Two hymenopteran parasitoid species of the jackfruit borer Diaphania caesalis (Lepidoptera: Pyralidae) in China

Abstract

Jackfruit borer, Diaphania caesalis (Walker), is a major boring pest of Artocarpus plants (Moraceae). Biological control is considered an environmentally sustainable means of managing pests. However, parasitoids of D. caesalis in China are unknown. Here, we investigated the parasitoids of D. caesalis through field monitoring and surveys and identified them through morphological observation and DNA barcoding technology. Two hymenopteran parasitoid species, Dolichogenidea sp. and Eulophidae undet. sp., were identified on D. caesalis. The parasitism rate of Dolichogenidea sp. (21.0 ± 1.8%) was significantly higher than that of Eulophidae undet. sp. (3.8 ± 2.2%). The field incidence of Dolichogenidea sp. in the Artocarpus integer and Artocarpus heterophyllus orchards was 30.8 ± 2.5% and 22.3 ± 7.6%, respectively, but there was no significant difference. Overall, Dolichogenidea sp. was the dominant parasitoid of D. caesalis in China. Further research is needed to determine the species’ identity, and their biological characteristics should be evaluated to determine their potential applications in biocontrol programs.

Introduction

Cempedak (Artocarpus integer [Thunb.] Merr.) and jackfruit (Artocarpus heterophyllus Lam.) (Moraceae) are monoecious plants that belong to the Moraceae family (Fathoni et al. 2023, Liu et al. 2025, Suwardi et al. 2025). They are tropical evergreen trees native to South and South East Asia that have been identified in multiple countries, including India, Indonesia, Thailand, Mauritius, Myanmar, the Philippines, Vietnam, Bangladesh, Malaysia, Brazil, and China, and gradually cultivated commercially (Kallekkattil et al. 2019a, Lathiff et al. 2021, Lin et al. 2022). In China, they are the most widely planted species of the genus Artocarpus.

The jackfruit borer, Diaphania caesalis (Walker) (Lepidoptera: Pyralidae), is a major boring insect distributed in subtropical and tropical areas (Wang et al. 2020). This pest infests cempedak, jackfruit, and other species of the genus Artocarpus, including terap (A. elasticus), chapalis (A. chaplasha), and breadfruit (A. communis and A. altilis) (Kallekkattil et al. 2019b). Its larvae are hidden inside tender shoots, floral buds, and fruit, where they feed, which leads to deformation and dropping of immature fruit and rot in mature fruit, rendering the fruit commercially worthless (Wang et al. 2020). In severe cases, production can be reduced by more than 50% (Du et al. 2020). This pest widely occurs in Guangdong Province, China, where jackfruit and cempedak are grown commercially in relatively large areas for their tropical fruit.

Biological control is considered one of the most environmentally sustainable means of managing pests (van Lenteren et al. 2018, Kumaraswamy et al. 2024, Cingolani et al. 2025). Parasitoid insects commonly have a host search efficiency and host specificity, with many species being specialists that target only one or a few closely related host species (Gonthier et al. 2024). These traits make them suitable for targeted pest management (Zikic et al. 2024). To date, numerous hymenopteran species have been used as commercial biological control agents, such as Tamarixia radiata (targeting psyllids), Trichogramma spp. and Glyptapanteles harrisinae (against lepidopteran pests), and Peristenus relictus (for hemipteran pests) (van Lenteren et al. 2018, Zikic et al. 2024, Pickett et al. 2024). Therefore, biological control using parasitoids represents an effective strategy for pest management. In India (Karnataka, Kerala, and Tamilnadu), 13 primary parasitoid species of D. caesalis have been recorded thus far: Apanteles stantoni (Hymenoptera: Braconidae), which is the most abundant species; Apanteles expulsus; Phanerotoma hendecasisella; Bracon sp. (Hymenoptera: Braconidae); Goniozus sensorius (Hymenoptera: Bethylidae); Brachymeria margaroniae (Hymenoptera: Chalcididae); Eurytoma punctifronta (Hymenoptera: Eurytomidae); Figitid (Unidentified) (Hymenoptera: Figitidae); Ichnuemonid (Unidentified) (Hymenoptera: Ichnuemonidae); Elasmus indicus; Elasmus brevicornis; Nesolynx phaeosoma; and Eulophid (Unidentified) (Hymenoptera: Eulophidae) (Kallekkattil et al. 2019a). Kumaraswamy et al. (2024) reviewed parasitoids as biocontrol agents in India. However, their review contains no documented records of large-scale releases or commercial applications of these parasitoids against D. caesalis. Similarly, available information on the parasitoid complex associated with D. caesalis in China is also limited. It is necessary to understand the morphology and field incidence of parasitoids to use them in biological control and develop sustainable management of pests. Hence, the present study aimed to provide information on the parasitoid complex of D. caesalis in China through field monitoring and surveys. This study provides a detailed description of the external morphology of parasitoids, combined with ecological and morphological feature pictures. We also provide molecular and field incidence information. The results will help to identify and assess the potential of parasitoid wasp species for the biological control of D. caesalis in China.

