New species and new records of genus Melampsora (Melampsoraceae) from Pakistan using electron microscopy and DNA barcoding techniques

Abstract

The genus Melampsora, known for its significant role as a plant pathogen, exhibits a rich species diversity. Current study reports Melampsora himalayensis sp. nov. as new species with M. ferrinii and M. populnea as new records from different regions (Fairy Meadows, Gilgit Baltistan; Khanspur, Khyber Pakhtunkhwa) of Pakistan, contributing to the knowledge of rust fungi diversity and distribution. Their placement within genus Melampsora was validated by comparative morpho-anatomical investigation. Detailed morphological characterization was employed using Scanning electron microscopy which provided features of spore morphology including their surface ornamentation. Additionally, molecular analysis was performed for species delimitation and to resolve phylogenetic relationships within genus Melampsora. Combined morpho-anatomical and phylogenetic data led to the discovery of previously unrecorded species, Melampsora ferrinii and M. populnea from Pakistan, including a novel taxon, Melampsora himalayensis sp. nov. This study provides information about taxonomy, host range and distribution of Melampsora in Pakistan.

Introduction

Rust fungi are biotrophic plant parasites and parasitize a wide range of host plants, including Ferns, Gymnosperms, Angiosperms, Lycopods etc. with narrow host preference. The host plants show symptoms like blisters, galls and needles. The pustules are mostly orange, yellow, brown, black, or white while rusty brown colored pustules can also be seen [1]. As obligate biotrophs, rust fungi can only feed, grow and reproduce on their living hosts and they differentiate specific infection structures “haustoria” [2].

Rust fungi are completely dependent on the nutrients provided by living plant hosts [3]. From Pakistan, 22 genera and about 355 species of rust fungi on various host plants are reported with only twelve (12) species of Melampsora viz. Melampsora caprearum (DC.) Thüm, M. chelidonii-pierotii Tak. Matsumoto, M. ciliata Barclay, M. dimorphospora S. Kaneko & Hirats. F., M. epitea Thüm, M. salicis-albae Kleb, M. populnea (Pers.) P. Karst, M. euphorbiae (Ficinus & C.Schub) Castagne, M. pakistanica B. Ali, Sohail and Mumtaz, M. laricis-populina Kleb, M. lini (Ehrenb.) Thüm, and M. yoshinagae Henn. from Pakistan [3, 4]. Only 20 species of rust fungi are documented from Pakistan on the basis of molecular phylogenetic analysis while rest of the species are reported only on morpho-anatomical basis that needs re-evaluation on molecular basis [5].

The genus Melampsora Castagne is an obligatory biotrophic plant parasite, similar to all other rust fungi [6]. It was first established by Castagne in 1843 based on the type species. Small yellow pustules (uredinia, carrying urediniospores) on the underside of the leaves, or both sides in case of severe infections, are the common symptoms of Melampsora species. These pustules occur on the leaves within two to three weeks [7]. This genus comprises both autoecious and heteroecious species.

Melampsora species have a broad range of host associations and can parasitize many host plant genera. About fifteen (15) species of Melampsora are reported on Salix L. and twenty (20) on Populus L. globally [8, 9] while five (05) species of Melampsora are reported on Salix plants and three (03) on Populus species from Pakistan [5].

In general, multiple Melampsora species can infect the same host plant and a single Melampsora species can infect multiple host plants, so it is difficult to identify Melampsora species on host plant associations alone. Morpho-anatomical and molecular examinations provide useful information about the identification of different Melampsora species. Scanning electron microscopy of spores gives additional information about surface ornamentation that may help in species delimitation [4].

The life cycle of Melampsora species is complex and involves five distinct spore stages, classifying it as macrocyclic and heteroecious—requiring two unrelated host plants to complete its development. The cycle begins in early spring when basidiospores, produced from overwintering teliospores, infect the alternate host, initiating the formation of spermogonia (pycnia). These spermogonia produce spermatia, which play a role in sexual reproduction. Following fertilization, aecia are formed on the alternate host and release aeciospores, which are dispersed by wind[1, 2, 4].

