Preparation and enzymatic activity analysis of rChiA-DP derived from the Bacillus proteolyticus IMH/B-1 Strain isolated from Dermacentor nuttalli

Abstract

This study aimed to clone and express chitinase genes from Bacillus proteolyticus strains and characterize the enzymatic properties of recombinant enzymes. Bacillus proteolyticus was isolated from the body of Dermacentor nuttalli and renamed IMH/B-1. Chitin-degrading enzymes were screened via clear zone assay and PCR. The chitinase A gene (ChiA) was successfully cloned, and the recombinant plasmid pET28a-rChiA-DP (Dermatestor-derived Protein) was constructed. Recombinant chitinase protein (rChiA-DP) was expressed in Escherichia coli BL21 using IPTG induction and purified by nickel-nitrilotriacetic acid (Ni–NTA) affinity chromatography. Bioinformatic tools were used to predict the rChiA-DP protein sequences, analyse its enzyme family classification, and identify key amino acid residues in its catalytic domain. The enzymatic activity of rChiA-DP, along with its nematode resistance and antifungal effects on Caenorhabditis elegans (C. elegans) and fungi (Aspergillus sp.), was assessed under varied temperatures, pH, metal ions, salt concentrations and substrates. The amino acid sequence of the rChiA-DP contains a chitin-binding domain (CBD) (substrate binding), a fibronectin type III domain (FN3)(structural stability), and a catalytic domain with a typical TIM-barrel molecular structure (catalytic scaffold). SDS-PAGE analysis revealed that the molecular weight of the rChiA-DP was approximately 74.6 kDa, which is consistent with the theoretical predictions. The optimal conditions for rChiA-DP enzyme activity were 40 °C and pH 7.0. Enzyme activity was significantly enhanced by 10 mM Ba²⁺, Tris, K⁺, and Li⁺. Organic solvents such as methanol, ethanol, isopropanol, and isoamyl alcohol (10% concentration) also increased the activity. Conversely, positive metal ions such as Cu²⁺, Ni²⁺, Fe³⁺, Zn²⁺ and Mn²⁺ as well as SDS, DMSO, Tween 20/80 significantly inhibited the activity of the rChiA-DP. rChiA-DPs demonstrated varying degrees of decomposition activity against substrates such as colloidal chitin, chitin powder, nematode eggs, nematodes, shrimp shells, and tick eggs, with the highest activity observed for colloidal chitin (7.53 ± 0.86 U/mL). However, it exhibited no degradation activity on chitosan and tick surface. Compared with the heat-inactivated control group‌ and the s-buffer group, the rChiA-DP treatment significantly reduced the survival rate of C. elegans by 50.4% vs. heat-inactivated control (P < 0.01), indicating a potential antiparasitic effect. However, it showed no significant antifungal activity against fungi such as Aspergillus niger or Aspergillus flavus, and the diameter of the inhibition zone was not significantly larger than that of the negative control (P > 0.05). This study successfully prepared tick-derived rChiA-DPs and evaluated their enzymatic activity and anti-nematodal activity, providing enzymatic basis for the design of biopesticides targeting insect cuticle.

Introduction

Chitin is a linear polysaccharide polymer composed of N-acetyl-D-glucosamine linked by β−1,4-glycosidic bonds that plays a critical role in the biological world^1,2. It is a key structural component of crustacean shells (e.g., shrimp and crabs), providing defense and structural integrity. In arthropods, including agricultural pests and nematodes, chitin serves as a primary component of exoskeletons. Chitinase, an enzyme that specifically degrades chitin, is classified into three families, namely, GH-18, GH-19, and GH-20, on the basis of amino acid structure and sequence homology. GH-18 chitinase is ubiquitous and widely distributed in bacteria, fungi, viruses, animals, and plants and includes chitinase A, B, and C. In contrast, GH-19 chitinase is primarily found in plants and nematodes and is rarely identified in microorganisms^3–5. GH-20 family enzymes (e.g., β-N-acetylhexosaminidase) primarily hydrolyze chitooligosaccharides or chitosan, distinct from chitinase specificity, catalyze the breakdown of chitosan and acetylgalactosamine. The chitinases of the GH-18 family and the GH-19 family have completely different structures. The GH-18 family catalytic domain forms a TIM-barrel (triose‒phosphate isomerase) with eight alpha helices and eight parallel beta chains. The hydrolysis reaction is mediated by conserved glutamic acid residues via a substrate-assisted catalytic mechanism⁶. Like lysozymes, chitinase GH-19 has a high alpha helix double-lobed structure, employing a single displacement reversal catalytic mechanism⁷. These enzymes hydrolyze β−1,4-glycosidic bonds to produce chitooligosaccharides and N-acetylglucosamine (GlcNAc), with endo-acting enzymes cleaving internal bonds and exo-acting enzymes releasing monomers. Recombinant chitinase enzymes (produced via gene recombination) retain activity and disrupt insect exoskeletons by degrading chitin, leading to host mortality^8–10. GH-19 chitinases exhibit a high α-helix content with a lysozyme-like fold conformation, which are produced via gene recombination technology, retain enzymatic activity and efficiently degrade the insect exoskeleton chitin¹¹. Chitinase has shown promise as a biological insecticide, while chitinase shows biocontrol potential, its efficacy against nematodes requires further validation in vivo due to differences in cuticle composition between insects and nematodes. For example, Dyah et al.¹² demonstrated that chitinase significantly reduces mosquito larvae survival rates. Similarly, Hussi et al.¹³ reported that chitinase produced by the Bacillus licheniformis strain USMW10 IK, which was isolated from the gut of Globitermes sulfureus, significantly increased the mortality rate after direct contact with chitinase-coated filter paper for 24 h. Page et al.¹⁴ revealed that Chryseobacterium nematophagum, which was isolated from rotten fruits, degraded chitin from the anterior pharynx of Caenorhabditis elegans after 3 h of interaction, subsequently invading and killing the worm. Genomic sequencing revealed the presence of pathogenic factors such as metalloproteinases, collagenase and chitinase in Chryseobacterium nematophagum. Chitinase also exhibits extensive antifungal activity. For example, Bouqellah et al.¹⁵ produced hybrid chitinases with enhanced antifungal properties by combining the functional domains of natural chitinases from Bacillus subtilis and Streptococcus mutans. These antifungal assays demonstrated significant inhibition of Fusarium oxysporum growth and bactericidal activity against Candida albicans, Alternaria solani, and Rhizobium solani. Pugoh et al.¹⁶ synergistically enhanced antifungal (Trichoderma viridum) activity by combining Ryukyuan chitinase palmitoylation of LysM (LysM-palmitoylated) with amphotericin, i.e., the addition of 0.5 µM LysM-palmitoylated to Amphotericin B (AMB) reduced the minimum inhibitory concentration (MIC) of AMB reduced to 0.31 µM.