Materials and Methods

Sample Origin and Rearing

Diaphania  caesalis larvae were collected from cempedak (Artocarpus integer (Thunb.) Merr.) in Leizhou city (109°54′31.219″E, 20°34′50.531″N) (Site 1) and from jackfruit (Artocarpus heterophyllus Lam.) at the Guangdong Ocean University Practice Base (110°18’32.612”E, 21°9’13.284”N) in Zhanjiang city (Site 2), Guangdong Province, China, in June 2024 to identify and assess parasitoid incidence. Two sampling rounds were conducted at Site 1. In the first round, approximately 40 larvae were collected for parasitoid species identification and randomly divided into 4 groups (10 larvae each) for indoor parasitism rate quantification. The second round, targeting field parasitism rates by dominant parasitoids, yielded 50 larvae. Cumulative larval count at this site reached approximately 90 individuals. At Site 2, approximately 30 larvae were collected in a single sampling event for assessing field parasitism rates. The collection site and host plant information are shown in Table 1. No parasitism of adult D. caesalis individuals was observed during the investigation. The collected larvae still fed on the young leaves of the original host plants, and they were then reared under constant laboratory conditions (26 ± 1 °C, RH 70% to 80%, 14:10 L:D photoperiod) for experimental use. The collected larvae that showed parasitism by natural enemies were fed together with their parasitoids. Emerging parasitoid adults were collected, preserved in 95% ethanol, and then stored at −20 °C, partly for morphological observation and partly for molecular identification. The number and sex of parasitoids emerging from each larva were also recorded.

Table 1.

Details of the collection sites and host plant samples

Site	Locations	Coordinates (N, E)	Host plant	Purpose
1	Leizhou city, Guangdong Province, China	109°54′31.219″E 20°34′50.531″N	Cempedak (Artocarpus integer)	Identifying and assessing the incidence of parasitoids
2	Zhanjiang city, Guangdong Province, China	110°18′32.612″E 21°9′13.284″N	Cempedak (A. integer) Jackfruit (A. heterophyllus)	Assessing the incidence of parasitoids

Identification of Parasitoids

The total genomic DNA of individual parasitoids was extracted using a blood/cell/tissue genome DNA extraction kit (TIANGEN, Beijing, China), following the manufacturer’s instructions. PCRs were performed in a 50 μl volume containing 2 μl of the template DNA lysate, 2.5 μl of each primer (10 μm), and 25 μl of 2× SuperTaq PCR mix (GenStar, Beijing, China). The specific primers and cycling conditions are shown in Table 2. After the PCR, amplified products (5 μl) were electrophoresed and visualized on a 1% agarose gel containing Gold-View colorant. When bands of the expected size were visible on the gels, the remaining 30 μl volume of PCR products was sent for two-way sequencing (Tianyi Huiyuan Gene Technology Co., Ltd, Guangzhou, China). The obtained sequences were spliced for BLAST comparison in the National Center for Biotechnology Information database (https://www.ncbi.nlm.nih.gov). The sequences of parasitoids in this study have been deposited in the NCBI database (Accession Nos. PV466807 to PV466809, PV468780 to PV468782, PV590861 to PV590863, PV590866 to PV590868). The phylogenetic trees of parasitoids were constructed by combining the sequences of parasitoids from this study with other recorded parasitoids belonging to different groups. IQ-TREE version 1.6.12-Linux (http://www.iqtree.org) was used to construct a phylogenetic tree of parasitoids using the maximum likelihood method. The bootstrap replicates were set to 1000 times. Diaphania caesalis larvae that were parasitized and the cocoons and adults of the parasitoids were observed and photographed under a microscope (Leica DM750, Wetzlar, Germany).