During mycological field surveys, infected plants of Willow family (Salicaceae) growing in Fairy Meadows, Gilgit Baltistan and Khanspur, Khyber Pakhtunkhwa, Pakistan were collected. Molecular phylogenetic and microscopic analyses of the fungi parasitizing Populus and Salix plants suggested that the causal agents of this disease are Melampsora species. From current study, M. ferrinii is recorded as a new record for Pakistan; M. populnea as new record for Fairy Meadows, Gilgit Baltistan and one (01) species of Melampsora forms a separate lineage from already known species. Based on this evidence, it is described as a new taxon with detailed description and photographs.

Past studies in Pakistan have predominantly relied on traditional morphology-based identification, with limited use of DNA barcoding or advanced imaging techniques. The lack of molecular data has hindered accurate species delimitation and understanding of their phylogenetic relationships. Additionally, previous studies have less integrated scanning electron microscopy (SEM) to investigate spore surface ornamentation—an essential micro-morphological trait for distinguishing closely related Melampsora species.

The current study aims to address these gaps by employing a combination of morpho-anatomical, scanning electron microscopy, and molecular phylogenetic analyses to identify and characterize Melampsora species infecting members of the Salicaceae family in high-altitude regions of northern Pakistan.

Materials and method

Sampling sites

During the field surveys, specimens infected with rust fungi were collected from Fairy meadows, District Diamer, Gilgit Baltistan; Khanspur, District Abbottabad, Khyber Pakhtunkhwa, Pakistan during 2020–2023 (Fig. 1). The climatic conditions and moisture provided the favorable environment for these fungal pathogens to grow.

Fig. 1.

Location map showing sampling site Fairy Meadows, Gilgit Baltistan; Khanspur, Khyber Pakhtunkhwa, Pakistan (By the software ArcGIS, version 10.3)

In Pakistan, Fairy Meadows (district Diamer, Gilgit Baltistan) is a natural alpine meadow at the base of Nanga Parbat, which, at 8126 m, is the 9 th highest mountain in the world and second in Pakistan after K2 in Pakistan [10]. The average annual temperature for Fairy Meadows is 16 °C. Diamer is one of the main forest hotspots in Gilgit Baltistan, having farmlands and pastures of Fairy Meadows, located at a latitude of 35°N and longitude of 74°E [11]. This region is situated towards the south side of the Karakoram Highway at a short distance of 15 km, and 443 km from the capital of Pakistan, Islamabad [12].

Khanspur is situated towards 34°N latitude and 74°E longitude having an area of 1684 hectares. Moist temperate type of forest range is present here having great diversity of plants and animals. The natural vegetation of this area is highly influenced by human activities [13].

Plant material collection and identification

Fungal samples of Melampsora species were collected from infected leaves of Salix babylonica L., S. tetrasperma Roxb., S. karelinii Turcz. ex Stschegl and Populus ciliata Wall. ex Royle in Khanspur, Khyber Pakhtunkhwa (GPS coordinates: 34.0214°N, 73.4247°E); Fairy Meadows, Gilgit Baltistan (GPS coordinates: 35.3873°N, 74.5785°E) Pakistan during 2020–2023. Geographical distribution of sampling sites is provided in Fig. 1.

The host plant species were formally identified by Prof. Dr. Abdul Nasir Khalid, Institute of Botany, Institute of Botany, University of the Punjab, Lahore, Pakistan and by comparison with specimens from the herbarium of the Institute of Botany, University of the Punjab, Lahore, Pakistan (LAH). Voucher specimens were deposited in the same Herbarium, under the codes LAH3832, LAH38328, LAH38270, LAH38271, LAH38330.

Permissions and ethical compliance

Sampling sites were not conserved sites.

Morphological studies

Infected plants after collection were brought in the Fungal Biology & Systematics Research Lab. These were dried in blotting papers, preserved in the paper envelopes and were deposited in the herbarium of the Institute of the Botany, University of the Punjab, Lahore, Pakistan (LAH38270, LAH38271, LAH38328, LAH38329, LAH38330). Microscopic features were examined using a stereomicroscope (EMZ-5 TR, Meiji Techno Co., Ltd., Japan). Free-hand sections and scratch mounts were prepared in 10% lactic acid and subsequently examined under a light microscope (Labo America Inc., USA). The measurements of about 30 spores for each stage were taken by Scope Image 9.0 (X5), image-processing software (Bioimager, Maple, Ontario, Canada). SEM photographs were taken at the Central Resource Laboratory (CLR), Department of Physics, University of Peshawar, Pakistan. Host plants were identified by comparison with specimens from the herbarium of the Institute of Botany, University of the Punjab, Lahore, Pakistan (LAH). Newly illustrated specimens were also deposited in the same Herbarium.