Although chitinase shows promise as a biological control agent, relatively few studies have explored its efficacy in killing nematodes. The application of chitinase in this domain holds significant potential, especially given the global challenges posed by severe agricultural pests that drastically reduce crop yields^17,18. Even in the field of animal husbandry, parasitic insects such as nematodes, tapeworms, and flukes cause severe harm¹⁹. Currently, chemical insecticides and drugs are the primary means of pest control in agriculture. However, these chemicals often pose toxicity risks to the host, and their residues have serious implications for environmental safety and human and animal health.

To address these issues, this study was designed to clone and express the GH-18 family A-class chitinase from Bacillus subtilis strains for the first time. By comprehensively evaluating its enzymatic properties and anti-nematodal activity, this study provides a theoretical basis for future research into biological pesticides capable of effectively degrading pests.

Materials and methods

Sample collection

The Dermacentor nuttalli samples were collected from the Namuguri Pastoral Area of Jibuhulungtu Sumu in Xinbaerhu Left Banner, Hulunbuir City, Dalai Sumu in Xinbaerhu Right Banner, and Hui Sumu in Ewenki Autonomous Banner. Expression vectors (e.g., pET28a) and Escherichia coli competent cells [DH5α and BL21(DE3)] were stored in our laboratory. Wild-type Caenorhabditis elegans strain N2 and OP50 uracil-auxotrophic Escherichia coli strains were purchased from Shangyuan Biotech.

Main reagents and instruments

Main reagents

Restriction endonucleases BamH Ⅰ, Xho Ⅰ with 10 × FastDigest Buffer from ‌Takara Bio‌ (China). DNA purification kits (Gel Recovery, PCR Cleanup, Plasmid Miniprep) from ‌Tiangen Biotech. Chitinase activity assay kit, chitin (from shrimp), chitosan, and eosin Y (alcohol soluble) from ‌Solarbio Life Sciences. The Clon Express II One Step Cloning Kit was from Vazyme Biotech. BeyoGold™ His-tag Purification Resin from ‌Beyotime Biotechnology. Amicon® Ultra-15 10 K centrifugal filters from ‌Merck Millipore. Cetyltrimethylammonium bromide (CTAB) from Tianjin Guangfu Fine Chemical Institute‌. Mouse anti-His-Tag mAb and HRP-conjugated Goat anti-Mouse IgG from Biosynthesis Biotechnology. BioTrace™ NT Nitrocellulose Membrane (30 cm × 3 M) from Pall Corporation.

Instrument

Instrumentation Sources: PCR system: ‌Biometra TAdvanced‌ (Biometra GmbH); Nucleic acid electrophoresis unit: ‌PowerPac™ Universal System‌ (Bio-Rad Laboratories); High-speed centrifuge: ‌Sigma 3-18KS‌ (Sigma Laborzentrifugen GmbH); Constant-temperature water bath: ‌SC-10‌ (Shanghai Senxin Experimental Instrument Co., Ltd.); Gel documentation system: ‌FUSION FX7‌ (Vilber Lourmat); Microscope: ‌Olympus BX43‌ (Olympus Corporation); Biochemical incubator: ‌Sigma 856‌ (Sigma-Aldrich); Semi-dry transfer apparatus: ‌Trans-Blot® SD Semi-Dry Transfer Cell‌ (Bio-Rad Laboratories).

Primer design and synthesis

The genomic DNA of isolated bacterial strains was extracted via a Bacterial Genomic DNA Extraction kit (Hunan Aikerui Bioengineering Co., Ltd.) and served as the PCR template. Two primer sets were employed (the specific process can be found in 2.4.2.2): universal bacterial primers (27F/1492R (designed by Primer Premier 5.0) for 16S rRNA gene amplification and chitinase-specific primers: PF-rChiA-DP/PR-rChiA-DP (vector construction) and Chi1F/Chi1R (detection). All primer sequences are listed in Table 1.

Table 1.

Sequences of the primers.

Primer name	Primer sequence (5′ → 3′)	Fragment size (bp)
27F	AAGGAGGTGATCCAACCGCA	1500
1 492R	AAGGAGGTGATCCAACCGCA
PF-rChiA-DP	CAGCAAATGGGTCGCGGATCCATGGATTCACCAAAGCAAAGTCA	1932
PR-rChiA-DP	GTGGTGGTGGTGGTGCTCGAGCTAGTTTTCGCTAATGACGGC
Chi1F	ACGCCATATGCTTTCTACGTCTTTAATAATTGGCTCCATAC	2500
Chi1R	AAGTCGACGCGAAAGCCTTTCCCTAACAGGTGACTAT