Table 2.

Specific primers and PCR procedures

Gene	Prime sequences (5ʹ–3ʹ) and PCR procedure	Fragment size (bp)	References
COI	LCO1490: GGTCAACAAATCATAAAGATATTGG HCO2198: TAAACTTCAGGGTGACCAAAAAATCA Predenaturation at 94 °C for 5 min, 5 cycles of 94 °C for 1 min, 45 °C for 1.5 min, and 72 °C for 1.5 min, followed by 30 cycles of 94 °C for 1 min, 54 °C for 1.5 min, and 72 °C for 1 min, and final extension for 5 min at 72 °C.	600	Folmer et al. 1994, Aman-Zuki et al. 2019
18S rDNA	18S-H17F: AAATTACCCACTCCCGGCA 18S-H35R: TGGTGAGGTTTCCCGTGTT Predenaturation at 94 °C for 3 min, followed by 34 cycles of 94 °C for 30 s, 58 °C for 45 s, and 72 °C for 1 min, and final extension for 8 min at 72 °C.	750	Heraty et al. 2004
28S rDNA	D2-3551F: CGTGTTGCTTGATAGTGCAGC D2-4068R: TTGGTCCGTGTTTCAAGACGGG Predenaturation at 94 °C for 5 min, followed by 34 cycles of 94 °C for 30 s, 51 °C for 30 s, and 72 °C for 1 min, and final extension for 10 min at 72 °C.	600	Gillespie et al. 2005, Ward and Downie 2005

Incidence of Natural Enemies in the Field

The parasitoid with the highest parasitism rate (calculated as: parasitism rate (%) = (number of parasitized moth larvae per group/10) × 100) in the laboratory was selected to assess the incidence of parasitoids in the field using random surveys at the survey locations in June 2024, as described in section “sample origin and rearing.” Each survey site was randomly divided into 4 regions, with each region containing ≥ 25 host plants. From each region, 10 trees were randomly selected for sampling. For each tree, 10 tender shoots were randomly sampled from each cardinal direction (east, south, west, and north), and all selected shoots along with their surrounding leaves were inspected for D. caesalis larvae presence and evidence of parasitism by dominant parasitoid species. Larval counts and parasitism data from all 10 trees per region were pooled to calculate field incidence using the formula: field incidence (%) = (number of parasitized moth larvae per region/total number of moth larvae collected per region) × 100. All surveys were completed within a single day for each region.

Data Analysis

Parasitism rates and field incidence were analyzed using an independent-samples t-test, at a significance level of α = 0.05. The analyses and tests were performed using SPSS 21. GraphPad Prism 9.0 was used to generate the figures.

Results

Morphological Characteristics and Phylogenetic Analysis of Parasitoids

Of the collected D. caesalis larvae, multiple larvae were parasitized during rearing in the laboratory. Through morphologi­cal observation and DNA barcode analysis, the parasitic wasps were classified as 1 of 2 species (Figs. 1 and 2). The morphological characteristics of the 2 parasitoids were summarized in Table 3.

Fig. 1.

Dolichogenidea sp. A), B) parasitoids with a white cocoon on the host Diaphania caesalis. C), D) Female. (C) Dorsal habitus; the arrow shows the ovipositor; inset is enlargement of the antennae base. D) Lateral habitus; the arrows show the ovipositor and ovipositor sheath; inset is an enlargement of the ovipositor and ovipositor sheath. E), F) Male. E) Ventral habitus. F) Lateral habitus; the arrow shows the copulatory organs; inset is enlargement of the copulatory organs. O: Ovipositor. OS: Ovipositor sheath. G) Phylogenetic analysis based on CO1 sequences.

