Skip to main content
American Journal of Men's Health logoLink to American Journal of Men's Health
. 2025 Oct 1;19(5):15579883251371990. doi: 10.1177/15579883251371990

Wu Zi Yan Zong Wan Improves Triptolide-Induced Testicular Spermatogenic Dysfunction Through the Spermatogenic Microenvironment and the PLCγ/PKC Pathway

Lei Zhang 1,2, Binghao Bao 2, Weizhen Wu 2,3, Haolang Wen 2,3, Suyan Tong 2,3, Xueyan Wang 2,3, Baoxing Liu 2,
PMCID: PMC12489227  PMID: 41035162

Abstract

Wu Zi Yan Zong Wan (WZYZW) is a traditional Chinese formula known for treating male infertility, though its mechanism of action is unclear. This study investigates how WZYZW may alleviate spermatogenic dysfunction in mouse testes induced by triptolide (TP). We established a TP-induced spermatogenic dysfunction mouse model and randomly divided 30 male C57BL/6J mice into five groups: control, model, and low-, medium-, and high-dose WZYZW groups (six mice per group). After a 35-day intervention, testicular tissues were analyzed for histopathology via hematoxylin–eosin and TUNEL staining. Protein expression of type I collagen, laminin, fibronectin, and spermatogonial stem cell (SSC) markers, including GFRα1, Ret, and PLZF, were evaluated by immunohistochemical staining. GDNF and CSF1 levels were measured by ELISA, and the PLCγ/PKC pathway was analyzed via Western blotting and quantitative reverse transcription polymerase chain reaction (qRT-PCR). Compared with the model group, WZYZW significantly increased testicular index (high-dose, p < .01), improved Johnsen score (all doses, p < .05), reduced spermatogenic cell apoptosis, and improved the spermatogenic microenvironment by increasings type I collagen (high-dose, p < .01), laminin (low-dose, p < .01; medium/high-dose, p < .05), fibronectin (high-dose, p < .01), GDNF (medium/high-dose, p < .05), and CSF1 (high-dose, p < .05). It significantly upregulated the expression of GFRα1, PLZF, C-kit, Ret, and SCF, with the improvement of GFRα1(medium/high-dose vs. low-dose, p < .01), Ret (medium/high-dose vs. low-dose, p < .05), SCF (high-dose vs. low-dose, p < .05) showing a certain dose-dependency. The qRT-PCR and Western blotting results showed that WZYZW significantly enhanced PLCγ/PKC pathway activity. The study indicates that WZYZW can improve the spermatogenic microenvironment and promote the self-renewal and differentiation of SSCs through the PLCγ/PKC pathway, thereby improving spermatogenic function.

Keywords: conventional Chinese herbal mixture, mechanisms, male infertility, PLCγ/PKC pathway, spermatogenic micro-environment

Introduction

A married couple that regularly engages in sexual activity for more than 1 year without using any contraception, but the female partner is unable to conceive naturally due to male factors, is referred to as having male infertility (Eisenberg et al., 2023). Globally, 15% of couples of reproductive age have fertility problems, with male factors accounting for about 50% of these issues. (J. Chen et al., 2023). Male infertility occurs as a result of multifactorial factors, including genetic, environmental, anatomical, and physiological changes that affect spermatogenesis (Ramgir et al., 2022). The most frequent cause of male infertility is considered to be a decline in sperm viability or count (Maurya et al., 2022). Medical options for male infertility include surgery, antioxidants, and assisted reproductive technologies, but their indications, clinical efficacy, and safety are still subject to some controversy (Mazzilli et al., 2023; Zini and Al-Hathal, 2011).

Wu Zi Yan Zong Wan (WZYZW) can be traced back to the “Xuan Jie Lu” of the Tang Dynasty, which has the effect of tonifying the kidney and benefiting the sperm and has a long history of treating reproductive issues (Zou et al., 2019). The formula is composed of several key compounds, including flavonoids, alkaloids, and terpenoids. These compounds are known for their potential pharmacological activities, such as antioxidant and anti-inflammatory effects (Zou et al., 2015). Studies have confirmed that WZYZW can effectively increase sperm concentration, sperm viability, and acrosomal enzyme activity and reduce the DNA fragmentation index of spermatozoa in patients (Zhao et al., 2018). In addition, recent research has shown that WZYZW helps patients achieve better pregnancy outcomes (Yong et al., 2020). WZYZW has plenty of potential for treating male infertility, and determining its mechanism of action has become increasingly important.

Triptolide (TP), the active ingredient in Tripterygium wilfordii Hook f., is used in traditional Chinese medicine to treat a range of diseases, such as lupus, tumors, and rheumatoid arthritis (X. J. Li et al., 2014). However, long-term TP use also induces damage to the reproductive system of males and can be used to construct animal models of spermatogenic disorders (Singla et al., 2013). Studies have shown that (Ni et al., 2008) after TP gavage in Sprague-Dawley (SD) rats, sperm count and viability decreased as a result of TP buildup seen in the testes. Pathological changes such as vacuolization of the spermatogenic epithelium and detachment of spermatogenic cells were also observed.

Stabilization of the spermatogenic microenvironment is essential for maintaining normal spermatogenesis. Spermatogonial cells engage in interactions with Leydig cells, peritubular myoid cells (PMCs), and Sertoli cells (SCs), to provide a stable physical and metabolic microenvironment for the spermatogonial stem cells (SSCs), and thus maintain reproductive capacity (Potter & DeFalco, 2017; M. J. Oatley et al., 2011). The SCs establish the blood-testis barrier (BTB) through the tight junctions, creating a physical environment that is conducive to the growth and maturation of germ cells while shielding them from toxins and autoimmune damage (Mital et al., 2011). Studies have shown (K. Q. Chen et al., 2022; Kokkinaki et al., 2009; Parekh et al., 2019) that PMCs secrete colony-stimulating factor 1 (CSF1), which, together with glial cell line–derived neurotrophic factor (GDNF) secreted by SCs, not only provides essential growth factors for SSCs, but also cooperatively triggers spermatogenesis-related downstream signaling pathways such as MEK/ERK, PI3K/AKT, and PLCγ/PKC. By enhancing the secretory activity of SCs, increasing tight junction protein expression, and ensuring the BTB remains integrity, studies discovered that WZYZW stabilized the spermatogenic microenvironment and enhanced spermatogenesis (Pan et al., 2021). Nonetheless, further clarification is required about the WZYZW mode of action.

To regulate cell division, growth, and proliferation, the PLCγ/PKC signaling pathway is crucial. Phospholipase Cγ1 (PLCγ1) is directly activated by membrane receptors and produces inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Siraliev-Perez et al., 2022). DAG causes protein kinase C (PKC) to become active, and PKC in turn activates its downstream pathway to mediate various cellular activities, such as differentiation, survival, proliferation and migration (Jang et al., 2018; Yang et al., 2012). SSCs self-renewal depends on elevated PKC protein expression (Kim et al., 2014).

However, the precise molecular mechanism by which WZYZW exerts its protective effects on spermatogenesis, particularly through modulating the spermatogenic microenvironment and the PLCγ/PKC signaling pathway, remains incompletely understood. To address this gap, this study aimed to elucidate the therapeutic mechanism of WZYZW in ameliorating male infertility. Specifically, we established a TP-induced spermatogenic disorder mouse model to investigate how WZYZW restores spermatogenic function by regulating key components of the spermatogenic microenvironment and modulating the activity of the PLCγ/PKC signaling pathway. Our findings provide a solid scientific rationale for its clinical application for the treatment of male infertility.

Materials and Methods

Animals

The company Sipeifu (Beijing) Biotechnology Co., Ltd. (Animal Production License: SCXK [Beijing] 2019-0010) supplied thirty male C57BL/6J mice, weighing 20 ± 2 g around 7–8 weeks of age (Guo et al., 2023; Qi et al., 2022). The mice were housed in circumstances that were specifically free of pathogens, with access to food and water, and a temperature under control of 23 ± 2°C and a relative humidity range of 40% to 55%. Light and dark conditions were alternated for 12 h each day (light on at 8:00 a.m., light off at 20:00 p.m.). The Animal Ethics Committee of Beijing University of Chinese Medicine (2023102004-4159) checked out and authorized the experimental animals needed for this study.