Molecular studies

Genomic DNA was extracted directly from excised sori using a modified 2% CTAB method [14]. Extracted DNA was used for PCR amplification of the LSU nrDNA marker using primers pair i.e. Rust28SF (TTTTAAGACCTCAAATCAGGTG) as a forward primer [15] and reverse primer LR5 (ATCCTGAGGGAAACTTC) [16]. The amplified DNA fragments (PCR products) were visualized with the help of a 1% agarose gel using ethidium bromide through gel documentation system [17]. The amplified products were then sequenced commercially.

Phylogenetic study

Sequencing chromatograms of both forward and reverse primer reads were compared in BioEdit version 7.2.5. [18] for consensus sequence formation. Edited sequences were then subjected to BLAST search for homologous sequences of Melampsora at NCBI Genbank database. Sequences similar to our newly generated sequences were downloaded from Genbank (Table 1). Further, published sequences of Liu et al. (2020) were also retrieved. The final dataset of LSU was aligned using online MUSCLE version 3.8 [19]. After alignment, manual editing was done using BioEdit version 7.2.5. [18]. Phylogenetic analysis was performed in the MEGA 11 portal. Maximum likelihood phylogram was constructed using the Kimura model. Rapid bootstrap analysis was performed with 1000 replicates. The LSU dataset consists of 482 characters, of which, 403 are conserved, 73 variables, 47 Parsimony informative, and 26 Singleton sites. Bootstrap values above 60 were sited on the nodes.

Table 1.

Sequence details of species used to construct the phylogeny of Melampsora species reported in the current study

Fungus	Host	Plant Accession No. (LSU)	Voucher No	Locality	Reference
Chrysomyxa weirii	Picea omorika	KY798397.1	BPI 910315	USA	Unpublished
Chrysomyxa weirii	Picea glauca	JF802512.1	CFB 22195	Germany	[20]
Melampsora abietis-canadensis	–––	FJ666512.1	666X-TSC-SH11	Canada	Unpublished
Melampsora abietis-canadensis	––––-	FJ666513	667X-TSC-SH12	Canada	Unpublished
Melampsora populnea	Populus alba	PQ453824	LAH3832	Pakistan	Current study
Melampsora populnea	––––	FJ666510.1	664ME-POA-BC45	Canada	[21]
Melampsora euphorbiae	Euphorbia macroclada	DQ437504.1	BPI 863501	USA	[22]
Melampsora euphorbiae	Euphorbia heterophylla	DQ351722.1	BPI 871135	USA	[16]
Melampsora euphorbiae	Euphorbia peplus	EF192199.1	BRIP 39560	Australia	[22]
Melampsora euphorbiae	–-	AF522172.1	ECS48	USA	[16]
Melampsora ferrinii	Salix babylonica	KJ136562.1	PUR N6743	USA	[23]
Melampsora ferrinii	Salix babylonica	KJ136565.1	PUR N6741	USA	[16]
Melampsora ferrinii	Salix sp	KY053853.1	SAG 21943	Chile	[24]
Melampsora ferrinii	Salix babylonica	PQ453823	LAH38328	Pakistan	Current study
Melampsora himalayensis	Salix tetrasperma	PQ166689	LAH38270	Pakistan	Current study
Melampsora himalayensis	Salix tetrasperma	PQ166688	LAH38271	Pakistan	Current study
Melampsora himalayensis	Salix karelinii	PQ453819	LAH38330	Pakistan	Current study
Melampsora idesiae	Idesia polycarpa	KX944285.1	KUS-F29304	Korea	[25]
Melampsora idesiae	Idesia polycarpa	KX944283.1	KUS-F24940	Korea	[25]
Melampsora laricis-epitea	Salix viminalis	KY617852.1	GE14_2_4	Slovenia	Unpublished
Melampsora laricis-epitea	Salix sp	KY617851.1	GE14_2_6	Slovenia	Unpublished
Melampsora laricis-epitea	Salix sericea	KF170142.1	SAL-NY-0005	New York	[26]
Melampsora laricis-populina	Populus nigra	JQ042251.1	U-99	USA	[27]
Melampsora laricis-populina	Populus x Canadensis	JQ042250.1	sn36	USA	[27]
Melampsora occidentalis	Populus balsamifera	JQ042237.1	U-395	USA	[27]
Melampsora occidentalis	Populus trichocarpa	JQ042236.1	U-1218	USA	[27]
Melampsora pakistanica	Euphorbia helioscopia	KX237556.1	BA13c	Pakistan	[4]
Melampsora pakistanica	Euphorbia helioscopia	KU847978.1	QAU BA13	Pakistan	[4]
Melampsora ricini	Ricinus communis	KJ716352.1	PDD 98363	New Zealand	[28]