Methods

Macrogenomic analysis of symbiotic bacteria in Dermacentor nuttalli

A total of 582 ticks (Dermacentor nuttalli) were collected from the New Barag area of Hulunbuir, and their genomes were extracted via the CTAB method. The process was as follows: (1) Sample pretreatment: The tick was washed 3 × with PBS and then washed with 75%, 50%, and 30% alcohol solutions for 1 h each. Then the sample was rinsed with sterile ddH₂O in sterilized 1.5 mL EP tubes and ‌immediate freezed in liquid nitrogen. (2) Tissue homogenization: Grind frozen ticks in liquid nitrogen to fine powder; Add ‌500 μL 2% CTAB‌ + 20 μL proteinase K per 100 mg tissue (standardize volume); Incubate at 65 °C for 1 h with ‌gentle shaking every 10 min‌ (reduce mixing frequency). After removal, the mixture was cooled to room temperature. (3) ‌Organic extraction: Add equal volume phenol:chloroform alcohol (25:24:1); Centrifuge at ‌12,000 × g, 10 min, 4°C‌ (critical temperature change); Transfer aqueous phase → repeat chloroform alcohol (24:1) extraction. (4) ‌DNA precipitation: Add ‌0.7 volumes isopropanol‌ (not 2 volumes) → invert gently; Precipitate at ‌−20 °C for 30 min‌ (not 2 h); Centrifuge at 12,000 × g, ‌15 min, 4 °C. (5) ‌DNA washing & dissolution: Wash pellet with ‌500 μL cold 70% ethanol‌ 2 × (eliminate pipette blowing); Air-dry pellet until translucent (never use 65 °C oven); Resuspend in ‌30 μL TE buffer‌ (10 mM Tris–HCl, 1 mM EDTA, pH 8.0) (not ddH₂O). DNA from 48 pools was extracted and homogenized into three parallel samples for 16S rDNA amplicon sequencing, followed by Bacillus family-level taxonomic analysis.

Isolation and identification of Bacillus proteolyticus

Isolation and cultivation of Bacillus proteolyticus

Blood-fed female ticks were treated sequentially with sterile phosphate-buffered saline (PBS) containing various alcohol concentrations, frozen, and ground into powder. After freezing‒thawing, the tick tissue samples were cultured via spread plate method. Individual colonies were subjected to Gram staining and microscopic observation after culture. The isolated strains were inoculated on Luria–Bertani (LB) solid media via ‌streak plating and incubated at 37 °C. The colony morphology and characteristics were observed. A clear zone assay was employed to screen chitinase-producing bacteria on a chitinase plate (1% colloidal chitin, 0.2% potassium dihydrogen phosphate, 0.3% ammonium sulfate, 1.5% agar powder, 0.03% magnesium sulfate pentahydrate). The samples were incubated at 37 °C for 3 to 5 days to observe the size of clear zone diameter and to determine whether the bacteria produced chitinase.

Identification and genetic analysis of Bacillus proteolyticus via 16S rRNA PCR

PCR amplification using primers 27 F and 1492R followed a predenaturation step at 94 °C for 3 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 40 s, and extension at 72 °C for 1 min/kb rule, with a final extension at 72 °C for 10 min. The amplified product was verified via agarose gel electrophoresis and sent for sequencing. Homology comparisons via the NCBI BLAST system were used to determine the genotype and species of the strains. Phylogenetic analysis was conducted via MEGA7.0 software.

Preparation of colloidal chitin

A method described by Laribi-Habchi et al.²⁰ with slight modifications was utilized for colloidal chitin preparation. Gradually add ‌6 g chitin powder‌ to ‌120 mL pre-cooled (4 °C) concentrated HCl‌ under magnetic stirring. Maintain at ‌4 °C for 2 h‌ (extended from original protocol) until fully dissolved. Subsequently, Add ‌1.2 L pre-cooled 50% ethanol‌ dropwise (not at once) while stirring. Store at ‌4 °C for 24 h‌ (“overnight”clarified) to complete precipitation. The resulting suspension was centrifuged at ‌5,000 × g, 20 min, 4 °C, and the supernatant was discarded. The precipitate was repeatedly washed with cold distilled water until it was neutralized. Finally, the residue was centrifuged at 10,000 × g, 15 min, 4 °C, the supernatant was discarded, and distilled water was added to achieve a 1% (W/V) colloidal chitin solution.

Sequencing analysis and structural prediction

The chitinase gene in Bacillus subtilis was amplified via PCR-specific primers, based on the target CDS sequence (Gene ID: 99,619,985) from Bacillus cereus. The amplification process included predenaturation at 94 °C/3 min; predenaturation at 94 °C for 1 min, annealing at 60 °C for 60 s, and extension at 72 °C for 1 min, for a total of 30 cycles. A final extension was performed at 72 °C for 10 min, after which the mixture was cooled to 4 °C and stored. The PCR products were analysed via agarose gel electrophoresis, attached to the 19 T vector through gel recovery and sent for sequencing. The open reading frame (ORF) and encoded amino acid sequences of the sequenced genes were determined via EditSeq software, and transmembrane signal peptides were removed via transmembrane helices hidden Markov models (TMHMMs). The nucleotide sequences were then translated via Primer 5 software. The domain structure was analysed with NCBI tools, and the three-dimensional structure of rChiA-DP (Dermatestor-derived Protein) was predicted via AlphaFold 3. Phylogenetic adjacency trees were constructed via MEGA 7.0 software, and sequence alignment was performed via GeneDoc.

Cloning of the chitinase gene

In this study, a pair of specific primers was designed using the CE Design tool provided by Vazyme. The BamHI restriction site was introduced at the 5’ end of the upstream primer, immediately preceding the start codon (ATG). Similarly, the XhoI restriction site was incorporated at the 5’ end of the downstream primer, immediately preceding the stop codon (TAA). The expected size of the amplified fragment was 1,932 base pairs (bp). Genomic DNA extracted from Bacillus proteolyticus, isolated in our laboratory, was used as the template for PCR amplification with the designed primers. The PCR amplification was carried out under the following thermal cycling conditions: initial pre-denaturation at 94 °C/3 min, followed by 30 cycles of denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for 2 min, with a final extension step at 72 °C for 10 min. The resulting PCR product, corresponding to the ChiA-DP gene, was purified via gel extraction. Subsequently, the purified pET28a plasmid, which had been double-digested with BamHI and XhoI, was ligated with the amplified DNA fragment using Vazyme Exnase II ligase. The ligation product was then transformed into E. coli DH5α competent cells. Positive transformants were selected and submitted to Sangon Biotech for sequencing to confirm the accuracy of the inserted sequence. The successfully constructed recombinant plasmid was designated as pET28a-rChiA-DP.