Preparation and Main Chemical Composition of WZYZW

WZYZW is a standardized Chinese herbal formula formulated according to the Chinese Pharmacopoeia (2020 Edition) (Chinese Pharmacopoeia, Commission, 2020). The composition is as follows: Cuscuta chinensis Lam. (Cuscutae Semen, 24 g), Lycium barbarum L. (Lycii Fructus, 24 g), Rubus chingii Hu. (Rubi Fructus, 12 g), Plantago asiatica L. (Plantaginis Semen, 6 g), and Schisandra chinensis (Turcz.) Baill. (Schisandrae Chinensis Fructus, 3 g). The ratio of these herbal components in the formula is 8:8:4:2:1(Wu et al. 2023). Chinese herbal tablets were purchased and prepared at China-Japan Friendship Hospital (Beijing, China). The preparation method was as follows: eight doses of Chinese herbal medicines were decocted twice with 1 L of water for 30 min each time, and the concentrated decoction was combined to form a Chinese herbal liquid containing 2.5 g/mL of raw materials, filtered through a 0.22-μm membrane, autoclaved, and stored at 4°C (Chinese Pharmacopoeia, Commission, 2020).

Liquid Chromatography-Mass Spectrometry of WZYZW

A volume of 100 μL of the herbal extract was mixed with 1 mL of internal standard-containing water, vortexed (1 min), ultrasonicated (ice-water bath, 1 h), incubated (−40°C, 30 min), and centrifuged (12,000 rpm, 10 min). The supernatant was 10-fold diluted, and 200 μL was analyzed via LC-MS. Chromatographic separation was performed on a ACQUITY UPLC HSS T3 column (2.1 × 100 mm, 1.8 μm) with a gradient of 0.1% formic acid in water (A) and acetonitrile (B) at 0.3 mL/min. The chemical components in WZYZW were identified using an ACQUITY UPLC I-Class HF system coupled with a Q Exactive (QE) high-resolution LC-MS system. Mass spectrometric detection was performed in positive/negative ion switching mode with a mass range of m/z 100 to 1,500. Data were acquired via DDA and matched to reference standards (±5 ppm).

Chemicals and Reagents

  • TP: Beijing Bailing Wei Technology Co., Ltd. (Cat. No. L130S74; Beijing, China)

  • Sodium carboxymethylcellulose: Shangqiu Kengdao E-commerce Co., Ltd. (Cat. No. GB1886.232-2016; Zhengzhou, China)

  • Formaldehyde and xylene: Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China)

  • Hematoxylin: Beijing Zhong Shan Golden Bridge Biological Technology Co., Ltd. (Cat. No. ZLI-9610, Beijing, China)

  • Eosin: Beijing Zhong Shan Golden Bridge Biological Technology Co., Ltd. (Cat. No. ZLI-9613, Beijing, China)

  • DAB detection kit (for rabbit primary antibodies): Beijing Zhong Shan Golden Bridge Biological Technology Co., Ltd. (Cat. No. PV-6001, Beijing, China)

  • DAB detection kit (for mouse primary antibodies): Beijing Zhong Shan Golden Bridge Biological Technology Co., Ltd. (Cat. No. PV-9002, Beijing, China)

  • In situ cell death detection kit (POD): Roche Diagnostics GmbH (Cat. No. 11684817910; Mannheim, Germany)

  • GDNF ELISA kit: Elabscience Biotechnology Co., Ltd. (Cat. No. E-EL-M3028; Wuhan, China)

  • CSF1 ELISA kit: MultiSciences (Lianke) Biotech Co., Ltd. (Cat. No. EK2144; Hangzhou, China)

Antibodies:

  • PLZF: Santa Cruz Biotechnology (Cat. No. sc-28319; TX, USA)

  • SCF: Santa Cruz Biotechnology (Cat. No. sc-13126; TX, USA)

  • GFRα1: Santa Cruz Biotechnology (Cat. No. sc-271546; TX, USA)

  • C-kit: Abcam (Cat. No. ab256345; dilution; Cambridge, UK)

  • CSF1R: Proteintech (Cat. No. 25949-1-AP; Wuhan, China)

  • Collagen type I: Proteintech (Cat. No. 14695-1-AP; Wuhan, China)

  • Fibronectin: Proteintech (Cat. No. 66042-1-lg; Wuhan, China)

  • Ret: Beijing Bioss Biotech (Cat. No. bs-4998R; Beijing, China)

  • Laminin: Beijing Bioss Biotech (Cat. No. bs-0821R; Beijing, China)

  • PKC: Abcam (Cat. No. ab181558, Cambridge, UK)

  • p-PKC: Abcam (Cat. No. ab109539, Cambridge, UK)

  • PLCγ: Cell Signaling Technology (Cat. No. 5385, Boston, MA, USA)

  • p-PLCγ: Cell Signaling Technology (Cat. No. 2821, Boston, MA, USA)

Secondary antibody:

  • HRP-conjugated goat anti-rabbit IgG (H+L): Beijing Zhong Shan Golden Bridge Biological Technology Co., Ltd. (Cat. No. ZB-2301, Beijing, China).

Main instruments and Equipment

RM2235 paraffin sectioning machine: Leica Microsystems (Germany)

  • Tissue homogenizer: IKA Instruments (Germany)

  • Enzyme labeling instrument: Shanghai Bao Yu De Instruments (Shanghai, China)

  • PCR instrument: ABI7300, Applied Biosystems (USA)

  • General optical microscope: Meyer Instruments (Germany)

  • Electrophoresis instrument: Bio-Rad Laboratories (USA)

  • Protein electrotransfer apparatus: Bio-Rad Laboratories (USA)

Grouping, Drug Administration, and Sampling

The random number table approach applied to split 30 mice into five groups (each group n = 6): a control group; spermatogenic dysfunction model group; and WZYZW low-, medium-, and high-dose groups. The control group was gavaged with 0.5% sodium carboxymethylcellulose at 9:00 a.m. and 5:00 p.m. TP (0.05 mg/kg/d) (Guo et al., 2023) and 0.5% sodium carboxymethylcellulose were gavaged at 9:00 a.m. and 6:00 p.m., respectively, to the spermatogenic dysfunction model group. The three WZYZW groups were given TP (0.05 mg/kg/d) by gavage at 9:00 a.m., and along with modeling, different doses of WZYZW were given for gavage intervention at 6:00 p.m. Based on the body surface area of a 70 kg individual, the human equivalent dosage for the medium dose of various WZYZW was calculated as 12 g/kg/d (equivalent to 12.3 times the human dosage) (Nair & Jacob, 2016), with 6 g/kg for the low-dose group and 24 g/kg for the high-dose group. Gavage was continued for 35 days (Figure 1). Mice were weighed at the end of treatment. The testicular organ index was calculated by weighing both testes: organ index = organ mass/body weight × 100%. One testis from each mouse was preserved in formaldehyde for histopathological sectioning. The other testis was cut to remove the tunica albuginea, and the resulting fresh testicular tissue was frozen at −80°C for subsequent Western blotting and quantitative reverse transcription polymerase chain reaction (qRT-PCR).

Figure 1.

Mice, split into groups, receive placebo or WZYZW for 35 days as depicted in diagram.

Diagram of Mouse Grouping and Intervention

Histopathological Analysis of Testes

Testicular tissues were fixed in a 12% neutral formaldehyde solution for 48 h and then paraffin-embedded. Pathological sections measuring 5-μm were cut from the wax blocks. Deparaffinization with xylene and an ethanol gradient to water was performed, hematoxylin–eosin (HE) staining was applied, and after the sections were sealed with a neutral resin, pathological alterations in the testes of each group were examined under a light microscope (×40 objective).

TUNEL Staining

The paraffin sections were dewaxed to water and then antigenically repaired with sodium citrate buffer. The blocking solution was incubated for 1 h and then the TUNEL reaction solution was incubated for 1 h at ambient temperature. A 3% hydrogen peroxide was then blocked for 10 min. The sections were incubated with a POD-converting agent for 30 min at 37°C. DAB was used to develop the color, and hematoxylin stain was applied to the sections before being observed under a microscope. The brown color showed apoptotic cells, and the blue color showed normal cells (F. Wang et al., 2019).

Immunohistochemical Staining

To facilitate antigen retrieval, paraffin sections were dewaxed to water and then put in sodium citrate buffer. Afterward, endogenous peroxidase activity was suppressed with 3% hydrogen peroxide. Following a 1 h blocking period in goat serum, diluted primary antibody was applied to the sections dropwise. Next, the slices were incubated for an entire night at 4°C. The sections were then incubated overnight at 4 °C with the following primary antibodies: PLZF (1:200; Santa Cruz Biotechnology, Cat. No. sc-28319; TX, USA); SCF (1:50; Santa Cruz Biotechnology, Cat. No. sc-13126; TX, USA); GFRα1 (1:50; Santa Cruz Biotechnology, Cat. No. sc-271546; TX, USA); C-kit (1:1000; Abcam, Cat. No. ab256345; Cambridge, UK); CSF1R (1:100; Proteintech, Cat. No. 25949-1-AP; Wuhan, China); Collagen type I (1:1000; Proteintech, Cat. No. 14695-1-AP; Wuhan, China); Fibronectin (1:500; Proteintech, Cat. No. 66042-1-lg; Wuhan, China); Ret (1:1000; Beijing Bioss Biotech, Cat. No. bs-4998R; Beijing, China); Laminin (1:300; Beijing Bioss Biotech, Cat. No. bs-0821R; Beijing, China).

