stem’s xylem, the plants do not consistently exhibit foliar symptoms, and no inhibitory substances are produced in the xylem to stop its progression (Chitwood-Brown et al., 2021). In contrast, the susceptibility of SDT3, evidenced by wilting and the presence of Fol in its stems, highlights its failure to prevent systemic colonization (Ferreira et al., 2006). Consistent with the findings of Van der Does et al. (2019), fungal colonization in diseased susceptible tomatoes was observed at an average height of up to 12 cm from the ground, whereas in resistant plants, colonization was limited to a lower height of up to 9 cm.

The transcriptional responses of tomato rootstocks to Fol infection revealed diverse, genotype-specific resistance mechanisms. While all resistant accessions upregulated key defense-related genes, the magnitude and timing of expression differed markedly. LE482 exhibited the strongest early induction of the LRR gene, consistent with effective pathogen recognition and rapid immune activation, aligning with prior studies on early LRR-mediated resistance (Andersen et al., 2018; Manzo et al., 2016). In contrast, LE472 showed a transient LRR response with moderate expression of WRKY41 and PR-1, suggesting a weaker or short-lived defense. LE314 displayed balanced and coordinated upregulation across all three genes, indicative of a stable and sustained immune response. Notably, LE501 exhibited a pronounced late induction of PR-1 at 7 DAI, pointing to a strong salicylic acid-dependent SAR. This aligns with previous findings that link PR-1 expression to durable resistance (Aimé et al., 2008; Breen et al., 2017; Sudisha et al., 2012). The superior resistance performance of LE501 in both greenhouse and field conditions may be attributed to this robust SAR activation. Collectively, these results support the notion that resistance to vascular wilt pathogens like Fol involves multilayered defenses, ranging from early recognition (e.g., LE482), transcriptional regulation (e.g., LE472), to systemic immunity (e.g., LE501), underscoring the value of leveraging diverse immune pathways in grafted tomato systems for enhanced disease resistance.

Fol-resistant rootstocks protect a susceptible scion from Fusarium wilt and maintain scion productivity and fruit quality

Successful grafting can be influenced by several factors, including scion and rootstock compatibility, grafting techniques, and environmental conditions (Tedesco et al., 2022). Compatibility between scion and rootstock is particularly crucial for ensuring grafting success and optimal plant performance. For example, Shrestha et al. (2022) reported that the productivity and success of cantaloupe grafting in a Mediterranean climate strongly depend on the compatibility of the grafted components. Similarly, Awu et al. (2023) noted that differences in rootstock selection and temperature conditions significantly affected the success rate of intraspecific tomato grafting. In Solanaceous plants, Kawaguchi et al. (2008) investigated various graft combinations, including tomato, eggplant, and pepper, and concluded that only tomato/tomato grafts achieved proper fusion, allowing for efficient nutrient, water, and assimilate transfer, which maintained fruit production. These studies highlight the critical importance of scion-rootstock compatibility in ensuring grafting success and optimizing plant performance. Our results demonstrated a uniform grafting success rate of 100% and stable GI values across self-grafted and heterografted combinations, emphasizing the high compatibility of the scion with all tested rootstocks. The minor differences in GI between self-grafted and heterografted plants were statistically insignificant, confirming that graft union formation was not adversely affected.

The findings of this research highlight the effectiveness of intraspecific heterografting in mitigating the impact of Fol in tomato production while maintaining scion growth, yield, and fruit quality. Interestingly, the intraspecific heterografted tomatoes displayed complete resistance to Fol, remaining symptomless under field conditions. These results underscore the pivotal role of resistant rootstocks in preventing Fol infection by limiting pathogen colonization and translocation effectively. In contrast, self-grafted plants exhibited severe disease symptoms, emphasizing the susceptibility of the SDT3 cultivar without the support of resistant rootstocks. This highlights the significance of rootstock-mediated resistance, which is likely facilitated by localized defense mechanisms and structural barriers that restrict pathogen spread. Previous studies have shown that interspecific grafting, where Solanum lycopersicum (scion) is grafted onto S. macrocarpon and S. torvum, leads to moderate susceptibility (20%–40%) to Fusarium oxysporum under field conditions, compared to non-grafted plants, which exhibit 50–100% susceptibility. Both rootstocks effectively delayed the onset of Fusarium wilt, extending the disease-free period from the first week to the sixth week after transplanting. Additionally, they significantly reduced disease incidence and severity in naturally infected fields (Awu et al., 2023). Moreover, Fernandes et al. (2022) developed five intraspecific hybrids of Solanum lycopersicum (FOX1 to FOX5) and assessed their agronomic traits and resistance to Fol races 1, 2, 3, and a mixture of these races. FOX1 and FOX4, both containing the I-3 resistance gene, exhibited resistance to all Fol races and the race mixture but lacked desirable agronomic traits. Nevertheless, they were recommended for use as rootstocks for the cherry tomato cultivar Sweet Heaven to manage Fusarium wilt effectively. Besides, intraspecific grafting of susceptible heirloom tomato scions onto disease-resistant rootstocks has proven to be an effective strategy for managing soil-borne diseases, as demonstrated in naturally infested soils where Fusarium wilt was fully controlled (Rivard and Louws, 2008). Furthermore, while the greenhouse experiments utilized a defined Fol race 1 strain for consistency, the field evaluations were conducted in naturally infested soil likely harbouring a diverse population of Fol strains. The absence of disease symptoms in heterografted tomatoes under these conditions suggests that the resistant rootstocks provide effective and potentially durable protection against a broader spectrum of Fol variants.