Expression and purification of rChiA-DP

The correctly sequenced recombinant plasmid pET284-rChiA-DP was transformed into E.coli BL21 (DE3) competent cells, which were subsequently cultured at 37 °C and 180 rpm until the optimal density at OD600 nm reached 0.6. IPTG was then added to a final concentration of 1 mmol/L to induce protein expression. The culture was induced for 6 h at 20 °C and 150 r/min, after which the bacterial cells were harvested. Following cell lysis by ultrasonication, the recombinant enzyme rChiA-DP was purified via a BeyoGold™ His-tag Purification Resin affinity chromatography column. Then, the recombinant enzyme, after being exchanged and concentrated using an Amicon® Ultra 10 K ultrafiltration tube, underwent polyacrylamide gel electrophoresis (SDS-PAGE), Western blot, and chitinase activity analysis.

Analysis of enzymatic properties of rChiA-DP

Determination of chitinase activity

In this study, rChiA-DP activity was measured using two complementary methods: 1. ‌Qualitative analysis‌: Chitinolytic capability was assessed through clear zone formation on colloidal chitin plates. 2 ‌Quantitative analysis‌: A commercial chitinase activity assay kit (BC0825, Solarbio Science & Technology Co., Ltd.) was employed. This method quantifies activity based on chitin hydrolysis to GlcNAc, which undergoes alkaline-heat-induced reaction with p-dimethylaminobenzaldehyde (DMAB) to form a chromogen (λ < sub > max </sub > = 585 nm). The quantitative approach was subsequently applied to assess the effects of pH, temperature, metal ions, and organic solvents on ‌the enzyme’s activity‌.

Effects of pH on rChiA-DP

To examine the effects of various pH values on the activity of rChiA-DP, a diluted enzyme mixture was reacted with 1% (w/v) colloidal chitin as a substrate at 37 °C. The buffers employed included 0.2 M citrate sodium citrate buffer (pH 3.0–6.0)‌, 0.2 M disodium hydrogen phosphate dihydrogen phosphate buffer (pH 6.0–8.0)‌, and 0.2 M glycine NaOH buffer (pH 9.0–10.0). The optimal pH value for the recombinant enzyme was determined by measuring its enzyme activity. The recombinant enzyme was subsequently stored overnight in buffer solutions of various pH values at 4 °C in a refrigerator. The enzyme solutions pretreated with these different pH conditions were then added to the reaction system, which was assessed via the same enzyme activity measurement method. Each experiment included three parallel samples, and enzyme activity was calculated under different pH conditions.

Effects of temperature on recombinant enzymes

Under the optimal pH conditions, the enzyme preparation was incubated with colloidal chitosan in 0.01 M phosphate buffer (pH 7.0) across a range of temperatures from 20 °C to 85 °C. The relative enzyme activity at different temperatures was calculated, and the optimal reaction temperature was identified as the temperature yielding the highest enzyme activity, which was set at 100%. Each experimental group consisted of three replicates. To evaluate thermal stability, the recombinant enzyme was incubated at various temperatures ranging from 25 °C to 80 °C for 60 min and 90 min. Following incubation, the residual enzyme activity was measured under optimal reaction conditions. The enzyme activity of the untreated enzyme mixture was 100%, with 3 replicates in each group. The residual enzyme activity of the recombinant chitinase was calculated at each temperature for 60 min and 90 min to test its heat resistance.

Influence of metal ions and organic solvents on recombinant enzymes

To evaluate the influence of various metal ions and chemical reagents on recombinant enzyme activity, enzyme preparations were treated with Ca²⁺, Mg²⁺, Zn²⁺, Na⁺, K⁺, NH₄⁺, Ba²⁺, Cu²⁺, Fe³⁺, Li⁺, Ni²⁺, Mn²⁺, SDS, ethylenediaminetetraacetic acid (EDTA), and urea (urea) at final concentrations of 10 mM and 50 mM. Additionally, organic reagents, including methanol, ethanol, isopropanol, glycerol, isoamyl alcohol, Tween 20, Tween 80, dimethyl sulfoxide (DMSO) and acetic acid, were examined to determine their effects on recombinant enzyme activity under optimal conditions. The residual enzyme activity of each reagent to the enzyme was calculated at 100% without the addition of impact factors.

Effects of salt ion concentration on recombinant enzymes

By incubating enzymes with NaCl at final concentrations of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, and 13% at 4 °C for 2 h, their effects on the activity of the recombinant enzymes were measured under optimal reaction conditions. The residual enzyme activity for each concentration of NaCl was calculated without NaCl supplementation as 100%.

Substrate specificity assay

Enzyme activity was measured under optimal conditions using a variety of substrates, including 1% (w/v) colloidal chitin, shrimp shell fine powder chitin, chitin powder, chitosan, ticks, tick eggs, shrimp shells, nematodes, and nematode eggs. Under the specified optimal pH and temperature conditions, the enzyme activity when colloidal chitin was used as a substrate was defined as 100%. The enzymatic activity for the other substrates was calculated accordingly.