After adding diluted secondary antibody labeled with horseradish peroxidase (HRP) to the tissue, it was incubated for 1 h at the normal temperature. DAB was used to develop the color, and hematoxylin was used to restain the tissue. A light microscope with a ×40 objective was used to examine and take pictures of the tissue slices. The immunohistochemical results were analyzed semi-quantitatively using ImageJ 1.53t software (National Institutes of Health, Bethesda, MD, USA).

Enzyme-Linked Immunosorbent Assay

A sample of 20 mg testicular tissue was placed in 200 µL of precooled phosphate-buffered saline (PBS) and homogenized using a tissue homogenizer to prepare the tissue suspension. The supernatant was removed after centrifugation. Following the guidelines provided by the GDNF and CSF1 ELISA kits, the procedure was carried out. The OD450 absorbance value was measured and the final results were computed using a standard curve.

Western blotting

A quantity of 20 mg testicular tissue was added to 200 µL of RIPA lysis buffer with 1 µL of PMSF, 1 µL of Phosphatase Inhibitor Cocktail III, and 1 µL of Protease Inhibitor Cocktail. The tissue was homogenized using a tissue homogenizer and lysed on ice for 30 min. After lysis, the mixture was centrifuged at 12,000 rpm for 10 min, and the supernatant was transferred to a new 1.5 mL centrifuge tube. Then, 1/4 volume of 5× SDS buffer was added. The solution was mixed thoroughly and boiled for 10 min. Protein concentration was first determined using a BCA assay (Thermo Fisher Scientific, USA), and then 15 µg of protein was loaded per lane for separation on an 8% SDS-PAGE gel. After being electrophoresed, the whole protein was moved onto a polyvinylidene fluoride (PVDF) membrane. A 1 h blocking procedure using 5% skim milk powder was performed at room temperature on the membrane. After spending the whole night at 4°C submerged in the diluted primary antibody, the membrane was thoroughly washed using TBST three times the following day. The secondary antibody used was horseradish enzyme labeled goat anti-rabbit IgG (H+L) (1:4000; ZSGB-Bio Cat. No. ZB-2301, RRID: AB_2747412, Beijing Zhong Shan Golden Bridge Biological Technology, Beijing, China), and an additional 2 h was spent incubating the membrane at ambient temperature. ECL solution was added to the PVDF membrane, and darkroom film was exposed for development (F. Wang et al., 2024). PKC (1:2000; Abcam Cat. No. ab181558, RRID: AB_3662843, Rabbit monoclonal antibody, Cambridge, UK), p-PKC (1:2000; Abcam Cat. No. ab109539, AB_10863532, Rabbit monoclonal antibody, Cambridge, UK). PLCγ (1:2000; Cell Signaling Technology Cat. No. 5385, RRID: AB_2797610, Rabbit monoclonal antibody, Boston, MA, USA), p-PLCγ (1:2000; Cell Signaling Technology Cat. No. 2821, RRID: AB_2798485, Rabbit monoclonal antibody, Boston, MA, USA). ImageJ 1.53t software (National Institutes of Health) was used to do the gray value study. The relative expression of PLCγ, p-PLCγ, PKC, and p-PKC protein was calculated using β-actin as an internal reference.

qRT-PCR Analysis

Fresh testicular tissue was stirred in Trizol using a tissue homogenizer and lysed thoroughly, followed by the addition of chloroform and isopropanol to extract the RNA precipitate. DEPC water was added to the precipitate to fully dissolve the RNA. The RNA concentration was calculated using a NanoPhotometer spectrophotometer. Following reverse transcription of RNA to cDNA, real-time quantitative RT-PCR was performed using a standard reaction program. The qRT-PCR thermocycling conditions were as follows: (1) 50°C for 2 min, (2) 95°C for 10 min, (3) 95°C for 15 s, (4) 60°C for 1 min. Steps (3) and (4) were repeated for 40 cycles. With β-actin serving as an internal reference, the relative expression of the PLCγ and PKC genes was determined. The primer sequences were: PLCγ forward AAGAGCAGTCTC-CGAGGTCT, reverse TTGCTTGGTGCTGTCGTACT; PKC forward CAGGAGAATCGACTGGGAGA, reverse CCTTTGCCACACACTTTGGG; and β-actin forward GAAATCGTGCGTGACATCAAAG, reverse TGTAG-TTTCATGGATGCCACAG. We validated the primer sequences using the NCBI BLAST tool, and the results showed that these primers have good specificity, matching highly with the target gene sequences and showing no nonspecific matches. Gene expression levels were determined using the 2−△△Ct method, with β-actin as the internal control.

Statistical Analysis

Normality of the data distribution was assessed using the Shapiro-Wilk test before analysis. For normally distributed data, if equal variances were met, one-way analysis of variance (ANOVA) was performed, followed by Tukey’s HSD (Honest Significant Difference) post hoc test to determine which specific groups differed significantly. If the data met the normality assumption but not the homogeneity of variances, the Games-Howell post hoc test was used for further analysis. If the data did not meet the assumptions of normal distribution, the Kruskal–Wallis test was used as a nonparametric alternative. All data analysis, including the aforementioned statistical tests, were conducted using SPSS 26.0 software (SPSS Inc., Chicago, IL, USA), with a significance level set at p < .05. GraphPad Prism 8.0 software (GraphPad Software Inc., La Jolla, CA, USA) was used solely to generate histograms for data visualization.

Results

WZYZW Main Chemical Composition

The chemical profiles of WZYZW were examined using LC-MS in positive and negative ion mode and a total of 418 chemical components were identified (Table 1, Supplementary File 1). Table 1 displays the top 10 expressed chemical ingredients, which include citric acid dl-valine and oxoglutaric acid.

Table 1.

Main Chemical Composition of WZYZW.

No. Compound Formula Retention time (min) m/z Adducts Ratio of peak area
1 Citric acid C6H8O7 1.03 191.0192 M-H 18.09667222
2 DL-Valine C5H11NO2 0.78 118.0865 M+H 11.48181151
3 Oxoglutaric acid C5H6O5 0.86 191.0192 M+FA-H 8.949231621
4 Luciferin C11H8N2O3S2 5.47 281.0048 M+H, M+Na 6.134060372
5 L-Proline C5H9NO2 0.78 116.0709 M+H, M+Na 5.435130225
6 epi-Lactose C12H22O11 0.75 381.0794 M+K 5.406772901
7 5-Hydroxymethylfurfural C6H6O3 2.3 127.0392 M+H-H2O, M+H 3.642016325
8 7-[(beta-d-glucopyranosyl)oxy]-3ʹ,4ʹ,5,8-tetrahydroxyflavone C21H20O12 4.75 465.103 M+H, M+Na, M+K 3.300381174
9 Ascorbyl glucoside C12H18O11 0.81 361.0741 M+H, M+Na, M+NH4 3.116816841
10 Sucrose C12H22O11 0.77 365.1055 M+Na 2.974821942

WZYZW Improves the Spermatogenic Function of Mouse Testes

The control group displayed normal testicular morphology, while the spermatogenic disorder model group exhibited testicular shrinkage and reduced testicular weight. There was a dose-dependent increase in testicular weight after WZYZW intervention (Figure 2A and B). In addition, the testicular organ index of the model group significantly decreased compared with the control group (p < .01), and there was a significant improvement in the testicular organ index in the high-dose WZYZW group (p < .01) (Figure 2C and D).

Figure 2.

Compare testis weight, body weight, organ index, histology, and Johnsen score with WZYZW low, medium, and high doses in mice.

Testicular Histopathological Assessment. (A) Testicular Tissue Appearance; (B-D) Testicular Weight, Body Weight and Testicular Organ index Comparison Between Groups of Mice After Intervention; (E) Hematoxylin-Eosin Staining of Testes

* Indicates disorganized spermatogenic tubules, → indicates spermatogenic vacuoles, magnification: 400 ×, scale bar: 50 μm; (F) Comparison of Johnsen score of testes between groups after intervention. *p < .05, **p < .01 versus control group. Data represent mean ± SD, n = 6. #p < .05, ##p < .01 versus model group. &p < .05 versus WZYZW low-dose group. $p < .05 versus WZYZW medium-dose group.