Results

Taxonomy

Melampsora ferrinii Toome & Aime, Pl. Path. 64(1): 221 (2014).

Spermogonia, aecia and telia not found. Uredinia scattered over the surface, hypophyllous, yellow, rounded, scattered. Urediniospores rounded or obovoid to ellipsoid, globose to sub-globose, hyaline, pale yellow, 11‒21 × 16‒32 µm. Wall 1.4‒2.9 µm thick at sides, 1.6‒2.7 µm thick apically, ornamentation echinulate with pointed spines. Paraphyses capitate, 13‒20 × 27‒86 μm, evenly thickened or slightly thickened at apex, apex 1.8‒3.4 μm thick. Pedicel broken (Fig. 2).

Fig. 2.

The Morphology of Melampsora ferrinii on Salix babylonica (HP-07) A Infected leaves of host plant B Infection under stereomicroscope C Capitate paraphysis with a urediniospore D–E Urediniospores showing different shapes and echinulate ornamentation

Material Examined: On the leaves of Salix babylonica L. (Salicaceae), with II stage, PAKISTAN, Khyber Pakhtunkhwa, Khanspur, 2,250 m. a. s. l., September 17, 2020, Mohammad Aijaz Ahmad and Najam-ul-Sehar Afshan, HP‒07, LAH38328, GenBank Accession No. PQ453823.

Notes

The urediniospores of Melampsora ferrinii are globose to ellipsoid having echinulated ornamentation with sharp spines (Fig. 2). Comparative morphology with specimens of M. ferrinii on Salix babylonica from Iran showed morphological similarity between these specimens. The sequence of the Pakistani specimen (HP–07), nested with the same taxon from USA (KJ136562; KJ136565) and China (KY053853) indicates that they belong to the same species. M. ferrinii differs from closely related (Fig. 3) species (M. idesiae) having small sized urediniospores. Paraphyses are mostly capitate in M. ferrinii while M. idesiae has clavate shaped paraphyses. M. ferrinii is widely distributed in Australia, China, Iran, Japan and USA [25].

Fig. 3.

Phylogenetic analysis of LSU sequences of genus Melampsora. Maximum likelihood phylogram was constructed in MEGA 11. Bootstrap support values above 60% are shown above the nodes. Newly amplified sequences are highlighted. The LSU region of Chrysomyxa weirii was used as an outgroup

Melampsora himalayensis Afshan, Ahmad, Jabeen & Khalid sp. nov.

MycoBank: MB857369.

Etymology: The specific epithet, himalayensis refers to the locality Himalayan forests, Pakistan.

Diagnostic characters

Spermogonia, aecia and telia not found. Uredinia hypophyllous, scattered in the form of groups on leaf surfaces, 0.2 to 0.4 mm in diameter, yellow to orange. Urediniospores ellipsoid or ovoid to obovoid, rounded or pear-shaped, 22–41 × 18–27 µm; Spore wall hyaline, echinulated with finely pointed spines, 3.39–4.73 µm thick at sides; Paraphyses elongated, apically capitate, lollypop shaped, hyaline, pedicellate, 24–40 × 17–20 µm (Figure 4a, b).

Fig. 4.