Effects of recombinant chitinase on Caenorhabditis elegans

Cultivation and synchronization of Caenorhabditis elegans

To ensure consistency in subsequent experiments, 2–3 culture dishes containing a large number of L4-stage nematodes or eggs were selected for synchronization. These culture dishes were specifically chosen to ensure that the nematodes were at the same developmental stage. A backup lysis mixture was prepared by mixing 3 mL of sodium hypochlorite, 4 mL of 1 M NaOH, and 5 mL of water in a 12 mL centrifuge tube. The solution was used for subsequent nematode lysis. The surface of the culture dish was gently rinsed with 1–2 mL of S-buffer for excessive washing of miscellaneous bacteria. The rinsed nematodes were transferred into a 1.5 mL centrifuge tube via a pipette to ensure that a sufficient number of adult worms were collected for subsequent processing. The collected nematodes were centrifuged at 3000 × g, 2 min, and the supernatant was discarded. The prepared lysis buffer was added to the pellet, and the mixture was gently inverted until the nematode body curled, after which it froze, and the eggs were released. Throughout the cracking process, the liquid was observed for color changes, transitioning from turbid to yellow and finally to clear. Upon confirming that lysis was complete, the sample was centrifuged again at 3000 × g, 2 min. The supernatant was discarded, and the eggs were rinsed at least 3 times to ensure purity. The enriched eggs, collected at the bottom of the tube, were then transferred into another tube. Using a pipette, the collected eggs were inoculated onto NGM medium devoid of OP50 Escherichia coli and incubated overnight at 20 °C until L1 larvae hatched. Hatched L1 larvae were inoculated onto NGM medium containing OP50 Escherichia coli and further cultured at 20 °C until L4 stage nematodes.

Chitinase action on Caenorhabditis elegans

The cultured L4 stage nematodes were washed repeatedly to create a heavy suspension, and the heavy suspension was added to a 96-well plate at a volume of 20 µL (approximately 50 nematodes) per well. The experiment consisted of three groups, each with three wells. In the experimental group, 200 µL of recombinant chitinase rChiA-DP at a concentration of 0.584 mg/ml was added to each well. The heat-inactivated control group received 200 µL of inactivated rChiA-DP that had been inactivated by high temperature (incubated in a 100 °C water bath for 10 min) in each well. The blank control group was provided with 200 µL of S-buffer in each well. The 96-well plate was incubated at 37 °C for 6 h. The mortality rate and morphological changes in the nematodes were observed via an inverted microscope. The mortality rate and morphological changes in each group of nematodes were recorded to assess the effectiveness of the rChiA-DP. For comparative analysis, the killing effect of rChiA-DPs on nematodes was evaluated by comparing the mortality rates among the experimental group, heat-inactivated control group, and blank control group. High-temperature inactivated rChiA-DP and S-buffer were used as controls to ensure the reliability and accuracy of the experimental results.

Degradation effect of chitinase on the pharynx of Caenorhabditis elegans

After the C. elegans in the three groups mentioned above were washed, they were suspended in 500 μL of pH 6 citrate phosphate buffer (0.2 M NaH2PO4 and 0.1 M potassium citrate). Then, 10 μL of eosin Y (5 mg/mL in 70% ethanol) was added to the test tube, and the mixture was incubated in the dark for 10 min. Following extensive washing with citrate phosphate buffer, the samples were observed under a fluorescence microscope.

Effects of chitinase on fungi

One hundred milliliters of fungal mixture (Aspergillus niger and Aspergillus flavus) was prepared and evenly spread over the surface of potato dextrose agar (PDA) solid culture medium. After 20 min, sterilized Oxford cups were placed at equal intervals on PDA culture media in a 28 °C incubator for 5 days. After culturing, the fungi were cut into small pieces and placed in the center of the PDA plate for 24 h, after which 4 holes were created around them. In 3 wells, rChiA -DP was added, and in the fourth well, 1 inactivated rChiA-DP was added. Then, 100 mL of concentrated rChiA-DP was added to each well, and 3 parallel experiments were performed. The plates were incubated in a 28 °C incubator for 24 h, after which the growth of the fungi and the antifungal effects of the supernatant were observed every 5 h. After 24 h of cultivation, the diameter of the inhibition zone was measured, and the average of three parallel experimental measurements was determined to record the production of antifungal substances.

Statistical analysis

The data were analyzed using Student’s t-tests to determine statistically significant differences between sample groups. P-values were reported either numerically or represented by asterisks according to the following convention: **P < 0.01.

Results

Metagenomic analysis of tick symbiotic bacteria

Metagenomic analysis revealed the presence of multiple genera of the Bacillus family inside the ticks, including Virgibacillus, Bacillus, Oceanobacillus, Lysinibaculus, and Pseudogracilibacillus (Fig. 1). The abundance ratios of each bacterial group were as follows: Bacillus and other strains of Bacillus accounted for a total of 37.74%, including the uncultured strains Bacillus sp. (22.48%), Bacillus sp. Y2 (6.37%), Bacillus sp. DB14538 (2.28%), Bacillus sp. 6042 (4.57%), Bacillus sp. R054bN (0.48%), Bacillus sp. (in bacteria) (0.48%) and Bacillus sonorensis (1.08%). The genus Virgibacillus accounted for 38.22% of the total, with Virgibacillus sp. Zunyi-G having the highest proportion at 37.02%, followed by a small amount of Virgibacillus sp. WSR35 (1.2%). The Oceanobacillus genus accounted for 7.33%, whereas the Lysinibacillus genus accounted for 0.84%. The Pseudogracilibacillus genus accounted for 3.49%. Additionally, other unidentified Bacillales microbiota accounted for 12.38% of the total, including unclassified Bacillales (1.92%), unclassified Bacilli (1.08%) and unclassified Bacillaceae (9.38%).

Fig. 1.

Metagenomic analysis results of tick symbiotic bacteria. Note: Bacillus genus: purple area; Virgibacillus genus: pink area; Oceanobacillus genus: blue-green area; Pseudogracilibacillus genus: green area; Unknown Bacillales unclassified and Bacillaceae unclassified: orange and red areas.

Isolation, cultivation, and evolutionary tree analysis of Bacillus proteolyticus

Microscopic examination revealed that Bacillus proteolyticus appeared as a purple, short, rod-shaped, gram-positive bacteria (Fig. 2A). On LB solid medium, it formed milky white, smooth, and neatly edged colonies (Fig. 2B). Clear zone assay results indicated that the strain grew on colloidal chitin media and produced clear zones (Fig. 2C). A phylogenetic tree based on the 16S rRNA gene sequence (Fig. 2D) showed that the isolated Bacillus proteolyticus shared the closest genetic relationship with the Americould isolate MCCC1A00365, located in the same branch with 99.79% sequence identity. This strain was designated as IMH/B-1.