HE staining showed that the control group displayed normal spermatogenic tubule morphology with organized spermatogenic cell arrangements and normal sperm. In contrast, the spermatogenic disorder model group showed decreased spermatogenic cell numbers, disorganized arrangements, and reduced spermatozoa in some tubules, despite generally normal seminiferous tubule morphology (Figure 2E).

After intervention with various doses of WZYZW, the quantity and arrangement of spermatogenic cells at all levels in all groups of mice progressively recovered, and the spermatozoa gradually increased compared with the spermatogenic disorder model group (Figure 2E). Compared with the spermatogenic disorder model group, all testicular Johnsen scores showed improvement (p < .05). In addition, the high-dose WZYZW group outperformed the low- and medium-dose WZYZW groups in terms of testicular Johnsen scores (p < .05) (Figure 2F). This indicated that the impaired spermatogenic function of the mice improved as the intervention dose of WZYZW increased.

Statistical analysis of the above data was performed using one-way ANOVA followed by Tukey’s HSD test for multiple comparisons. Furthermore, the spermatogenic disorder model group saw an increase in testicular spermatogenic cell death in comparison with the control group, which was decreased by WZYZW intervention (Figure 3).

Figure 3.

TUNEL staining of testes. (A) Control Group; (B) Model Group; (C) WZYZW Low-Dose Group; (D) WZYZW Medium-Dose Group; (E) WZYZW High-Dose Group. → Indicates Apoptotic Cells\r\nMagnification: 200 ×, scale bar: 50 μm, n = 6.

TUNEL staining of testes. (A) Control Group; (B) Model Group; (C) WZYZW Low-Dose Group; (D) WZYZW Medium-Dose Group; (E) WZYZW High-Dose Group. → Indicates Apoptotic Cells

Magnification: 200 ×, scale bar: 50 μm, n = 6.

WZYZW Improves the Physical Microenvironment of Spermatogenesis

Laminin, type I collagen, and fibronectin expressions were downregulated (p < .05, p < .05, p < .01, respectively) in the model group compared with the control. High-dose WZYZW significantly upregulated type I collagen expression (p < .01) in contrast to both the low-dose and model groups. All WZYZW doses enhanced laminin expression, with low-dose showing the greatest increase (p < .01). High-dose WZYZW significantly elevated fibronectin expression over the model group and the other doses (p < .01) (Figure 4).

Figure 4.

Imatest for a study on WZYZW doses' effects on the testicular microenvironment in mice.

Impacts of Varying WZYZW Dosages on the Testicular Microenvironment in Mice. (A) Control Group; (B) Model Group; (C) WZYZW Low-Dose Group; (D) WZYZW Medium-Dose Group; (E) WZYZW High-Dose Group; (F–H) Statistical Analysis of the Average Optical Density of Laminin Type I Collagen, Laminin and Fibronectin

Magnification: 400 ×, scale bar: 50 μm, → indicates positive expression region. Data represent mean ± SD, n = 6. *p < .05, **p < .01 versus control group. #p < .05, ##p < .01 versus model group. &&p < .01 versus WZYZW low-dose group. $$p < .01 versus WZYZW medium-dose group.

The expression levels of Laminin, type I collagen and fibronectin were analyzed using one-way ANOVA followed by Tukey’s HSD test.

WZYZW Improves the Spermatogenic Metabolic Microenvironment

The model group had a significant decrease in the levels of both GDNF and CSF1 proteins (p < .05), and as the medication concentration rose after WZYZW intervention, so did the release of these proteins. When GDNF expression was compared with the model group, the WZYZW groups receiving medium- and high-doses were noticeably greater (p < .05), whereas in contrast to both the model and low-dose WZYZW groups, those given a high dosage of WZYZW had substantially more CSF1 expression (p < .05) (Table 2).

Table 2.

Impacts of Varying WZYZW Dosages on the Protein Expression of GDNF and CSF1 ( x¯±S , n = 5).

Group GDNF (pg/mg) CSF1 (pg/mg)
Control 32.96 ± 3.76 60.44 ± 14.44
Model 20.57 ± 3.95 * 26.49 ± 4.41 *
Low-dose WZYZW 23.21 ± 5.65 29.20 ± 8.59
Medium-dose WZYZW 26.32 ± 2.64 # 35.76 ± 7.42
High-dose WZYZW 26.10 ± 1.24 # 47.32 ± 9.14 # &

Note. In contrast with the control group, *p < .05. In contrast with the model group, #p < .05. In contrast with the low-dose WZYZW group, &p < .05.

The expression levels of GDNF and CSF1 were performed using one-way ANOVA followed by Tukey’s HSD test for multiple comparisons.

WZYZW Improves the Self-Renewal and Differentiation of SSCs

The model group showed a significant decrease in self-renewal proteins GFRα1, Ret, and PLZF (p < .01). The medium- and high-dose WZYZW groups exhibited markedly elevated GFRα1 and PLZF levels (p < .01). RET protein levels were significantly lower in the model group than in the WZYZW groups (p < .01), and higher in the medium- and high-dose WZYZW groups compared with the low-dose group (p < .05). CSF1R protein levels did not significantly differ among the groups (p > .05) (Figure 5).

Figure 5.

The image presents the impact of varying WZYZW dosages on the expression of self-renewal related proteins in MSCs.

Impacts of Varying WZYZW Dosages on the Expression of Self-Renewal-Related Proteins in Mice SSCs. (A) Control Group; (B) Model Group; (C) WZYZW Low-Dose Group; (D) WZYZW Medium-Dose Group; (E) WZYZW High-Dose Group; (F–I) Statistical Analysis of the Average Optical Density of GFRα1, Ret, PLZF and CSF1R Mean Optical Density

Magnification: 400×, scale bar: 50 μm, → indicates positive expression region. Data represent mean ± SD, n = 6. **p < .01 versus control group. ##p < .01 versus model group. &p < .05, &&p < .01 versus WZYZW low-dose group. $$p < .01 versus WZYZW medium-dose group.

The model group emitted much less SCF and C-kit proteins (p < .05, p < .01, respectively), which are associated with the differentiation of testicular SSCs. In addition, C-kit and SCF were noticeably greater among the groups receiving WZYZW at medium or high dosages in contrast with the model group (p < .05). Between the various doses of WZYZW groups, there was no discernible change in C-kit protein (p > .05). High dosages better enhanced SCF protein expression in the WZYZW treatment group (p < .05) (Figure 6).

Figure 6.

Improvements of Mice SSC's Protein Expression with Different WZYZW Concentrations. (A) Control Group; (B) Model Group; (C) WZYZW Low-Dose Group; (D) WZYZW Medium-Dose Group; (E) WZYZW High-Dose Group; (F-G) Statistical Analysis of C-Kit and SCF Optical Density. Magnification: 400×, scale bar: 50 μm, → indicates positive expression region. Data represent mean ± SD, n = 6. *p < .05, **p < .01 versus control group. #p < .05, ##p < .01 versus model group. &p < .05 versus WZYZW low-dose group.

Impacts of Varying WZYZW Dosages on the Expression of Proteins Related to the Self-Differentiation of Mice SSCs. (A) Control Group; (B) Model Group; (C) WZYZW Low-Dose Group; (D) WZYZW Medium-Dose Group; (E) WZYZW High-Dose Group; (F&G) Statistical Analysis of the Average Optical Density of C-Kit and SCF

Magnification: 400×, scale bar: 50 μm, → indicates positive expression region. Data represent mean ± SD, n = 6. *p < .05, **p < .01 versus control group. #p < .05, ##p < .01 versus model group. &p < .05 versus WZYZW low-dose group.

Statistical analysis of the above data was performed using one-way ANOVA followed by Tukey’s HSD test for multiple comparisons.

Effects of WZYZW on Protein and Gene Expression of the PLCγ/PKC Pathway in the Testes of TP-Treated Mice

Testes from the spermatogenic disorder model group showed lower levels of PLCγ, PKC, and p-PKC expression than the control group (p < .05). Nonetheless, no noteworthy distinction was seen in the phosphorylation ratios of p-PKC/PKC and p-PLCγ/PLCγ. WZYZW treatment at medium-dose significantly upregulated PLCγ and p-PLCγ proteins compared with the model group (p < .05). High-dose WZYZW further enhanced PKC protein expression (p < .05), while all doses increased p-PKC levels, albeit nonsignificantly. No notable changes were observed in p-PKC/PKC or p-PLCγ/PLCγ phosphorylation ratios among groups (Figure 7A–E).

Figure 7.