Fig. 2.

Eulophidae undet. sp. A), B) parasitoids on the host Diaphania caesalis; inset is an enlargement of the parasitoid larvae. C) Pupa. D) to F) Adults. D) Dorsal habitus; inset is an enlargement of the eyes and scape of the antennae. E) Ventral habitus. F) Lateral habitus. G) Phylogenetic analysis based on CO1 sequences.

Table 3.

Comparative morphology of 2 parasitoid species

Items	Parasitoid species
	Dolichogenidea sp.	Eulophidae undet. sp.
Pupa	With white cocoon	Naked
Body length	3.2 mm	2.5 mm
Adult coloration	Black	Blackish green with a metallic luster
Antennaes	Length subequal to or slightly exceeding body length, general coloration black with scape distinctly light brown	Much shorter than body length, with scape elongate and yellowish-white
Wings	Hyaline, fore wing with pterostigma	Hyaline, no pterostigma
Legs	Light brown to dark reddish brown, with black infuscation	Yellowish-white
Abdomen	Uniformly black, showing no trace of maculation or banding patterns, with elongate ovipositor	Dorsal side with a subtrapezoidal honey-yellow macula, ventral side almost entirely honey-yellow, no obvious exposed ovipositor

One parasitoid species left the host at the late larva stage to pupate and formed a white cocoon, with approximately 20 pupae per host (Fig. 1A and B). The body length of the adult was approximately 3.2 mm (based on the examined specimen), and the antennae were 1.1 times as long as the body (Fig. 1A). The head, antennae (except scape), thorax, and abdomen were black, and the wings were hyaline. The forewing with pterostigma was relatively thick and duck brown, and the scape of the antennae and fore and mid legs were mostly light brown. The hind femur telos was light brown, and the base had black infuscation. The tibia base was light brown, and the telos was reddish brown. Tarsi were dark reddish brown (Fig. 1C to F). The ovipositor was evenly curved downward, and the ovipositor sheaths were slightly longer than the metatibia (Fig. 1C and D). Some females had no obvious ovipositor sheath. We observed the ovipositors of 9 groups of parasitoids (cocoons on one host as one group), in which the females without an ovipositor sheath accounted for 36.3 ± 1.8% (mean ± SE) of all females, and the female rate was 79.1 ± 1.7% (mean ± SE). The males’ antennae were slightly longer than the females’ antennae, and the copulatory organs of some male individuals were clearly exposed (Fig. 1E and F). The 3 CO1 sequences found in this study (GenBank Accession Nos. PV466807 to PV466809) matched Dolichogenidea stantoni (Hymenoptera: Braconidae) (GenBank Accession Nos. PQ530501 and PQ530502), with 98.81% similarity. Twenty-one CO1 sequences were selected from the NCBI database as reference sequences to construct a phylogenetic tree. Phylogenetic analysis showed that the parasitoid with the cocoon in this study was closely related to Dolichogenidea stantoni (Fig. 1G). The 28S sequences found in this study (GenBank Accession Nos. PV468780 to PV468782) matched Dolichogenidea sp. (GenBank Accession No. MK568809), with 98.89% similarity. Phylogenetic analysis showed that the parasitoid was also closely related to Dolichogenidea sp. (Supplementary Fig. S1). We compared our specimens with the images of the reported specimens of Dolichogenidea stantoni (PQ530501 and PQ530502) (Chen et al. 2024) and found that they were similar. The 18S sequences found in this study (GenBank Accession Nos. PV590869 to PV590871) matched Cotesia glomerata (GenBank Accession No. XR006509351), with 97.28% similarity, but the morphological characteristics of the parasitoids with the cocoon in this study were significantly different from Cotesia glomerata. Based on the morphological characteristics and the CO1 and 28S sequences, we identified this parasitoid as Dolichogenidea sp.