Fig. 2.

Results of phylogenetic tree analysis of isolation and culture of Bacillus proteolyticus. Note: (A): Bacillus proteolyticus microscopy results; (B): Bacillus proteolyticus culture results; (C): Clear zone assay; (D): Bacillus proteolyticus phylogenetic tree.

Analysis of chitinase protein structure

PCR amplification using chitinase-specific primers (Chi1F/Chi1R) yielded a distinct ‌2.5-kb‌ band (Fig. 3B). After signal peptide removal, the mature rChiA-DP protein comprises 642 amino acids. Structural prediction analysis (Fig. 3A, C) demonstrated that the rChiA-DP possesses a TIM-barrel catalytic domain with ‌8 α-helices and 8 parallel β-strands, along with An N-terminal chitin-binding domain (CBD) and a central fibronectin type III domain (FN3). This enzyme belongs to the GH-18 chitinase family. Phylogenetic analysis (Fig. 3D) revealed a close evolutionary relationship between the rChiA DP and chitinase from Bacillus thuringiensis. Multiple Sequence Alignment revealed that, despite variations in the coding amino acid sequences of different chitinases, the key amino acids within the catalytic domain were highly conserved. In this study, two conserved motifs with sequences IxxGG and YxxDGVDLDxE were identified in rChiA-DP (Fig. 3E).

Fig. 3.

Bioinformatics analysis of chitinase from Bacillus proteolyticus. Note: (A): The structural domain structure of rChiA DP; (B): PCR detection results; (C): Chitinase structure prediction diagram (TIM barrel domain marked in blue, binding domain (CBD) in yellow, fibronectin type III domain (FN3) in purple); (D): rChiA-DP phylogenetic tree; (E): Multiple sequence alignment of rChiA-DP.

Expression, purification, and activity analysis of rChiA-DP

SDS-PAGE analysis detected a prominent band at approximately 75 kDa in the IPTG-induced cell lysate (CL) of rChiA-DP transformants, absent from the pET-28a empty vector control (Fig. 4A). Western blot confirmed the His-tag presence on this band (Fig. 4B), consistent with the predicted molecular weight of rChiA-DP (74.8 kDa). After Ni-column affinity purification, SDS-PAGE demonstrated high purity rChiA-DP (Fig. 4C). In colloidal chitin hydrolysis assays, rChiA-DP ultrafiltration concentrate (UF) exhibited a significantly larger clear zone than cell lysate (CL) or elution fraction (E) following 12-h incubation (Fig. 4D). The purified rChiA-DP displayed an enzyme activity of ‌7.53 ± 0.86 U/mL‌ and a specific activity of ‌12.53 ± 1.47 U/mg‌.

Fig. 4.

Expression, purification, and activity analysis of rChiA-DP. Note: (‌A):‌ SDS-PAGE of cell lysates: Lane 1: pET-28a empty vector (Control); Lane 2: IPTG-induced rChiA-DP lysate (CL); (‌B): Western blot of panel A probed with anti-His-tag antibody; (‌C): Ni-affinity purification: Lane M: Protein marker; Lane FT: Flow-through; Lanes W1–W3: Wash fractions 1–3; Lanes E1–E4: Elution fractions 1–4; (‌D): Chitinolytic activity assay (clear zone method): Wells 1–4: pET-28a lysate (Control), IPTG-induced lysate (CL), pooled elution (E), ultrafiltrate (UF).

Analysis of the enzymatic properties of the recombinant chitinase

Effects of temperature and pH on the activity of rChiA-DP

The temperature-activity profile of rChiA-DP (‌Fig. 5A‌) showed that chitinase activity gradually increased from 25 °C to 40 °C, peaking at 40 °C. Activity remained above 89% of maximum at 45 °C, but decreased significantly above this temperature. Thermal stability analysis (‌Fig. 5B‌) demonstrated that rChiA-DP maintained ‌ > 70% residual activity‌ after 1–2 h incubation between 25–40 °C. Activity declined progressively with extended incubation time, exemplified by: ‌10% higher‌ residual activity after 1 h vs. 2 h at 40 °C; ‌7% higher‌ residual activity after 1 h vs. 2 h at 30 °C. The pH-activity profile (‌Fig. 5C‌) revealed maximal activity within pH 5.0–9.0 (peak at pH 7.0), with relative activities of 68.33% at pH 5.0 and 49.10% at pH 9.0. pH stability assays (‌Fig. 5D‌) indicated optimal stability at pH 7.0, with ‌ > 65% residual activity‌ retained across pH 5.0–9.0 after incubation.

Fig. 5.

Effects of pH and Temperature on Chitinase. Note: (‌A): Effects of different temperatures on chitinase activity (B): Stability of chitinase to temperature (‌C): Effects of different pH on chitinase activity (‌D): Stability of chitinase to pH. All data are presented as the mean ± s.d. (error bars).

Effects of metal ions, organic solvents, and salt concentrations on the activity of rChiA-DP

The effects of metal ions on the activity of purified rChiA-DP are shown in Fig. 6A. At 10 mM concentration, Ba²⁺, Tris buffer, K⁺, and Li⁺ significantly ‌enhanced‌ rChiA-DP activity. When increased to 50 mM, Ba²⁺ and Li⁺ inhibited activity, whereas K⁺, Tris, and Na⁺ showed no significant effect on rChiA-DP activity. At a concentration of 10 mM, Ca⁺, NH₄⁺, Mg²⁺, urea, 50 mM K⁺ and Tris exhibited no significant impact. Cu²⁺, Ni²⁺, Fe³⁺, Zn²⁺, Mn²⁺, and SDS caused significantly inhibition‌ at both concentrations (10/50 mM).

Fig. 6.