(a): Morphology of Melampsora himalayensis sp. nov. A Infected leaves of Salix tetrasperma B Infection under stereomicroscope C Different shapes of urediniospores D Paraphyses along with urediniospores. (b): A‒B. SEM Photographs of uredinia containing urediniospores and paraphyses C. SEM Photograph of urediniospores and paraphyses D. Urediniospores showing echinulate wall ornamentation

Holotype

On leaves of Salix tetrasperma Roxb. (Salicaceae), stage II, Pakistan, Gilgit Baltistan, Fairy Meadows, elevation 3,300 m. a. s. l, August 05, 2023, Najam ul Sehar Afshan, Muhammada Jabeen, FM–20, LAH38270, GenBank accession no. PQ166689.

Additional material examined

On leaves of Salix tetrasperma Roxb. (Salicaceae), stage II, Pakistan, Gilgit Baltistan, Fairy Meadows, elevation 3,300 m. a. s. l, August 27, 2022, Najam ul Sehar Afshan, Muhammada Jabeen MF–16, LAH38271, GenBank accession no. PP166688; On leaves of Salix karelinii Turcz. ex Stschegl., (Salicaceae) Khyber Pakhtunkhwa, Abbottabad, Khanspur, elevation 2, 250 m. a. s. l, September 18, 2020. Najam ul Sehar Afshan, Aijaz Ahmad, KVR-22, LAH38330, GenBank accession no. PQ453819.

Morphological comparison of Melampsora species reported on Salix and Populus [5, 8, 29–31].

Species name	Host plant	uredinia	Urediniospores	Paraphysis
M. abietis –caprearum	Salix alba	hypophyllous	13–20 × 12–16 µm, wall 1.5 µm thick	1.5–3 µm thick
M. abietis-populi	Populus koreana, P. simonii. P. nigra	Hypophyllous	Ellipsoid, oblong, or pyriform, 21–35 µm, 15- 20 µm	Thickened at apex, 10 µm
M. alliifragilis	Salix alba; S. sp	mainly hypophyllous	22–33 × 13–15 µm, wall smooth at apex up to 3 µm thick	2–5 µm thick
M. alli-populina	Populus nigra, P. trichocarpa	Hypophyllous, rarely epiphyllous	24–38 × 11–18 µm, 2–4 µm wall thickness Oblong or clavoid	Capitate, thin stalks, 50–60 µm × 14–22 µm
M. amygdalinae	Salix excels	hypophyllous	19–32 × 11–15 µm, wall smooth at apex 1.5 µm thick;	3–5 µm thick
M. caprearum	Salix cinerea	hypophyllous, 1–2 mm, up to 5 mm on young leaves	14–21 × 13–15 µm, wall evenly echinulate, 2–2.5 µm thick	5–6 µm thick at apex
M. coleosporioides	Salix babylonica	mainly hypophyllous	18–27 × 13–19 µm, wall 1.5–2 µm thick	uniformly thickened
M. cf. dimorphospora	Salix alba	mainly hypophyllous	19–30 × 15–25 µm, of two kinds with evenly echinulate or verrucose wall, wall thickness 2.5–3 µm	wall 3–4 µm
M. epitea	Salix aegyptiaca; S. purpurea;	amphigenous, 0.5–1.5 mm	12–25 × 10–18 µm, wall 1.5–3 µm thick	wall up to 3 µm
M. euonymicapraearum	Salix carmanica	hypophyllous	18–23 × 14–19 µm, wall evenly echinulate, up to 5 µm thick	wall up to 8 µm thick at the apex
M. iranica	Salix elbursensis; S. sp.	mainly hypophyllous and on stems	17–25 × 15–20 µm, wall evenly echinulate, up to 3 µm thick	wall up to 5 µm thick
M. laricis-epitea	Salix sp.	amphigenous, up to 1.5 mm	12–25 × 9–19 µm, wall evenly echinulate up to 3 µm thick	thick-walled (8–10 µm)
M. larici-populina	Populus nigra, P. laurifolia, P. trichocarpa	Mostly, hypophyllous, upto 1 mm	Ellipsoid, echinulated, 30–40 × 13–17 µm	Capitate to clavate, 40–70 × 14–18 µm
M. ferrinii	Salix babylonica	hypophyllous, 0.1 to 0.3 mm	15–32 × 10–21 µm, wall 1.5–3 µm thick	wall up to 3.5 µm uniformly thick
M. medusa	Populus maximowiczii	Hypophyllous, pulverulent	Ellipsoid, obovate to ellipsoid, 26–35 × 16–23 µm	5–6.5 µm thickened
M. magnusiana	Populus sieboldii	Hypophyllous	Obovoid, ellipsoid, 17–26 × 12–19 µm	Thickened at apex
M. populnea	Populus alba, P. tremula	Hypophyllous, pulvinate, Pulverulent, 0.5 mm	Ellipsoid to obovoid, 11–25 µm × 11–18 µm	40–60 µm × 8–23 µm, clavoid to capitate
M. salicis –albae	Salix alba; S.babylonica; S. excelsa; S.purpurea; S. triandra; S. sp.	mainly hypophyllous and on young twigs, up to 5 mm long on young shoots	20–36 × 11–17 µm, wall smooth at apex, 2 µm thick	wall thickness even, 2–3 µm
M. salicis –acmophyllae	Salix acmophylla	hypophyllous	18–24 × 16–20 µm, wall evenly echinulate, 3–5 µm thick	wall 7–9 µm thick at apex
M. ribesii –viminalis	Salix sp.	mainly hypophyllous, c. 0.2–0.3 mm	15–19 × 14–16 µm, wall evenly echinulate, 2 µm thick	wall thickness mainly even, 1–2 µm
M. ribesii –epitea	Salix aegyptiaca	hypophyllous, 0.5–1 mm	16–20 × 14–18 µm, wall evenly echinulate, 3–3.5 µm thick	wall 2.5–4 µm thick
M. repentis	Salix alba	mainly hypophyllous	13–17 × 12–14 µm, wall evenly echinulate, 1.5 µm thick	wall 3–5 µm thick