The other parasitoid species is shown in Fig. 2. The larvae were hymenopteriform and lacked tubercles or spines. The dark brown, mature larvae of the parasitoids gathered on the surface of the host, with approximately 10 larvae on each host (Fig. 2A and B), and did not spin a cocoon for pupation but instead were naked and presented a mummified appearance (appendages were held against its body) (Fig. 2C). The parasitoid adult was blackish green with a metallic luster, approximately 2.5 mm long, with reddish eyes and ocelli, hyaline wings, a scape on the antennae, and mostly yellowish-white legs (Fig. 2D to F). The central portion near the front of the dorsal side of the adult abdomen was honey yellow and nearly trapezoidal (Fig. 2D). The ventral side of the adult abdomen, the base, and the end were also honey yellow (Fig. 2E). The 3 CO1 sequences found in this study (GenBank Accession Nos. PV590861 to PV590863) matched Eulophidae undet. sp. (GenBank Accession No. KR926978), with 90.34% similarity. Eighteen CO1 sequences were selected from the NCBI database as reference sequences to construct a phylogenetic tree. Phylogenetic analysis based on the CO1 sequences (3 sequences obtained in this study and 18 sequences selected from the NCBI database) showed that the parasitoid clustered with species of the Eulophidae family (Fig. 2G). We also obtained 3 18S rRNA gene sequences (GenBank Accession Nos. PV590866 to PV590868) that matched Elasmus polistis (Hymenoptera: Eulophidae) (GenBank Accession No. JN623182) and Eulophidae undet. sp. (GenBank Accession No. JN623183), with 99.87% similarity. Phylogenetic analysis showed that the parasitoid was also closely related to Eulophidae (Supplementary Fig. S2). We compared our specimens with the images of the reported specimens of Elasmus polistis (Jacques et al. 2022), and their forms were obviously different. The 28S sequence of this parasitoid was not successfully obtained in this study; thus, based on the CO1 and 18S sequences, we identified this parasitoid as Eulophidae undet. sp.

Parasitism Rates of Different Parasitoids

On the same host plants and in the same area, the parasitism rate of Dolichogenidea sp. was 21 ± 1.8%, which was significantly higher than the parasitism rate of Eulophidae undet. sp. (3.8 ± 2.2%) (t = 6.1, df = 6, P = 0.001) (Fig. 3A).

Fig. 3.

Parasitism rates of Dolichogenidea sp. and Eulophidae undet. sp. A). Field incidence of Dolichogenidea sp. in the Artocarpus integer and A. heterophyllus orchards B). **, statistically significant based on the t test at α  =  0.05. Bars are the mean ± SE (n = 4).

Field Incidence of Dominant Parasitoids on Different Host Plants

The field incidence of Dolichogenidea sp. in the Artocarpus integer and Artocarpus heterophyllus orchards was 30.8 ± 2.5% and 22.3 ± 7.6%, respectively, but there was no significant difference (t = 1.1, df = 6, P = 0.33) (Fig. 3B).

Discussion

Our survey uncovered 2 hymenopteran parasitoids, Dolichogenidea sp. (Braconidae: Microgastrinae) and Eulophidae undet. sp., associated with D. caesalis in China. Dolichogenidea sp. was the dominant parasitoid, and the field incidence was 22% to 31%; the female-biased sex ratio was 79%, indicating that these parasitoids could be biocontrol agents for pest management.

Parasitoid wasps have diverged into solitary and gregarious parasitoids based on the number of larvae developing within a single host (Zikic et al. 2024). These 2 parasitoids of D. caesalis identified in this study were all gregarious parasitoids; approximately 10 to 20 hymenopteran larvae developed concurrently within/on each host, sharing its resources. Many gregarious parasitoids have been recorded in the subfamily Microgastrinae and family Eulophidae (Yefremova and Lubin 2020, Zikic et al. 2024).