Furthermore, this study revealed that scion growth parameters, including PH, NB, and canopy diameter, showed no significant differences between self- and heterografted tomatoes, indicating that the rootstocks did not negatively affect the vegetative growth of the scion. The consistency in fruit size, and yield across all treatments demonstrates that grafting with resistant rootstocks does not compromise the productivity or marketability of the scion. Recent studies have highlighted that vegetable grafting not only enhances resistance to biotic and abiotic stresses but also has the potential to influence fruit quality through complex rootstock-scion interactions. For example, grafting studies using the cultivated tomato ‘Moneymaker’ and wild Solanum pimpinellifolium demonstrated that sugars, acids, and volatiles in tomato fruits can be modulated by the choice of rootstock, with different metabolites showing distinct responses depending on the graft combination and method (Zhou et al., 2022). These metabolic alterations have been linked to the movement of mobile mRNAs associated with metabolic regulation across graft junctions. Consistent with these findings, our study revealed that fruit quality parameters such as total TSS and firmness were moderately influenced by scion-rootstock interactions, whereas pH and color remained stable. Supporting these findings, Ganiyu et al. (2018) observed that intraspecific grafted tomatoes positively influenced scion growth and fruit quality, with a significant yield increase during both early and late planting seasons. Similarly, previous report (Gong et al., 2022) suggested that rootstocks can subtly influence fruit traits, but scion characteristics and environmental factors often have a greater impact. Careful rootstock selection can therefore support both disease resistance and stable fruit quality in grafted tomato production systems. Other studies (Fernandes et al., 2022) demonstrated that the grafting of cherry tomato Sweet Heaven onto Fol-resistant rootstocks did not adversely affect growth, gas exchange, yield, or fruit quality. However, the fruits exhibited a reduction in firmness, fruit pulp pH, and TSS. Similarly, Awu et al. (2023) reported that in naturally infested field conditions, the chlorophyll content and photosynthetic rate of non-grafted plants decreased, whereas grafted plants demonstrated increased fruit yield compared to their non-grafted counterparts.

Concluding remarks

Fol-resistant tomato rootstock accessions, including LE501, LE482, LE472, and LE314, play a critical role in managing Fol-induced wilt. These rootstocks limit pathogen colonization and translocation while enhancing scion defense through the activation of SAR and localized immune responses. The upregulation of key genes like LRR, WRKY41, and PR-1 highlights their molecular defense mechanisms. Field evaluations confirm that resistant rootstocks significantly reduce disease severity and maintain scion growth, and yield. Importantly, this study highlights that specific fruit quality traits, particularly TSS and fruit firmness are influenced by scion-rootstock interactions, while fruit pH and color remain largely stable across grafted treatments. These findings suggest that resistant rootstocks can modulate certain aspects of fruit quality beyond their role in disease control. The integration of Fol-resistant rootstock accessions into tomato production systems offers a sustainable solution to manage Fusarium wilt while maintaining high productivity. Future research should focus on elucidating the molecular pathways involved in resistance and optimizing grafting strategies to further enhance disease management.

Footnotes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research project was financially supported by Mahasarakham University (MSU) (Grant No. 6801030/2568); and the Kasetsart University Research and Development Institute (KURDI) under Grant FF(KU)19.56. The authors express their gratitude to the Faculty of Natural Resources and Agro-Industry, Kasetsart University, Chalermphrakiat Sakon Nakhon Province Campus, for their support and research facilitation. Special thanks to Miss Somporn Wongpakdee for her assistance in preparing tomato materials and conducting Fol inoculation.