PLCγ/PKC Pathway Protein and Gene Expression: (A) Immunoblot of PLCγ, p-PLCγ, PKC, p-PKC Proteins Expression in Testicular Tissues of Mice in Each Group; (B–E) Average Optical Densities of PLCγ, p-PLCγ, PKC, and p-PKC Proteins Compared With That of β-Actin Protein, Respectively; (F-G) The mRNA Levels of PLCγ and PKC\r\n*p< .05 versus control group. #p< .05 versus model group. Data represent mean ± SD, n=3. &&p< .01 versus WZYZW low-dose group. $$p< .01 versus WZYZW medium-dose group.

PLCγ/PKC Pathway Protein and Gene Expression. (A) Immunoblot of PLCγ, p-PLCγ, PKC, p-PKC Proteins Expression in Testicular Tissues of Mice in Each Group; (B–E) Average Optical Densities of PLCγ, p-PLCγ, PKC and p-PKC Proteins Compared With That of β-Actin Protein, Respectively; (F&G) The mRNA Levels of PLCγ and PKC

*p < .05 versus control group. #p < .05 versus model group. Data represent mean ± SD, n = 3. &&p < .01 versus WZYZW low-dose group. $$p < .01 versus WZYZW medium-dose group.

qRT-PCR analysis indicated decreased PLCγ and PKC gene expression in the spermatogenic disorder model group compared with controls, though not statistically significant (p > .05). High-dose WZYZW treatment elevated testicular PLCγ expression in mice, albeit nonsignificantly (p > .05). PKC gene expression gradually increased in WZYZW-treated groups, with the high-dose group exhibiting significant upregulation (p < .05) (Figure 7F and G).

Statistical analys is of the above data was performed using one-way ANOVA followed by Tukey’s HSD test for multiple comparisons.

Discussion

As a classic formula for boosting essence and tonifying the kidney, WZYZW has been widely used in treating male infertility associated with kidney deficiency patterns in traditional Chinese medicine (Wu et al., 2021). Although its clinical application is well-documented, the exact mechanism by which WZYZW enhances male fertility has yet to be fully understood. This research explores how WZYZW improves testicular spermatogenic dysfunction caused by TP by targeting the spermatogenic microenvironment and PLCγ/PKC pathway.

TP has been confirmed to cause testicular toxicity, which can damage germ cells, and was used to construct an animal model of testicular spermatogenic disorders (W. Zhang et al., 2023). In this study, the model group exhibited testicular damage similar to that previously reported in the literature, including testicular atrophy, reduction of spermatogonial cells, and tissue disorganization (Qin et al., 2023; X. Zhang et al., 2021). However, after intervention with different doses of WZYZW, the testicular structural damage caused by TP was reversed, including an increase of spermatogenic cells and a decrease of vacuolization of spermatogenic tubules. Spermatogonial function appeared to be restored to varying degrees in the low-, medium-, and high-dose treatment groups of WZYZW, and its testicular organ index and Johnsen score gradually increased in comparison with those of the model group. These results suggest that WZYZW mitigated the testicular damage caused by TP and demonstrated a dose dependence. In addition, TUNEL staining showed that WZYZW effectively reduced apoptosis of spermatogenic cells caused by TP.

Spermatogenesis is a complex but highly coordinated process in which multiple cellular and molecular signaling pathways interact with each other to ensure the successful maturation of spermatozoa. SSCs are at the core of this process and can differentiate and giving rise to the entire spermatogonial spectrum (Ibtisham & Honaramooz, 2020). Some of the SSCs remain self-renewing to maintain the stem cell population, while the rest become differentiated SSCs that develop into spermatogonia and eventually spermatids (Lord & Nixon, 2020; Sanou et al., 2022). This process is essential for maintaining male fertility. Single-cell RNA sequencing results have shown that an increased number of undifferentiated SSCs (PIWIL4+) contribute to male infertility (Di Persio et al., 2021). The stability of the spermatogenic microenvironment is necessary to sustain SSC renewal and differentiation. Previous studies (Pan et al., 2021) have demonstrated the therapeutic efficacy of WZYZW in alleviating TP-induced damage to SCs and blood–testis barrier dysfunction, mainly focusing on histological restoration, pro-inflammatory cytokines, and cytoskeletal proteins. In contrast, our study expands upon these findings by systematically evaluating the regulatory role of WZYZW on the spermatogenic microenvironment, including both the physical and metabolic components. More importantly, we explored its potential mechanism in modulating SSC self-renewal and differentiation through the PLCγ/PKC signaling pathway. These findings offer new insights into how WZYZW may promote spermatogenic recovery by stabilizing the microenvironment and regulating SSC fate, thereby contributing novel mechanistic understanding to its protective effects against male reproductive toxicity.

In rodent and human testes, the extracellular matrix secreted by SCs and PMCs co-precipitates to form a basement membrane that surrounds the epithelial base of the spermatogenic tubules, which is in physical contact with the SSCs, and participates in the construction of the BTB to create a steady physical microenvironment that supports the spermatogenic activity (Bu et al., 2022). Specifically, SCs synthesize and secrete laminin, collagen, and glycoproteins, which together with type I collagen, glycoproteins, and fibronectin synthesized by PMCs, help keep the BTB integrity, and make the barrier more compact (Y. Gao et al., 2017; H. Li et al., 2020). It is possible that laminin, fibronectin, and type I collagen regulate the adherence of SSCs and spermatogonia to the basement membrane, as well as the subsequent migration and segregation of spermatocytes and spermatids into the tubule lumen (Bondarenko et al., 2011; Schaller et al., 1993; Siu & Cheng, 2008). Our study revealed that TP inhibited the expression of laminin, fibronectin and type I collagen in the mouse testes, destabilized the physical microenvironment of spermatogenesis, and led to reduced spermatogenic function. In contrast, WZYZW intervention increased the levels of laminin, type I collagen, and fibronectin, maintained the integrity of the basement membrane-mediated physical microenvironment, and positively affected the differentiation of SSCs.

GDNF, primarily secreted by SCs, plays a pivotal role in the self-renewal of SSCs, with its effects being dose-dependent (Takashima et al., 2015). Excessive GDNF expression may lead to abnormal SSCs proliferation and malignant transformation (Meng et al., 2001), whereas GDNF deficiency results in SSCs depletion and male infertility (Meng et al., 2000). PMCs also contribute low levels of GDNF and are key producers of CSF1, another essential growth factor in the spermatogenic microenvironment. Studies have shown that the addition of CSF1 to a GDNF- and FGF2-containing medium significantly enhances SSC self-renewal efficiency, suggesting a synergistic regulatory role between GDNF and CSF1 (J. M. Oatley et al., 2009). Mechanistically, GDNF binds to the SSC surface receptor GFRα1 to form the GDNF/GFRα1/RET complex, while CSF1 activates the CSF1R receptor, both initiating downstream signaling pathways that support SSCs renewal, proliferation, and survival (Bhang et al., 2018; Doretto et al., 2022). In this study, TP exposure significantly downregulated GDNF, CSF1, GFRα1, and RET protein expression, indicating disruption of the metabolic microenvironment essential for spermatogenesis. Notably, WZYZW treatment reversed these changes in a dose-dependent manner, suggesting it restores microenvironmental homeostasis and promotes SSC function. The GDNF/GFRα1/Ret complex and CSF1/CSF1R complex activate multiple downstream signaling pathways to promote functional cellular metabolism (M. Wang et al., 2017). The PLCγ/PKC signaling pathway is a crucial mechanism that governs the SC GDNF-PMC CSF1 synergistic network among them (Kiss Bimbova et al., 2022). Our results indicate that WZYZW increased PLCγ and PKC gene and protein levels and activated the PLCγ/PKC signaling pathway, which in turn promoted the self-renewal and differentiation of SSCs and improved spermatogenesis.

In addition to being an important marker of SSC function, the multifunctional transcription factor PLZF plays a role in SSC self-renewal. Mice lacking PLZF exhibit depletion of SSCs and impaired spermatogenesis, which ultimately results in infertility (X. Gao et al., 2019; Sharma et al., 2019). SCF is a particular ligand for the tyrosine kinase receptor C-kit. The link between SCF and C-kit initiates many signaling pathways and controls a range of biological functions. Testicular meiosis, apoptosis, and germ cell proliferation are thought to be regulated by the SCF/C-kit system, which are crucial for the maintenance and development of a healthy male germline stem cell pool (Cardoso et al., 2017; Feng et al., 2000). If binding between SCF and C-kit is blocked, SSCs are unable to proliferate and apoptosis is promoted (Packer et al., 1995). Studies have shown (Cardoso et al., 2014; Devouassoux-Shisheboran et al., 2003) that the density of SCF in the testes of normal men is significantly higher than that of infertile men, while the C-kit receptor is expressed less in the testes of infertile males. Our research revealed that TP showed a significant reduction in the expression of proteins involved in SSC self-renewal and differentiation, while WZYZW upregulated these proteins, maintained the homeostasis of SSCs, and reversed the disruption of SSCs by TP.