Among Braconidae subfamilies, Microgastrinae contains an extraordinarily rich diversity of parasitoid wasps that parasitize larval lepidopterans (Fagan-Jeffries et al. 2018, Morrison et al. 2025, Slater-Baker et al. 2025). Dolichogenidea, belonging to Microgastrinae, is a cosmopolitan genus with approximately 200 described species (Ahmad et al. 2020). Morphological feature recognition combined with DNA barcoding technology has been widely applied in classification and species identification (Aman-Zuki et al. 2019, van Klink et al. 2022, Höcherl et al. 2024, Vilarino et al. 2025). The CO1 sequences of Dolichogenidea sp. found in this study matched D. stantoni reported by Chen et al. (2024), with 98.81% similarity. Liu et al. (2019) recorded D. stantoni as a new species in China. Although the morphology of Dolichogenidea sp. uncovered in this study was similar to that of D. stantoni recorded by Liu et al. (2019) and Chen et al. (2024), there were some obvious differences. For example, the color of the scape of the antennae was light brown in this study and obviously lighter than that of other parts of the antennae, which was not obviously exhibited in the records by Liu et al. (2019) and Chen et al. (2024). Kallekkattil et al. (2019a) reported that Apanteles stantoni was the most dominant parasitoid of the jackfruit borer D. caesalis in India, but lack of molecular data precludes direct comparison. The morphology of A. stantoni was more similar to that of D. stantoni recorded by Liu et al. (2019) and Chen et al. (2024) than to the morphology of the parasitoid recorded in this study. Dolichogenidea was initially described as a subgenus of Apanteles Foerster (Viereck 1911) but was then raised to the genus level by Mason (1981) (Fagan-Jeffries et al. 2018). We speculated that A. stantoni reported by Kallekkattil et al. (2019a) and D. stantoni recorded by Liu et al. (2019) and Chen et al. (2024) might be the same species. The 28S sequences of Dolichogenidea sp. found in this study also matched Dolichogenidea sp. (GenBank Accession No. MK568809), with 98.89% similarity, but no 28S sequence information was provided by Chen et al. (2024) for D. stantoni. The species name for Dolichogenidea sp. recorded in this study needs to be determined using more precise type specimen comparisons and further molecular information. The 18S sequences of Dolichogenidea sp. found in this study matched Cotesia glomerata, with 97.28% similarity, but their morphological characteristics were obviously different, indicating that the 18S sequence may not be suitable for species identification of Dolichogenidea or Microgastrinae.

Previous studies have found that many species of Dolichogenidea parasitize lepidopteran pests, such as D. cordia on Acrocercops lysibathra, D. syngremma on Eteoryctis syngramma, D. gelechiidivoris on Tuta absoluta, Dolichogenidea sp. on Lamprosema indicate, D. persica on Leucoma wiltshirei, and D. stantoni on the melon borer Diaphania indica and Herpetogramma submarginale, some of which are considered promising biocontrol agents against pests due to their high parasitism rates (27% to 48.9%) and/or gregarious reproduction ability (ten to a few hundred individuals in a brood) (Wu and Jiang 2011, Ahmad et al. 2020, Krache et al. 2021, Abdoli et al. 2023, Chen et al. 2024, Gonthier et al. 2024, Syropoulou et al. 2025). Offspring emerging from the same host are generally referred to as broods (Zikic et al. 2024). In this study, Dolichogenidea sp. was the dominant parasitoid of D. caesalis in China. The field incidences were 22% to 31%, and there were no significant differences in the incidence rates between jackfruit and cempedak orchards. Sustained parasitism rates > 20% are widely cited as a benchmark for biological control efficacy, particularly when targeting Lepidoptera with moderate reproductive rates (Singh 2023). Gregariousness in the subfamily Microgastrinae is uniquely a result of polyembryony, in which multiple individuals develop from a single egg (Zikic et al. 2024). There were approximately 20 offspring of Dolichogenidea sp. per D. caesalis larva, and the average female rate was 79.07% in a brood. In biological control, maintaining a high female ratio is crucial for enhancing the efficacy of parasitoids. Empirical evidence suggests that when the proportion of females exceeds 60%, the population exhibits significantly enhanced parasitism rates, thereby improving pest suppression (Yang et al. 2010, Bari et al. 2015). In this study, Dolichogenidea sp. also had a high parasitism rate, gregarious reproduction ability, and female rate and could be used as a promising candidate for the biological control of D. caesalis. However, this study only documented the field occurrence rate of Dolichogenidea sp. during a specific period. The seasonal and interannual variation in occurrence rates still requires further investigation through long-term monitoring. Furthermore, augmentative biological control involves the mass release of parasitoids to manage pest populations. These releases can provide rapid pest suppression in crops with short production cycles or sustained control across multiple pest generations in long-cycle crops (van Lenteren et al. 2018). Therefore, future studies should investigate the biological characteristics of Dolichogenidea sp. and develop efficient mass-rearing techniques to fully exploit its potential for biological control applications.