References

  1. Aamir M., Singh V. K., Dubey M. K., Kashyap S. P., Zehra A., Upadhyay R. S., Singh S. Structural and functional dissection of differentially expressed tomato WRKY transcripts in host defense response against the vascular wilt pathogen (Fusarium oxysporum f. sp. lycopersici) PLoS ONE. 2018;13:e0193922. doi: 10.1371/journal.pone.0193922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aimé S., Cordier C., Alabouvette C., Olivain C. Comparative analysis of PR gene expression in tomato inoculated with virulent Fusarium oxysporum f. sp. lycopersici and the biocontrol strain F. oxysporum Fo47. Physiol. Mol. Plant Pathol. 2008;73:9–15. [Google Scholar]
  3. Ajilogba C. F., Babalola O. O. Integrated management strategies for tomato Fusarium wilt. Biocontrol Sci. 2013;18:117–127. doi: 10.4265/bio.18.117. [DOI] [PubMed] [Google Scholar]
  4. Ali M. Y., Sina A. A. I., Khandker S. S., Neesa L., Tanvir E. M., Kabir A., Khalil M. I., Gan S. H. Nutritional composition and bioactive compounds in tomatoes and their impact on human health and disease: a review. Foods. 2020;10:45. doi: 10.3390/foods10010045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Andersen E. J., Ali S., Byamukama E., Yen Y., Nepal M. P. Disease resistance mechanisms in plants. Genes. 2018;9:339. doi: 10.3390/genes9070339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Awu J. E., Nyaku S. T., Amissah J. N., Okorley B. A., Agyapong P. J. A., Doku F. E., Nkansah G. O. Grafting for sustainable management of Fusarium wilt disease in tomato production in Ghana. J. Agric. Food Res. 2023;14:100710. [Google Scholar]
  7. Bai D., Li Z., Gu S., Li Q., Sun L., Qi X., Fang J., Zhong Y., Hu C. Effects of kiwifruit rootstocks with opposite tolerance on physiological responses of grafting combinations under waterlogging stress. Plants. 2022;11:2098. doi: 10.3390/plants11162098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Beckman C. H. Phenolic-storing cells: keys to programmed cell death and periderm formation in wilt disease resistance and in general defence responses in plants? Physiol. Mol. Plant Pathol. 2000;57:101–110. [Google Scholar]
  9. Breen S., Williams S. J., Outram M., Kobe B., Solomon P. S. Emerging insights into the functions of pathogenesis-related protein 1. Trends Plant Sci. 2017;22:871–879. doi: 10.1016/j.tplants.2017.06.013. [DOI] [PubMed] [Google Scholar]
  10. Castaldi S., Petrillo C., Donadio G., Piaz F. D., Cimmino A., Masi M., Evidente A., Isticato R. Plant growth promotion function of Bacillus sp. strains isolated from salt-pan rhizosphere and their biocontrol potential against Macrophomina phaseolina. Int. J. Mol. Sci. 2021;22:3324. doi: 10.3390/ijms22073324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chitwood-Brown J., Vallad G. E., Lee T. G., Hutton S. F. Breeding for resistance to fusarium wilt of tomato: a review. Genes. 2021;12:1673. doi: 10.3390/genes12111673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Davis D. The use of intergeneric grafts to demonstrate toxins in the Fusarium wilt disease of tomato. Am. J. Bot. 1954;41:395–398. [Google Scholar]
  13. Di Pietro A., Madrid M. P., Caracuel Z., Delgado-Jarana J., Roncero M. I. G. Fusarium oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Mol. Plant Pathol. 2003;4:315–325. doi: 10.1046/j.1364-3703.2003.00180.x. [DOI] [PubMed] [Google Scholar]
  14. Fernandes R. H., da Silva D. J. H., Delazari F. T., Lopes E. A. Screening of tomato hybrids for resistance to Fusarium wilt. Crop Breed. Appl. Biotechnol. 2022;22:e43352248. [Google Scholar]
  15. Ferreira R. B., Monteiro S., Freitas R., Santos C. N., Chen Z., Batista L. M., Duarte J., Borges A., Teixeira A. R. Fungal pathogens: the battle for plant infection. Crit. Rev. Plant Sci. 2006;25:505–524. [Google Scholar]
  16. Ganiyu S. A., Popoola A. R., Enikuomehin O. A., Bodunde J. G. Influence of grafting on growth and yield performance of two tomato cultivars grown in open field in Nigeria. J. Plant Pathol. 2018;100:43–50. [Google Scholar]