To summarize, WZYZW promotes the restoration of spermatogenesis by enhancing key molecular factors such as GDNF, PLZF, and CSF1, stabilizing the basement membrane, and activating the critical signaling pathway PLCγ/PKC. These molecular improvements translate into reduced apoptosis, improved testicular structure and function, and enhanced SSC self-renewal and differentiation. Together, these effects demonstrate that WZYZW holds promise as a multi-target therapeutic agent for male infertility.

In comparison with existing treatments for male infertility, such as hormonal therapy and antioxidant-based interventions, WZYZW may offer several unique advantages. Hormonal therapies, including gonadotropin or androgen supplementation, primarily aim to restore hormonal balance and stimulate spermatogenesis but are often associated with limited efficacy in non-endocrine-related infertility and may carry systemic side effects (Habous et al., 2018). Similarly, antioxidant agents such as folic acid and coenzyme Q10 have shown limited therapeutic efficacy in improving male fertility outcomes (Stenqvist et al., 2018). In contrast, WZYZW appears to exert multi-target effects by modulating both the physical and metabolic spermatogenic microenvironments, enhancing basement membrane stability, and activating key signaling pathways including the PLCγ/PKC axis, thereby comprehensively promoting SSC self-renewal and differentiation. These mechanisms suggest that WZYZW may serve as a promising multi-target intervention in the treatment of male infertility. Further studies, including direct comparative evaluations with existing therapeutic options, are warranted to validate its clinical efficacy and translational potential. In addition, some preliminary clinical trials have shown that WZYZW can significantly increase sperm concentration and motility in patients, while also regulating FSH/LH levels, further supporting its potential for clinical application (Zhou et al., 2019).

Despite the promising findings of this study, several limitations should be acknowledged. First, the current research was conducted using a mouse model of TP-induced testicular toxicity, which may not fully recapitulate the complex pathophysiology of human male infertility. Second, while we demonstrated that WZYZW modulates key signaling pathways such as PLCγ/PKC and improves SSC renewal and differentiation, the precise molecular targets and long-term safety profile of WZYZW remain to be elucidated. Third, clinical trials are necessary to evaluate the efficacy, dosage optimization, and potential side effects of WZYZW in humans. Addressing these challenges in future studies will be crucial for advancing WZYZW from bench to bedside and for developing more comprehensive therapies for male reproductive disorders.

Conclusion

In conclusion, in vivo experimental studies have shown that WZYZW improves spermatogenic metabolism and the physical microenvironment, which in turn improves the expression of proteins related to self-renewal and differentiation of SSCs, thus improving the function of spermatogenesis in a mouse model with a spermatogenic disorder. The mechanism may involve regulation of the PLCγ/PKC pathway. The above findings indicate that WZYZW has the effect of improving spermatogenic function, providing a theoretical basis for the clinical application and promotion of WZYZW in the treatment of male infertility.

Supplemental Material

sj-xlsx-1-jmh-10.1177_15579883251371990 – Supplemental material for Wu Zi Yan Zong Wan Improves Triptolide-Induced Testicular Spermatogenic Dysfunction Through the Spermatogenic Microenvironment and the PLCγ/PKC Pathway

Supplemental material, sj-xlsx-1-jmh-10.1177_15579883251371990 for Wu Zi Yan Zong Wan Improves Triptolide-Induced Testicular Spermatogenic Dysfunction Through the Spermatogenic Microenvironment and the PLCγ/PKC Pathway by Lei Zhang, Binghao Bao, Weizhen Wu, Haolang Wen, Suyan Tong, Xueyan Wang and Baoxing Liu in American Journal of Men's Health

Acknowledgments

All authors of the manuscript are grateful for the invaluable support of the National Natural Science Foundation of China.

Footnotes

Consent for Publication: Not applicable.

Funding: The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the National Natural Science Foundation of China (No. 82274517).

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement: The data that support the findings of this study are available from the corresponding author on reasonable request.

Supplemental Material: Supplemental material for this article is available online.