Effects of metal ion, organic reagent, and salt ion concentrations on the activity of recombinant enzyme rChiA DP and substrate. Note: (‌A): Effects of metal ions and organic reagents on the activity of recombinant enzyme rChiA DP (‌B): Effects of organic solvents on the activity of purified rChiA DP enzyme (‌C): Effects of salt concentration on the activity of purified rChiA DP enzyme (‌D): Substrate specificity. All data are presented as the mean ± s.d. (error bars).

The effects of organic solvents on the activity of the purified rChiA-DP enzyme are depicted in Fig. 6B. At 10% (v/v): Methanol, ethanol, isopropanol, and isoamyl alcohol increased activity at a final concentration of 10%. Glycerol showed no effect. At 20% (v/v), all tested solvents ‌inhibited activity‌, including DMSO. Tween 20, Tween 80 and acetic acid (both concentrations) caused > 50% inhibition.

The addition of NaCl (0–1%) increased the activity of the rChiA-DP (Fig. 6C). At 2% NaCl, > 91% residual activity‌ was maintained.

Substrate specificity

The specific activity of purified rChiA-DP toward diverse substrates is quantified in Fig. 6D. Highest activity‌ (100%) occurred with colloidal chitin, chitin powder, chitosan, nematode eggs, nematodes, shrimp shells, ticks, and tick eggs. Relative activities‌ for other substrates (normalized to colloidal chitin = 100%): Chitin powder: 30.24%; Nematode eggs: 21.38%; Nematodes: 15.89%; Shrimp shells: 2.4%; Tick eggs: 6.57%. ‌No detectable activity‌ toward chitosan or tick body segments.

Effects of chitinase on Caenorhabditis elegans

The nematode-chitinase co-incubation assay in 96-well plates demonstrated that ‌rChiA-DP treatment significantly reduced C. elegans survival rates‌, with a 50.4% decrease relative to the heat-inactivated control group and a 55.2% decrease relative to the S-buffer group (both P < 0.01, Fig. 7A).

Fig. 7.

The effect of rChiA-DP on Caenorhabditis elegans. Note: (‌A): Nematode survival rate (‌B): S-buffer group (‌C): Inactivated group (‌D): rChiA DP; The large white arrow points to the posterior pharyngeal bulb. The small white arrow points to the forward swallowing ball. The magnification of all images was × 40 times. All data are presented as the mean ± s.d. (error bars). **P < 0.01, Student’s t-test.

Eosin Y staining revealed ‌marked degradation of the pharyngeal bulb (corpus) in nematodes‌ treated with rChiA-DP, compared to both control groups (Fig. 7B-D). The significant reduction in pharyngeal bulb size indicates ‌specific chitinolytic activity‌ against this chitin-rich structure.

Effects of rChiA-DP on fungi

The antifungal assay (Fig. 8) demonstrated that ‌rChiA-DP‌ exhibited ‌no statistically significant inhibition‌ (P > 0.05) against Aspergillus niger or Aspergillus flavus compared to negative controls.

Fig. 8.

The effect of rChiA-DP on fungi. Note: (‌A) Aspergillus niger; (‌B). Aspergillus flavus.

Discussion

Nematodes constitute the predominant group of parasitic pathogens affecting both humans and livestock, imposing substantial burdens on global public health and agricultural economies²¹. Epidemiologic data indicate that soil-transmitted nematodes (e.g., Ancylostoma duodenale, Ascaris lumbricoides, and Trichuris trichiura) infect over 1 billion people worldwide. In animal husbandry, gastrointestinal nematodes such as Haemonchus contortus (barber’s pole worm) are particularly devastating to ruminants, causing productivity losses and mortality²². Current nematode control strategies predominantly rely on chemical anthelmintics. However, the emergence of widespread drug resistance in parasitic nematodes, coupled with concerns over drug residues in animal products, underscores the urgent need for novel biological antiparasitics^23,24. Biological control methods-characterized by their environmental safety, target specificity, and absence of chemical residues-represent a promising alternative with significant commercialization potential²⁵.

This study proposes a novel biocontrol approach leveraging chitinase. This approach involves the cloning and heterologous expression of the ChiA gene from tick-derived Bacillus proteolyticus. The enzymatic characteristics and structure of rChiA-DP were analysed, and its nematicidal activity was preliminarily evaluated to address challenges in enzyme yield and stability for practical biological antiparasitic applications. Ticks serve as reservoirs of diverse microbial communities in soil-associated environments, harboring abundant enzymatic resources. Prior research confirms chitinase production by multiple Bacillus species, such as Bacillus subtilis, Bacillus thuringiensis, Bacillus cereus, and Bacillus licheniformis³. Metagenomic profiling revealed that multiple genera of the Bacillus family of ticks exist. These genera include the genera Virgibacillus, Bacillus, Oceanobacillus, Lysinibacillus, and Pseudogracilibacillus. Among them, the Bacillus genus represented the dominant genus at 37.74%.

Bioinformatics analysis confirmed that the ChiA gene encodes a glycoside hydrolase belonging to the GH18 family (chitinase class A). Multiple sequence alignment revealed two conserved catalytic modules, IxxGG‌ (substrate-binding domain) and YxxDGVDLDxE (catalytic domain), with glutamic acid (E) serving as the catalytic residue essential for chitin hydrolysis. This is similar to the conserved modules SxGG (binding) and DxxDxDxE (catalysis) motifs of Shewanella khirikhana chitinase^26,27. The molecular mass of the rChiA-DP was 74.6 kDa (including fusion tags). After the carrier and His-tag fusion proteins were removed, the molecular mass was 70.8 kDa, which aligns with the theoretical value. This aligns with the typical mass range (22–91 kDa) reported for Bacillus-derived chitinases^28,29. The rChiA DP exhibited varying degrees of decomposition activity toward different substrates, demonstrating its substrate specificity. It showed the maximal activity toward colloidal chitin (7.53 ± 0.86 U/mL), which may be related to the higher solubility and exposed active sites of colloidal chitin, making it easier to bind and catalyze with enzymes. This characteristic was also validated in other chitin-related substrates, such as chitin powder, nematode eggs, and nematodes. Moreover, the rChiA-DP has no detectable activity‌ against: Fungal chitosan (deacetylation degree > 85%, impeding substrate recognition); Tick exoskeletons across developmental stages (due to chitin-protein cross-linking and sclerotization). The structural basis for this specificity requires further mechanistic investigation.