Notes

Previously, five species of Melampsora i.e. M. caprearum (DC.) Thüm., M. chelidonii-pierotii Tak. Matsumoto, M. dimorphospora S. Kaneko & Hirats., M. epitea Thüm., M. salicis-albae Kleb. have been reported from Pakistan on different Salix species [5]. Our newly described taxon is different from all these species on the bases of micro-morphological characteristics. M. himalayensis has larger urediniospores as compared to all previously reported taxa.

M. himalayensis is distinct morphologically from other phylogenetically close relative M. idesiae Miyabe. Uredinia of M. himalayensis are wider (Fig. 4b) as compared to M. idesiae Miyabe. Urediniospores of M. himalayensis are ellipsoid or ovoid to obovoid, rounded or pear-shaped, larger (22–41 × 18–27 µm), while M. idesiae has sub-globose to ellipsoid, but somewhat irregular and variable in shape, yellow to orange, echinulated, and smaller (18–22 × 15–22 μm) urediniospores. Paraphyses of M. himalayensis (Fig. 4a) are elongated, apically capitate, hyaline, 24–40 × 17–20 µm, while paraphyses of M. idesiae are hyaline, smooth, clavate, and 17–25 μm [25]. These morphologically distinguishing characters and phylogenetically different position makes M. himalayensis distinct from other species of Melampsora.

M. himalayensis is distinct morphologically from another phylogenetically close relative by having larger urediniospores (22–41 × 18–27 µm) while M. laricis-epitea has smaller (15.0–22.6 × 13.3–18.5 µm) urediniospores. The uredinia of M. himalayensis are smaller in diam. as compared to M. laricis-epitea uredinia. Paraphyses of M. himalayensis are elongated, apically capitate, hyaline, 24–40 × 17–20 µm, while paraphyses of M. laricis-epitea are 33.8‒72.8 µm long, with a head diameter of 13.0‒23.4 µm [32]. Hence, this species seems previously undescribed and new to science.

According to the combined consensus of both phylogenetic (Fig. 3) and morphological studies, it is evident that M. himalayensis collected on Salix is a distinct taxon.

Melampsora populnea (Pers.) P. Karst., Bidr. Känn. Finl. Nat. Folk 31: 53 (1878).