References

  1. Bhang D. H., Kim B. J., Kim B. G., Schadler K., Baek K. H., Kim Y. H., Hsiao W., Ding B. S., Rafii S., Weiss M. J., Chou S. T., Kolon T. F., Ginsberg J. P., Ryu B. Y., Ryeom S. (2018). Testicular endothelial cells are a critical population in the germline stem cell niche. Nature Communications, 9(1), 4379. 10.1038/s41467-018-06881-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bondarenko L. B., Shayakhmetova G. M., Byshovets T. F., Kovalenko V. M. (2011). Pyrazinamide-mediated changes in rat type I collagen and spermatogenesis indices. Acta Poloniae Pharmaceutica, 68(2), 285–290. [PubMed] [Google Scholar]
  3. Bu T., Wang L., Wu X., Li L., Mao B., Wong C. K. C., Perrotta A., Silvestrini B., Sun F., Cheng C. Y. (2022). A laminin-based local regulatory network in the testis that supports spermatogenesis. Seminars in Cell & Developmental Biology, 121, 40–52. 10.1016/j.semcdb.2021.03.025 [DOI] [PubMed] [Google Scholar]
  4. Cardoso H. J., Figueira M. I., Correia S., Vaz C. V., Socorro S. (2014). The SCF/c-KIT system in the male: Survival strategies in fertility and cancer. Molecular Reproduction and Development, 81(12), 1064–1079. 10.1002/mrd.22430 [DOI] [PubMed] [Google Scholar]
  5. Cardoso H. J., Figueira M. I., Socorro S. (2017). The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer. Journal of Cell Communication and Signaling, 11(4), 297–307. 10.1007/s12079-017-0399-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen J., Chen J., Fang Y., Shen Q., Zhao K., Liu C., Zhang H. (2023). Microbiology and immune mechanisms associated with male infertility. Frontiers in Immunology, 14, 1139450. 10.3389/fimmu.2023.1139450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen K. Q., Wei B. H., Hao S. L., Yang W. X. (2022). The PI3K/AKT signaling pathway: How does it regulate development of Sertoli cells and spermatogenic cells? Histology and Histopathology, 37(7), 621–636. 10.14670/HH-18-457 [DOI] [PubMed] [Google Scholar]
  8. Chinese Pharmacopoeia, Commission. (2020). Pharmacopoeia of the People’s Republic of China: Part I. [Google Scholar]
  9. Devouassoux-Shisheboran M., Mauduit C., Tabone E., Droz J. P., Benahmed M. (2003). Growth regulatory factors and signalling proteins in testicular germ cell tumours. APMIS: Acta pathologica, microbiologica, et immunologica Scandinavica, 111(1), 212–224. 10.1034/j.1600-0463.2003.11101251.x [DOI] [PubMed] [Google Scholar]
  10. Di Persio S., Tekath T., Siebert-Kuss L. M., Cremers J. F., Wistuba J., Li X., Meyer Zu Hörste G., Drexler H. C. A., Wyrwoll M. J., Tüttelmann F., Dugas M., Kliesch S., Schlatt S., Laurentino S., Neuhaus N. (2021). Single-cell RNA-seq unravels alterations of the human spermatogonial stem cell compartment in patients with impaired spermatogenesis. Cell Reports. Medicine, 2(9), 100395. 10.1016/j.xcrm.2021.100395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Doretto L. B., Butzge A. J., Nakajima R. T., Martinez E. R. M., de Souza B. M., Rodrigues M. D. S., Rosa I. F., Ricci J. M. B., Tovo-Neto A., Costa D. F., Malafaia G., Shao C., Nóbrega R. H. (2022). Gdnf acts as a germ cell-derived growth factor and regulates the zebrafish germ stem cell niche in autocrine- and paracrine-dependent manners. Cells, 11(8), 1295. 10.3390/cells11081295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Eisenberg M. L., Esteves S. C., Lamb D. J., Hotaling J. M., Giwercman A., Hwang K., Cheng Y. S. (2023). Male infertility. Nature Reviews. Disease Primers, 9(1), 49. 10.1038/s41572-023-00459-w [DOI] [PubMed] [Google Scholar]
  13. Feng L. X., Ravindranath N., Dym M. (2000). Stem cell factor/c-kit up-regulates cyclin D3 and promotes cell cycle progression via the phosphoinositide 3-kinase/p70 S6 kinase pathway in spermatogonia. The Journal of Biological Chemistry, 275(33), 25572–25576. 10.1074/jbc.M002218200 [DOI] [PubMed] [Google Scholar]
  14. Gao X., Chen H., Liu J., Shen S., Wang Q., Clement T. M., Deskin B. J., Chen C., Zhao D., Wang L., Guo L., Ma X., Zhang B., Xu Y., Li X., Li L. (2019). The REGγ-proteasome regulates spermatogenesis partially by P53-PLZF signaling. Stem Cell Reports, 13(3), 559–571. 10.1016/j.stemcr.2019.07.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gao Y., Mruk D., Chen H., Lui W. Y., Lee W. M., Cheng C. Y. (2017). Regulation of the blood-testis barrier by a local axis in the testis: Role of laminin α2 in the basement membrane. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology, 31(2), 584–597. 10.1096/fj.201600870R [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Guo J., Bao B., Song A., Zhang X., Zhang T., Ke Z., Pan Z., Wang F., Deng T., Huang H., Liu B. (2023). Impairment of spermatogenic function in mice by Lei Gong Teng Methylin and its mechanism. World Journal of Integrative Medicine, 18(6), 1152–1157+1163. 10.13935/j.cnki.sjzx.230617 [DOI] [Google Scholar]
  17. Habous M., Giona S., Tealab A., Aziz M., Williamson B., Nassar M., Abdelrahman Z., Remeah A., Abdelkader M., Binsaleh S., Muir G. (2018). Clomiphene citrate and human chorionic gonadotropin are both effective in restoring testosterone in hypogonadism: A short-course randomized study. BJU International, 122(5), 889–897. 10.1111/bju.14401 [DOI] [PubMed] [Google Scholar]
  18. Ibtisham F., Honaramooz A. (2020). Spermatogonial stem cells for in vitro spermatogenesis and in vivo restoration of fertility. Cells, 9(3), 745. 10.3390/cells9030745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jang H. J., Suh P. G., Lee Y. J., Shin K. J., Cocco L., Chae Y. C. (2018). PLCγ1: Potential arbitrator of cancer progression. Advances in Biological Regulation, 67, 179–189. 10.1016/j.jbior.2017.11.003 [DOI] [PubMed] [Google Scholar]
  20. Kim Y. H., Lee Y. A., Kim B. J., Kim K. J., Ryu B. Y. (2014). Protein kinase c regulates self-renewal of mouse spermatogonial stem cells. Tissue Engineering & Regenerative Medicine, 11(1), 67–74. https://doi:10.1007/s13770-013-1112-y [Google Scholar]
  21. Kiss Bimbova K., Bacova M., Kisucka A., Galik J., Zavacky P., Lukacova N. (2022). Activation of three major signaling pathways after endurance training and spinal cord injury. Molecular Neurobiology, 59(2), 950–967. 10.1007/s12035-021-02628-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kokkinaki M., Lee T. L., He Z., Jiang J., Golestaneh N., Hofmann M. C., Chan W. Y., Dym M. (2009). The molecular signature of spermatogonial stem/progenitor cells in the 6-day-old mouse testis. Biology of Reproduction, 80(4), 707–717. 10.1095/biolreprod.108.073809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li H., Liu S., Wu S., Li L., Ge R., Cheng C. Y. (2020). Bioactive fragments of laminin and collagen chains: Lesson from the testis. Reproduction (Cambridge, England), 159(3), R111–R123. 10.1530/REP-19-0288 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li X. J., Jiang Z. Z., Zhang L. Y. (2014). Triptolide: Progress on research in pharmacodynamics and toxicology. Journal of Ethnopharmacology, 155(1), 67–79. 10.1016/j.jep.2014.06.006 [DOI] [PubMed] [Google Scholar]
  25. Lord T., Nixon B. (2020). Metabolic changes accompanying spermatogonial stem cell differentiation. Developmental Cell, 52(4), 399–411. 10.1016/j.devcel.2020.01.014 [DOI] [PubMed] [Google Scholar]
  26. Maurya S., Kesari K. K., Roychoudhury S., Kolleboyina J., Jha N. K., Jha S. K., Sharma A., Kumar A., Rathi B., Kumar D. (2022). Metabolic dysregulation and sperm motility in male infertility. Advances in Experimental Medicine and Biology, 1358, 257–273. 10.1007/978-3-030-89340-8_12 [DOI] [PubMed] [Google Scholar]
  27. Mazzilli R., Rucci C., Vaiarelli A., Cimadomo D., Ubaldi F. M., Foresta C., Ferlin A. (2023). Male factor infertility and assisted reproductive technologies: Indications, minimum access criteria and outcomes. Journal of Endocrinological Investigation, 46(6), 1079–1085. 10.1007/s40618-022-02000-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Meng X., de Rooij D. G., Westerdahl K., Saarma M., Sariola H. (2001). Promotion of seminomatous tumors by targeted overexpression of glial cell line-derived neurotrophic factor in mouse testis. Cancer Research, 61(8), 3267–3271. 10.1016/S0165-4608(00)00403-9 [DOI] [PubMed] [Google Scholar]
  29. Meng X., Lindahl M., Hyvönen M. E., Parvinen M., de Rooij D. G., Hess M. W., Raatikainen-Ahokas A., Sainio K., Rauvala H., Lakso M., Pichel J. G., Westphal H., Saarma M., Sariola H. (2000). Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science, 287(5457), 1489–1493. 10.1126/science.287.5457.1489 [DOI] [PubMed] [Google Scholar]
  30. Mital P., Hinton B. T., Dufour J. M. (2011). The blood-testis and blood-epididymis barriers are more than just their tight junctions. Biology of Reproduction, 84(5), 851–858. 10.1095/biolreprod.110.087452 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nair A. B., Jacob S. (2016). A simple practice guide for dose conversion between animals and human. Journal of Basic and Clinical Pharmacy, 7(2), 27–31. 10.4103/0976-0105.177703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ni B., Jiang Z., Huang X., Xu F., Zhang R., Zhang Z., Tian Y., Wang T., Zhu T., Liu J., Zhang L. (2008). Male reproductive toxicity and toxicokinetics of triptolide in rats. Arzneimittel-forschung, 58(12), 673–680. 10.1055/s-0031-1296570 [DOI] [PubMed] [Google Scholar]