  17. Gong T., Brecht J. K., Hutton S. F., Koch K. E., Zhao X. Tomato fruit quality is more strongly affected by scion type and planting season than by rootstock type. Front. Plant Sci. 2022;13:948556. doi: 10.3389/fpls.2022.948556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gonzalez-Cendales Y., Catanzariti A.-M., Baker B., Mcgrath D. J., Jones D. A. Identification of I-7 expands the repertoire of genes for resistance to Fusarium wilt in tomato to three resistance gene classes. Mol. Plant Pathol. 2016;17:448–463. doi: 10.1111/mpp.12294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gordon T. R. Fusarium oxysporum and the Fusarium wilt syndrome. Annu. Rev. Phytopathol. 2017;55:23–39. doi: 10.1146/annurev-phyto-080615-095919. [DOI] [PubMed] [Google Scholar]
  20. Grieneisen M. L., Aegerter B. J., Scott Stoddard C., Zhang M. Yield and fruit quality of grafted tomatoes, and their potential for soil fumigant use reduction: a meta-analysis. Agron. Sustain. Dev. 2018;38:29. [Google Scholar]
  21. Guan W., Zhao X., Hassell R., Thies J. Defense mechanisms involved in disease resistance of grafted vegetables. HortScience. 2012;47:164–170. [Google Scholar]
  22. Hirano Y., Arie T. PCR-based differentiation of Fusarium oxysporum ff. sp. lycopersici and radicis-lycopersici and races of F. oxysporum f. sp. lycopersici. J. Gen. Plant Pathol. 2006;72:273–283. [Google Scholar]
  23. Kawaguchi M., Taji A., Backhouse D., Oda M. Anatomy and physiology of graft incompatibility in solanaceous plants. J. Hortic. Sci. Biotechnol. 2008;83:581–588. [Google Scholar]
  24. Kawicha P., Tongyoo P., Wongpakdee S., Rattanapolsan L., Duangjit J., Chunwongse J., Suwor P., Sangdee A., Thanyasiriwat T. Genome-wide association study revealed genetic loci for resistance to fusarium wilt in tomato germplasm. Crop Breed. Appl. Biotechnol. 2023;23:e43532311. [Google Scholar]
  25. Livak K. J., Schmittgen T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  26. Mace E. S., Buhariwalla K. K., Buhariwalla H. K., Crouch J. H. A high-throughput DNA extraction protocol for tropical molecular breeding programs. Plant Mol. Biol. Rep. 2003;21:459–460. [Google Scholar]
  27. Manzo D., Ferriello F., Puopolo G., Zoina A., D’Esposito D., Tardella L., Ferrarini A., Ercolano M. R. Fusarium oxysporum f. sp. radicis-lycopersici induces distinct transcriptome reprogramming in resistant and susceptible isogenic tomato lines. BMC Plant Biol. 2016;16:53. doi: 10.1186/s12870-016-0740-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mascia T., Santovito E., Gallitelli D., Cillo F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010;11:805–816. doi: 10.1111/j.1364-3703.2010.00646.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. McAvoy T., Freeman J. H., Rideout S. L., Olson S. M., Paret M. L. Evaluation of grafting using hybrid rootstocks for management of bacterial wilt in field tomato production. HortScience. 2012;47:621–625. [Google Scholar]
  30. Michielse C. B., Rep M. Pathogen profile update: Fusarium oxysporum. Mol. Plant Pathol. 2009;10:311–324. doi: 10.1111/j.1364-3703.2009.00538.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Molagholizadeh F., Hajianfar R., Saremi H., Moghadam A. A. Evaluation of tomato rootstocks resistant to the fungal wilt disease caused by Fusarium oxysporum f. sp. lycopersiciAustralas. Plant Pathol. 2023;52:195–205. [Google Scholar]
  32. Musa I., Rafii M. Y., Ahmad K., Ramlee S. I., Md Hatta M. A., Oladosu Y., Muhammad I., Chukwu S. C., Mat Sulaiman N. N., Ayanda A. F., Halidu J. Effects of grafting on morphophysiological and yield characteristic of eggplant (Solanum melongena L.) grafted onto wild relative rootstocks. Plants. 2020;9:1583. doi: 10.3390/plants9111583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Nordey T., Schwarz D., Kenyon L., Manickam R., Huat J. Tapping the potential of grafting to improve the performance of vegetable cropping systems in sub-Saharan Africa: a review. Agron. Sustain. Dev. 2020;40:23. [Google Scholar]