Spermogonia, aecia and telia not found. Uredinia hypophyllous, scattered, irregular, golden yellow in dry state. Urediniospores rounded, globose to subglobose, hyaline or light yellow, 18‒24 × 22‒29 µm. Wall 2.2‒4.3 µm thick at sides, 2.9‒4.7 µm thick apically, ornamentation echinulate. Germ pores 1‒3 in number, scattered. Pedicel broken. Paraphyses present, hyaline, 3‒5 × 25‒35 µm long (Fig. 5a, b).

Fig. 5.

(a): Morphology of Melampsora populnea on Populus alba A. Infected leaf of Populus alba B. Infection under stereomicroscope C. Urediniospores with paraphyses D. Echinulated urediniospores showing different shapes E-F. Paraphyses. (b): The SEM photographs of urediniospores of Melampsora populnea showing echinulate surface ornamentation

Material Examined: On leaves of Populus alba L. (Salicaceae), with II stage, PAKISTAN, Khyber Pakhtunkhwa, District Abbottabad, Khanspur, 2,250 m. a. s. l., 20 Oct. 2020, Mohammad Aijaz Ahmad and Abdul Rehman Khan Niazi, GB-20, LAH38329, GenBank Accession No PQ453824.

Notes

Comparison of morphological features of the rust (Fig. 5a, b) on Populus alba from Pakistan with M. populnea [33] confirmed the identity of Pakistani rust on Poplar plant as M. populnea. Phylogenetic analyses (Fig. 3) showed that our specimen (M. populnea) is placed in the clade of M. populnea including sequences reported from Canada (FJ666510). Morphologically, M. populnea differs from closely related (Fig. 3) species by having small sized urediniospores and different host range [33]. M. populnea is widely distributed in Asia, Canada, and UK [33]. In previous studies, Melampsora populnea was reported in Pakistan based solely on morphological characteristics [5]. In this study, we provide a comprehensive identification of M. populnea by integrating both morphological observations and molecular analyses, thereby enhancing the reliability of its identification.

Discussion

This study documents three species of Melampsora—M. himalayensis, M. populnea, and M. ferrinii—based on detailed morpho-anatomical characters and phylogenetic analyses. Among these, M. himalayensis is described here as a new species, while the other two are newly recorded for the rust fungi flora of Pakistan. The use of both compound microscopy and scanning electron microscopy (SEM) allowed for more precise characterization of spore ornamentation and paraphyses, which are important for distinguishing morphologically similar taxa.

The urediniospores of Melampsora ferrinii observed in this study are globose to ellipsoid with echinulated ornamentation and sharp spines (Fig. 2), consistent with descriptions from Iran on Salix babylonica. Our morphological comparison confirmed that the Pakistani material closely resembles those Iranian specimens. Phylogenetically, the sequence of the Pakistani specimen (HP–07) clusters with taxon reported from the USA (KJ136562, KJ136565) and China (KY053853), confirming its identity as M. ferrinii. The species is morphologically distinct from its close relative M. idesiae based on smaller urediniospore size and paraphyses shape. While M. idesiae has clavate paraphyses, M. ferrinii has predominantly capitate ones. The presence of M. ferrinii in Pakistan extends its known distribution from Australia, China, Iran, Japan, and the USA to South Asia, supporting its widespread adaptability and host range within the Salix genus.

The newly described M. himalayensis differs significantly from all previously known Melampsora species. Morphologically, it is characterized by larger urediniospores (22–41 × 18–27 µm) and broader uredinia (Fig. 4b). Its paraphyses are also larger, elongated, and apically capitate (24–40 × 17–20 µm). Comparatively, its closest phylogenetic relatives are M. idesiae and M. laricis-epitea, but it is clearly distinguishable from both: M. idesiae has smaller, more irregular urediniospores and clavate paraphyses, while M. laricis-epitea has smaller urediniospores and larger-headed paraphyses. These differences are supported by both morphological traits and a distinct position in the ITS phylogenetic tree (Fig. 3), confirming M. himalayensis as a novel taxon.

The use of SEM was especially critical in differentiating M. himalayensis from its relatives, as it allowed us to analyze spore ornamentation patterns with greater precision than compound microscopy. This level of detail is essential for distinguishing closely related rust species.

Ecologically, the collection of M. himalayensis from Fairy Meadows (Gilgit-Baltistan) and Khanspur (Khyber Pakhtunkhwa) suggests that high-altitude, temperate habitats with native Salix populations may serve as hotspot of rust fungal diversity. These areas are climatically and geographically distinct, suitable for rust fungi evolution. The isolation of M. himalayensis in such habitats highlights the importance of surveying underexplored ecological zones for fungal diversity.