  33. Oatley J. M., Oatley M. J., Avarbock M. R., Tobias J. W., Brinster R. L. (2009). Colony stimulating factor 1 is an extrinsic stimulator of mouse spermatogonial stem cell self-renewal. Development, 136(7), 1191–1199. 10.1242/dev.032243 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Oatley M. J., Racicot K. E., Oatley J. M. (2011). Sertoli cells dictate spermatogonial stem cell niches in the mouse testis. Biology of Reproduction, 84(4), 639–645. 10.1095/biolreprod.110.087320 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Packer A. I., Besmer P., Bachvarova R. F. (1995). Kit ligand mediates survival of type A spermatogonia and dividing spermatocytes in postnatal mouse testes. Molecular Reproduction and Development, 42(3), 303–310. 10.1002/mrd.1080420307 [DOI] [PubMed] [Google Scholar]
  36. Pan Z., Gao Y., Liu S., Ke Z., Guo J., Ma W., Cui T., Liu B., Zhang X. (2021). Wu-Zi-Yan-Zong-Wan protects mouse blood-testis barrier from Tripterygium wilfordii Hook. f. multiglycoside-induced disruption by regulating proinflammatory cytokines. Journal of Ethnopharmacology, 280, 114440. 10.1016/j.jep.2021.114440 [DOI] [PubMed] [Google Scholar]
  37. Parekh P. A., Garcia T. X., Hofmann M. C. (2019). Regulation of GDNF expression in Sertoli cells. Reproduction, 157(3), R95–R107. 10.1530/REP-18-0239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Potter S. J., DeFalco T. (2017). Role of the testis interstitial compartment in spermatogonial stem cell function. Reproduction (Cambridge, England), 153(4), R151–R162. 10.1530/REP-16-0588 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Qi X., Zhang M., Sun M., Luo D., Guan Q., Yu C. (2022). Restoring impaired fertility through diet: Observations of switching from high-fat diet during puberty to normal diet in adulthood among obese male mice. Frontiers in Endocrinology, 13, 839034. 10.3389/fendo.2022.839034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Qin Z., Song J., Huang J., Jiang S., Zhang G., Huang M., Huang Z., Jin J. (2023). Mitigation of triptolide-induced testicular Sertoli cell damage by melatonin via regulating the crosstalk between SIRT1 and NRF2. Phytomedicine: International Journal of Phytotherapy and Phytopharmacology, 118, 154945. 10.1016/j.phymed.2023.154945 [DOI] [PubMed] [Google Scholar]
  41. Ramgir S. S., Renu K., Vellingiri B., George A., Tirupapuliyur D., Thiagarajan P., Valsala Gopalakrishnan A. (2022). Phytomedicinal therapeutics for male infertility: Critical insights and scientific updates. Journal of Natural Medicines, 76(3), 546–573. 10.1007/s11418-022-01619-0 [DOI] [PubMed] [Google Scholar]
  42. Sanou I., van Maaren J., Eliveld J., Lei Q., Meißner A., de Melker A. A., Hamer G., van Pelt A. M. M., Mulder C. L. (2022). Spermatogonial stem cell-based therapies: Taking preclinical research to the next level. Frontiers in Endocrinology, 13, 850219. 10.3389/fendo.2022.850219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Schaller J., Glander H. J., Dethloff J. (1993). Evidence of beta 1 integrins and fibronectin on spermatogenic cells in human testis. Human Reproduction, 8(11), 1873–1878. 10.1093/oxfordjournals.humrep.a137952 [DOI] [PubMed] [Google Scholar]
  44. Sharma M., Srivastava A., Fairfield H. E., Bergstrom D., Flynn W. F., Braun R. E. (2019). Identification of EOMES-expressing spermatogonial stem cells and their regulation by PLZF. eLife, 8, e43352. 10.7554/eLife.43352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Singla N., Kaur G., Babbar B. K., Sandhu B. S. (2013). Potential of triptolide in reproductive management of the house rat, Rattus rattus. Integrative Zoology, 8(3), 260–276. 10.1111/1749-4877.12013 [DOI] [PubMed] [Google Scholar]
  46. Siraliev-Perez E., Stariha J. T. B., Hoffmann R. M., Temple B. R. S., Zhang Q., Hajicek N., Jenkins M. L., Burke J. E., Sondek J. (2022). Dynamics of allosteric regulation of the phospholipase C-γ isozymes upon recruitment to membranes. eLife, 11, e77809. 10.7554/eLife.77809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Siu M. K., Cheng C. Y. (2008). Extracellular matrix and its role in spermatogenesis. Advances in Experimental Medicine and Biology, 636, 74–91. 10.1007/978-0-387-09597-4_5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Stenqvist A., Oleszczuk K., Leijonhufvud I., Giwercman A. (2018). Impact of antioxidant treatment on DNA fragmentation index: A double-blind placebo-controlled randomized trial. Andrology, 6(6), 811–816. 10.1111/andr.12547 [DOI] [PubMed] [Google Scholar]
  49. Takashima S., Kanatsu-Shinohara M., Tanaka T., Morimoto H., Inoue K., Ogonuki N., Jijiwa M., Takahashi M., Ogura A., Shinohara T. (2015). Functional differences between GDNF-dependent and FGF2-dependent mouse spermatogonial stem cell self-renewal. Stem Cell Reports, 4(3), 489–502. 10.1016/j.stemcr.2015.01.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wang F., Liu W., Jiang Q., Gong M., Chen R., Wu H., Han R., Chen Y., Han D. (2019). Lipopolysaccharide-induced testicular dysfunction and epididymitis in mice: A critical role of tumor necrosis factor alpha†. Biology of Reproduction, 100(3), 849–861. 10.1093/biolre/ioy235 [DOI] [PubMed] [Google Scholar]
  51. Wang F., Shao X., Bao B., Yang Y., Wang Y., Zhang J., Wang S., Chen Y., Han D. (2024). Cytotoxic and viricidal effects of human semen on mumps virus-infected lymphocytes: In vitro studies. Journal of Medical Virology, 96(6), e29733. 10.1002/jmv.29733 [DOI] [PubMed] [Google Scholar]
  52. Wang M., Guo Y., Wang M., Zhou T., Xue Y., Du G., Wei X., Wang J., Qi L., Zhang H., Li L., Ye L., Guo X., Wu X. (2017). The Glial Cell-Derived Neurotrophic Factor (GDNF)-responsive phosphoprotein landscape identifies raptor phosphorylation required for spermatogonial progenitor cell proliferation. Molecular & Cellular Proteomics: MCP, 16(6), 982–997. 10.1074/mcp.M116.065797 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wu D. L., Wang T. S., Liu H., Xu F., Xie S., Tong X., Li L., Peng D., Kong L. (2023). Wuzi-Yanzong-Wan prevents oligoasthenospermia due to TAp73 suppression by affecting cellular junction remodeling in testicular tissue in mice. Journal of Ethnopharmacology, 302(Pt. A), 115867. 10.1016/j.jep.2022.115867 [DOI] [PubMed] [Google Scholar]
  54. Wu D. L., Wang T. S., Zhang W., Wang J. S., Peng D. Y., Kong L. Y. (2021). NMR-based metabolomics approach to study the effects of Wu-Zi-Yan-Zong-Wan on triptolide-induced oligospermia in rats. Journal of Ethnopharmacology, 265, 113192. 10.1016/j.jep.2020.113192 [DOI] [PubMed] [Google Scholar]
  55. Yang Y. R., Choi J. H., Chang J. S., Kwon H. M., Jang H. J., Ryu S. H., Suh P. G. (2012). Diverse cellular and physiological roles of phospholipase C-γ1. Advances in Biological Regulation, 52(1), 138–151. 10.1016/j.advenzreg.2011.09.017 [DOI] [PubMed] [Google Scholar]
  56. Yong S., Yang Y., Li F., Yao H., Yang F., Chang D. (2020). Wuzi Yanzong Pill for the treatment of male infertility: A protocol for systematic review and meta-analysis of randomized controlled trials. Medicine, 99(33), e21769. 10.1097/MD.0000000000021769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zhang W., Xia S., Ou J., Cao M., Cheng G., Li Z., Wang J., Yang C. (2023). A single-cell landscape of triptolide-associated testicular toxicity in mice. Journal of Pharmaceutical Analysis, 13(8), 880–893. 10.1016/j.jpha.2023.04.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhang X., Peng Z., Zheng H., Zhang C., Lin H., Qin X. (2021). The Potential Protective Effect and Possible Mechanism of Peptides from Oyster (Crassostrea hongkongensis) Hydrolysate on Triptolide-Induced Testis Injury in Male Mice. Marine drugs, 19(10), 566. 10.3390/md19100566 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhao M. P., Shi X., Kong G. W. S., Wang C. C., Wu J. C. Y., Lin Z. X., Li T. C., Chan D. Y. L. (2018). The therapeutic effects of a traditional Chinese medicine formula Wuzi Yanzong pill for the treatment of oligoasthenozoospermia: A meta-analysis of randomized controlled trials. Evidence-Based Complementary and Alternative Medicine: eCAM, 2018, 2968025. 10.1155/2018/2968025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhou S. H., Deng Y. F., Weng Z. W., Weng H. W., Liu Z. D. (2019). Traditional Chinese medicine as a remedy for male infertility: A review. The World Journal of Men’s Health, 37(2), 175–185. 10.5534/wjmh.180069 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zini A., Al-Hathal N. (2011). Antioxidant therapy in male infertility: Fact or fiction? Asian Journal of Andrology, 13(3), 374–381. 10.1038/aja.2010.182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zou D., Meng X., Wang B., Dai Y., Yang R., Suo Y., Wu Y., Yang W., Lin R. (2019). Analysis of pharmacological mechanisms and targets mining of Wuzi-Yanzong-Wan for treating non-obstructive oligoasthenospermia. Biomedicine & Pharmacotherapy/Biomedecine & Pharmacotherapie, 115, 108898. 10.1016/j.biopha.2019.108898 [DOI] [PubMed] [Google Scholar]
  63. Zou D., Wang J., Zhang B., Xie S., Wang Q., Xu K., Lin R. (2015). Analysis of chemical constituents in Wuzi-Yanzong-Wan by UPLC-ESI-LTQ-Orbitrap-MS. Molecules (Basel, Switzerland), 20(12), 21373–21404. 10.3390/molecules201219765 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

sj-xlsx-1-jmh-10.1177_15579883251371990 – Supplemental material for Wu Zi Yan Zong Wan Improves Triptolide-Induced Testicular Spermatogenic Dysfunction Through the Spermatogenic Microenvironment and the PLCγ/PKC Pathway

Supplemental material, sj-xlsx-1-jmh-10.1177_15579883251371990 for Wu Zi Yan Zong Wan Improves Triptolide-Induced Testicular Spermatogenic Dysfunction Through the Spermatogenic Microenvironment and the PLCγ/PKC Pathway by Lei Zhang, Binghao Bao, Weizhen Wu, Haolang Wen, Suyan Tong, Xueyan Wang and Baoxing Liu in American Journal of Men's Health


Articles from American Journal of Men's Health are provided here courtesy of SAGE Publications

RESOURCES