Another parasitoid wasp of the jackfruit borer D. caesalis uncovered in this study was Eulophidae undet. sp. (based on CO1 and 18S rDNA sequences), which was a minor parasitoid on D. caesalis with a low parasitism rate (3.75%, on average). Kallekkattil et al. (2019a) reported that Elasmis brevicornis (Hymenoptera: Eulophidae) is also a minor parasitoid on D. caesalis. The adult morphological characteristics of these species are obviously different. An ideal molecular barcode should possess sufficient variation among the sequences to discriminate species (Xu et al. 2022), and the combined use of COI and other genes was recommended for DNA barcoding-based species identification (Dong et al. 2018). The 18S sequences of Eulophidae undet. sp. uncovered in this study matched Elasmus polistis (Hymenoptera: Eulophidae), with 99.87% similarity, but their adult morphological characteristics were also obviously different. This indicates 18S rDNA may not be suitable for distinguishing certain hymenopteran parasitoids. The 28S rDNA sequence of this parasitoid was not successfully obtained in this study. In subsequent work, it would be advisable to modify the primer sets and optimize amplification conditions to successfully obtain the sequence. Eulophidae is a hyper-diverse family of chalcidoid wasps (Rasplus et al. 2020). The Eulophidae undet. sp. described in this study exhibit morphological similarities to Entedoninae species in both coloration and body shape but differs from them (Hansson and Shevtsova 2010, Rasplus et al. 2020, Gumovsky 2023, Schoeninger et al. 2024, Li et al. 2024). Based on these characteristics, we speculated that Eulophidae undet. sp. described in this study belongs to the subfamily Entedoninae. The sex of Eulophidae undet. sp. specimens shown in Fig. 2 could not be definitively determined. Based on morphological character diagrams of Entedoninae species provided by Li et al. (2024), the Eulophidae undet. sp. specimens in this study were likely female individuals. Additional morphological and molecular characterization is required to confirm the identity of Eulophidae undet. sp.

Overall, our study provides evidence of the parasitism rate, morphology, and molecular information for 2 parasitoids, Dolichogenidea sp. and Eulophidae undet. sp., of jackfruit borer D. caesalis in China. Dolichogenidea sp. was the dominant parasitoid and could be used as a promising candidate for the biological control of D. caesalis. Further research is needed to determine the species’ identity, and the biological characteristics are also required to explore the application of this parasitoid in biocontrol programs.

Author Contributions

Pei-Qiong Shi (Conceptualization [equal], Data curation [equal], Writing—original draft [equal], Writing—review & editing [equal]), Le Feng (Data curation [equal], Investigation [equal], Methodology [equal]), Ke-Cong Huang (Data curation [equal], Investigation [equal]), Jia-Cheng Hu (Data curation [equal], Methodology [equal]), Feng Feng (Funding acquisition [equal], Writing—review & editing [equal]), and Jin Xu (Conceptualization [equal], Funding acquisition [equal], Writing—original draft [equal], Writing—review & editing [equal])

Supplementary Material

Supplementary material is available at Journal of Insect Science online.

Funding

This work was supported by the program for scientific research start-up funds of Guangdong Ocean University (R19029), program of Guangdong Science and Technology Department (A24403), Yunnan Province Science and Technology Talents and Platform Plan (grant NO. 202305AF150146), and Feng Feng Expert Workstation in Yunnan Province, Jackfruit Germplasm Resource Nursery of Guangdong province (Guangdong Ocean University), and Jackfruit Science and Technology Backyard in Yunnan's Hekou.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to in- fluence the work reported in this paper. No conflict of interest exists in the submission of this manuscript, and the manuscript is approved by all authors for publication.