  34. Pengproh R., Thanyasiriwat T., Sangdee K., Saengprajak J., Kawicha P., Sangdee A. Evaluation and genome mining of Bacillus stercoris isolate B.PNR1 as potential agent for fusarium wilt control and growth promotion of tomato. Plant Pathol. J. 2023;39:430–448. doi: 10.5423/PPJ.OA.01.2023.0018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Planas-Marquès M., Kressin J. P., Kashyap A., Panthee D. R., Louws F. J., Coll N. S., Valls M. Four bottlenecks restrict colonization and invasion by the pathogen Ralstonia solanacearum in resistant tomato. J. Exp. Bot. 2020;71:2157–2171. doi: 10.1093/jxb/erz562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rivard C. L., Louws F. J. Grafting to manage soilborne diseases in heirloom tomato production. HortScience. 2008;43:2104–2111. [Google Scholar]
  37. Saman P., Kawicha P., Sangdee A., Wongpakdee S., Rattanapolsan L., Ponpang-Nga P., Suwor P., Thanyasiriwat T. Grafting compatibility, scion growth, and Fusarium wilt disease incidence of intraspecific grafted tomato. J. Hortic. Res. 2022;30:95–104. [Google Scholar]
  38. Shrestha S., Mattupalli C., Miles C. Effect of grafting compatibility on fruit yield and quality of cantaloupe in a mediterranean-type climate. Horticulturae. 2022;8:888. [Google Scholar]
  39. Šimkovicová M., Kramer G., Rep M., Takken F. L. W. Tomato R-gene-mediated resistance against Fusarium wilt originates in roots and extends to shoots via xylem to limit pathogen colonization. Front. Plant Sci. 2024;15:1384431. doi: 10.3389/fpls.2024.1384431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Song W., Zhou L., Yang C., Cao X., Zhang L., Liu X. Tomato Fusarium wilt and its chemical control strategies in a hydroponic system. Crop Prot. 2004;23:243–247. [Google Scholar]
  41. Srinivas C., Devi D. N., Murthy K. N., Mohan C. D., Lakshmeesha T. R., Singh B., Kalagatur N. K., Niranjana S. R., Hashem A., Alqarawi A. A., Tabassum B., Abd_Allah E. F., Nayaka S. C., Srivastava R. K. Fusarium oxysporum f. sp. lycopersici causal agent of vascular wilt disease of tomato: biology to diversity—a review. Saudi J. Biol. Sci. 2019;26:1315–1324. doi: 10.1016/j.sjbs.2019.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sudisha J., Sharathchandra R. G., Amruthesh K. N., Kumar A., Shetty H. S. Pathogenesis related proteins in plant defense response. In: Mérillon J., Ramawat K. G., editors. Plant defence: biological control. Springer; Dordrecht, The Netherlands: 2012. pp. 379–403. [Google Scholar]
  43. Takken F., Rep M. The arms race between tomato and Fusarium oxysporum. Mol. Plant Pathol. 2010;11:309–314. doi: 10.1111/j.1364-3703.2009.00605.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tedesco S., Fevereiro P., Kragler F., Pina A. Plant grafting and graft incompatibility: a review from the grapevine perspective. Sci. Hortic. 2022;299:111019. [Google Scholar]
  45. Thanyasiriwat T., Tongyoo P., Saman P., Suwor P., Sangdee A., Kawicha P. Genetic loci associated with Fusarium wilt resistance in tomato (Solanum lycopersicum L.) discovered by genome-wide association study. Plant Breed. 2023;142:788–797. [Google Scholar]
  46. Van der Does H. C., Constantin M. E., Houterman P. M., Takken F. L. W., Cornelissen B. J. C., Haring M. A., van der Burg H. A., Rep M. Fusarium oxysporum colonizes the stem of resistant tomato plants, the extent varying with the R-gene present. Eur. J. Plant Pathol. 2019;154:55–65. [Google Scholar]
  47. Zeist A. R., Giacobbo C. L., da Silva Neto G. F., Zeist R. A., Dorneles K. R., de Resende J. T. V. Compatibility of tomato cultivar Santa Cruz Kada grafted on different Solanaceae species and control of bacterial wilt. Hortic. Bras. 2018;36:377–381. [Google Scholar]
  48. Zhao M., Ji H.-M., Gao Y., Cao X.-X., Mao H.-Y., Ouyang S.-Q., Liu P. An integrated analysis of mRNA and sRNA transcriptional profiles in tomato root: insights on tomato wilt disease. PLoS ONE. 2018;13:e0206765. doi: 10.1371/journal.pone.0206765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhou Z., Yuan Y., Wang K., Wang H., Huang J., Yu H., Cui X. Rootstock-scion interactions affect fruit flavor in grafted tomato. Hortic. Plant J. 2022;8:499–510. [Google Scholar]

Articles from The Plant Pathology Journal are provided here courtesy of The Korean Society of Plant Pathology

RESOURCES