Globally, the discovery of M. himalayensis contributes to the understanding of rust fungi evolution and distribution in Asia. It also highlights the need for taxonomic reassessment of Melampsora species in regions where rust fungi remain poorly studied. This finding also reinforces the importance of combining molecular data with detailed morphological observations to resolve species boundaries within the genus.

Morphological and molecular comparisons confirmed the identity of rust found on Populus alba in Pakistan as Melampsora populnea. The urediniospores are small and consistent with previously described specimens from Canada and Europe (FJ666510), and phylogenetic analysis placed our specimen within the same clade. M. populnea differs from its close relatives by its smaller spore size and a specific host association with Populus species. Its known distribution across Asia, Canada, and the UK, now extended to Pakistan, indicates that it may have a broader host range or dispersal potential than previously thought.

The occurrence of M. populnea on Populus alba also holds significance for plant health, as this rust is known to reduce the aesthetic and physiological quality of poplar species used in forestry and landscaping. Early detection and proper identification are crucial for managing potential outbreaks, especially in regions where poplars are planted for commercial purposes. Earlier reports identified Melampsora populnea in Pakistan based solely on morphological characteristics[5]. In this study, we enhance the reliability of its identification by integrating both morphological observations and molecular analyses.

Conclusion and future directions

In conclusion, this study identified Melampsora himalayensis as a new species and reported M. ferrinii and M. populnea as new records for the rust fungi flora of Pakistan through comprehensive morpho–anatomical and molecular phylogenetic analyses (Table 1). These findings not only highlighted the taxonomic and biogeographical distribution of the genus Melampsora but also emphasize the significance of rust fungi. The discovery of M. himalayensis contributes to the global diversity of rust fungi, while the documentation of M. ferrinii and M. populnea expands their known geographical distribution.

This research not only enhances our knowledge of rust fungi but also underscores the importance of regional studies in broadening the scope of fungal biodiversity. The integration of traditional morphological techniques with molecular phylogenetics helps in accurate identification of rust fungi in underexplored regions of Pakistan. This work has implications for plant disease management, as the presence of these rust fungi may affect the health and productivity of native and cultivated Populus species. Understanding their distribution can help in monitoring potential outbreaks and to carry out conservation strategies for both wild and economically important host plants.

Future research should address expanding fungal diversity surveys to other understudied regions of Pakistan. Conducting pathogenicity tests is essential to evaluate the impact of these Melampsora species on host plants. Moreover, exploring the genetic diversity within Melampsora genus using next-generation sequencing (NGS) technologies could help understanding their evolutionary relationships, adaptation strategies, and potential resistance mechanisms. Such multidisciplinary approaches are crucial for advancing our knowledge of rust fungi and their ecological and agricultural relevance.

Authors’ contributions

Najam-ul-Sehar Afshan : Corresponding author, preparation of manuscript, validation, field tours, supervision of research work. Mohammad Aijaz Ahmad, Sadia Binyameen: Collection of data, microscopy. Muhammada Jabeen: Corresponding author, methodology, microscopy, writing origional draft, field tours, phylogeny. Abdul Nasir Khalid: Collection, conceptualization, identification of infected plants and fungus.

Funding

Not applicable.

Data availability

Samples analyzed during this study have been deposited in the LAH Herbarium, University of the Punjab, Lahore under voucher numbers LAH38270, LAH38271, LAH38328, LAH38329, and LAH38330. The DNA sequences generated during this study have been deposited in the NCBI GenBank data repository (https://www.ncbi.nlm.nih.gov/genbank/) under GenBank accession numbers for LSU: PQ453823, PQ166689, PQ166688, PQ453819, and PQ453824. The new taxon described in this study has been registered in MycoBank (https://www.mycobank.org/) under the accession number MB857369.

Declarations

Ethics approval and consent to participate

Not applicable. This study did not involve human participants, animals, or vertebrate specimens requiring ethical approval.

Consent for publication

Not applicable. This manuscript does not contain any identifiable personal data.

Competing interests

The authors declare no competing interests.