The optimal temperature for rChiA DP was 40 °C, lower than Bacillus pumilus JUBCH08 strain (70 °C)³⁰, but higher than Bacillus pumilus MCB-7 chitinase (37 °C)³¹. The rChiA DP exhibited high thermostability, retaining > 70% activity between 25–40 °C. Enzyme activity depends on the protonation state of catalytic residues and conformational stability under varying pH conditions³². Therefore, every enzyme has an optimal pH value, where its activity is highest. Exceeding this optimal range weakens the enzyme’s ability to bind to the substrate and even leads to enzyme inactivation³³. The optimal pH value for chitinase derived from Salinivibrio sp. BAO-1801³⁴ and Aeromonas hydrophila SBK1³⁵ was approximately 7.0, which aligns with the rChiA DP. Furthermore, the rChiA DP maintained an enzyme activity of over 65% at pH 5.0–9.0. This broad pH adaptability indicates the rChiA-DP could degrade related chitin products under different environmental conditions, which is more conducive to its potential for industrial and agricultural applications.

Metal ions play an important role in the catalytic process of enzymes³⁶. In this study, Ba²⁺, Tris, K⁺, and Li⁺ notably increased the activity of rChiA-DP at a concentration of 10 mM. These ions or molecules may function as synergistic factors or affect the stability of the enzyme structure during the catalytic process. Conversely, Cu²⁺, Ni²⁺, F³⁺, Z²⁺, M²⁺, and SDS significantly inhibited the activity of rChiA DP at both tested concentrations, especially Cu²⁺, Zn²⁺, Fe³⁺, and SDS. Cheba et al.³⁷ reported that Cu²⁺, Zn²⁺, Fe³⁺, and SDS could inhibit the activity of chitinase A derived from Bacillus sp. R2, a finding that is consistent with the behavior of the rChiA-DP.

Enzymatic reactions can also be regulated by the addition of organic solvents, which can alter the stability, activity, and reaction rate of enzymes and create a favourable microenvironment³⁸. In this study, the enzyme activity significantly increased with increasing concentrations of 10% methanol, ethanol, isopropanol, and isoamyl alcohol, possibly by providing a favourable microenvironment to promote enzyme–substrate interactions. At a concentration of 20%, however, most organic solvents inhibited the activity of the rChiA-DP enzyme, especially DMSO, Tween 20, and Tween 80, which may be related to alterations in the enzyme structure or binding ability of the active sites. Additionally, acetic acid strongly inhibited the activity of rChiA-DP at both concentrations, suggesting that acidic solvents can significantly hinder enzyme function by altering the surface charge of the enzyme or disrupting the active site.

rChiA-DP demonstrated significant nematicidal activity against Caenorhabditis elegans. Compared to heat-inactivated control group and the S-buffer group, nematode survival rates decreased by 50.4% and 55.2%, respectively (P < 0.01), following recombinant chitinase treatment. Eosin Y staining revealed pronounced structural thinning in the anterior pharyngeal bulbs of treated nematodes, indicating significant chitinase-mediated degradation of the anterior pharyngeal bulb of the nematodes. Zhang et al.³⁹ reported that chitin is located primarily in the cavity walls of specific areas of the nematode’s pharyngeal lumen, where it plays an important role in coordinating the collection, transport, and grinding of bacterial food as an important feeding organ. Therefore, the rChiA-DP may disrupt the mechanical integrity of the pharyngeal bulb by degrading chitin, impairing feeding functionality and ultimately leading to nematode mortality. The efficient degradation observed in the rChiA-DP treatment group indicated that recombinant chitinase possesses significant biological activity and a significant destructive effect on nematode structure. Moreover, when the heat-inactivated control group was compared with the buffer group, there was no significant difference in the survival rate of the nematodes (P < 0.01). These findings suggest that nonspecific factors other than the rChiA-DP recombinant protein did not interfere with the experimental results, further confirming the reliability of the killing effect of the recombinant chitinase. Although 37 °C was identified as the optimal temperature for the activity of rChiA-DP, it was not the optimal growth environment temperature for C. elegans. Consequently, the stress response may have also influenced the physiological response and normal development of C. elegans, but this alone was not enough to cause nematode death in the short term. Additionally, this study assessed rChiA-DP (activity: 7.53 ± 0.86 U/mL, measured via chromogenic substrate hydrolysis) against fungi including Aspergillus niger and Aspergillus flavus, revealing negligible antifungal effects. The inconsistency in the host selection of recombinant chitinase still requires further investigation.

In conclusion, the recombinant chitinase rChiA-DP developed in this study provides a new working platform as a potential nematode antiparasitic drug, particularly for controlling parasitic nematode-related diseases or agricultural pest management. This research lays the groundwork for future optimization of large-scale chitinase production and the development of application strategies.

Author contributions

FL: Project administration, Writing-review & editing. JH: Methodology, Writing-original draft. MAH: Writing-review & editing. SQAS: Writing-review & editing. YL: Investigation, Writing -review & editing. GT: Methodology, Writing-review & editing. GY: Project administration, Writing-review & editing. RS: Methodology, Writing-review & editing. LG: Data curation, Funding acquisition, Supervision, Writing-review & editing.

Funding

The Inner Mongolia Agricultural University First-Class Professional Course Construction Project, SYKJYB202303, the National Natural Science Foundation of China, 3236190021.

Data availability

The datasets generated and/or analysed during the current study are available in the GenBank repository. Accession number to datasets: KJ764712.2. Persistent weblink: https://www.ncbi.nlm.nih.gov/nuccore/751,198,471.

Declarations

Competing interests

The authors declare no competing interests.