The $\alpha$2$\delta$1 subunit of the voltage-gated calcium channel acts as a potential candidate for breast cancer tumor initial cells biomarker

Abstract

BACKGROUND:

The voltage-gated calcium channel subunit alpha 2 delta 1 ($\alpha$2$\delta$1) is a functional tumor initial cells (TICs) marker for some solid cancer cells. This study aimed to investigate whether $\alpha$2$\delta$1 can be used as a potential TIC marker for breast cancer cells.

METHODS:

$\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ cells were identified and sorted from the breast cancer cell lines MDA-MB-231, MDA-MB-435s and ZR-75-1 by Immunofluorescence (IF) and Fluorescent-activated cell sorting (FACS) analyses. Spheroid formation in vitro and tumorigenesis in NOD/SCID mice were assessed to determine the self-renewal and serial transplantation abilities of these cells. Using a lentivirus infection system for $\alpha$2$\delta$1 in breast cancer cell lines, we determined the mRNA levels of stemnessassociated genes by quality real-time PCR (qRT-PCR). Boyden chamber and wounding assays were further performed to detect the migration of $\alpha$2$\delta$1 overexpression cells. Bioinformatics explored the relationship of molecular classification of breast cancer and drug resistance.

RESULTS:

$\alpha$2$\delta$1 presents on the cytomembrane of breast cancer cells, with a positive rate of 1.5–3%. The $\alpha$2$\delta$1${}^{+}$ cells in breast cancer cell lines have a stronger self-renewal ability and tumor initiating properties in vitro and in vivo. Overexpressing $\alpha$2$\delta$1 successfully enhanced the sphere-forming efficiency, and upregulated the expression of stemness-associated genes, and increased cell migration. However, seldom significant was available between estrogen receptor +/- (ER+/-), progesterone receptor (PR+/-), and Her2+/-.

CONCLUSIONS:

Breast cancer cells positive for the $\alpha$2$\delta$1 charactered tumor initiation, and $\alpha$2$\delta$1 is a potential TIC marker for breast cancer that further promotes the migration.

1. Introduction

Breast cancer is one of the deadliest malignant tumors in women worldwide. This disease is the leading cause of cancer-related mortality in postmenopausal women. The poor prognosis for breast cancer patients is mainly due to recurrence and metastasis, which can be as high as 40% after comprehensive treatment and result in more than 17 million new cases every year [1]. Many studies have indicated that a few subsets of breast cancer cells are related to the origin and differentiation of tumors, which is the main reason for tumor recurrence and metastasis and is relevant to the chemotherapy resistance of breast cancer cells [2]. These cells were defined as tumor initiating cells (TICs), cancer stem cells (CSCs), or tumor propagating cells and maintained stemness associated properties including self-renewal, differentiation and tumorigenesis [3].

CD44 was first shown to be a TIC marker for breast cancer cells and aldehyde dehydrogenase l (ALDH 1)positive subpopulations isolated from a breast cell line and progenitor cells were also identified in patients over the past decade [4, 5]. In a recent report, protein C receptor (PROCR) could be used as a TIC biomarker to stratify triple-negative breast cancer into clinically relevant subgroups [6]. With these markers, TICs were sorted from the mixed cells which included TICs and non-TICs. In addition, these cells exhibit stem cell-like properties, such as increased tumorigenic potential and increased expression of stemness genes.

We previously discovered that $\alpha$2$\delta$1 is a subunit of the voltage-gated calcium channel, which can regulate the intracellular calcium concentration by activating calcium reflux through L and N-type voltage-gated calcium channels. $\alpha$2$\delta$1 positive ($\alpha$2$\delta$1${}^{+}$) cells isolated from hepatoma carcinoma cells exhibited TIC properties based on spheroid formation, differentiation and tumorigenesis experiments. In addition, $\alpha$2$\delta$1${}^{+}$ cells are related to self-renewal, differentiation, invasion and metastasis. 1B50-1, a monoclonal antibody against $\alpha$2$\delta$1, specific for isoform 5, had a therapeutic effect on HCC engraftments by eliminating $\alpha$2$\delta$1${}^{+}$ hepatoma TICs, but little affected heart, bone marrow and skeletal muscle tissues [7, 8]. Because blocking the bioactivity of $\alpha$2$\delta$1 decreases in the amplitude of [Ca${}^{2+}$]i oscillations, that resulted in changes in gene expression of calcium signaling pathway. Some stem associated pathways such as MAPK, Wnt and Notch pathway depended on or involved in the cell calcium signaling [9, 10, 11] . However, the expression of $\alpha$2$\delta$1 in breast cancer has not been investigated. In this study, we found that $\alpha$2$\delta$1 could be a promising potential surface marker for breast cancer TICs and validated the $\alpha$2$\delta$1 expression in the breast cancer cell lines ZR-75-1, MDA-MB231 and MDA-MB-435s. Our research indicated that $\alpha$2$\delta$1${}^{+}$ cells in breast cancer cells acted as tumor progenitors involved in self-renewal tumor formation and cell migration. This molecule could be a novel potential biomarker for TICs in breast cancer and provides a basis for further analysis of the initial features of cancer.

2. Materials and methods

2.1. Cell culture and plasmid

The human breast cancer cell lines ZR-75-1, MDA-MB-435s, and MDA-MB-231 were purchased from American Type Culture Collection, and identified by DNA fingerprinting of short tandem repeat (STR). All cells were cultured in RPMI-1640 or DMEM (Invitrogen, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; cat.no.10099-141; Invitrogen; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Invitrogen) at 37${}^{\circ }$C in a humidified incubator under an atmosphere of 95% air plus 5% CO${}_2$. Full length of $\alpha$2$\delta$1 sequences was cloned into Plenti6-Blast vector, and established $\alpha$2$\delta$1-overexpressing ($\alpha$2$\delta$1/OE) cell lines as previous reported [8].

2.2. Sequencing and bioinformation analysis

Total RNAs extracted from Petri dish cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) were sequenced by the Illumina Hiseq $\times$10 platform to obtain raw reads. Filtered clean reads had equality distributed base composition and mass. The upregulated differentially expressed genes were clustered by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis (DAVID; http://david.ncifcrf.gov/). The protein-protein interaction network of upregulated differentially expressed genes were constructed using the Search Tool for the Retrieval of Interacting Genes database (https://string-db.org/). High relational proteins were analyzed and illustrated with biological pathway using FunRich software version 3. The Cancer Genome Atlas (TCGA) dataset from the LinkedOmics website (ID: 72639) was used to analyze mRNA level of CACNA2D1 that are correlated with clinical profiles of patients with breast cancer, whose molecular classification were divided into different groups as luminal A, luminal B, HER-2, basal and normal breast like. Furthermore, we downloaded GEO data from multiple GEO profiles (GDS:3224; 2827; 4069; 360; 806 and 4083) to analyze estrogen receptor +/- (ER+/-), progesterone receptor +/- (PR+/-), Triple-negative breast cancer (TNBC) and drug resistance.

2.3. Antibody labeling and flow cytometry analysis

Mouse antibody 1B50-1 was conjugated with Lightning-Link Fluorescein kit (Innova Biosciences Ltd., Cambridge, UK) according to the protocol of the manufacturers. The fluorescein conjugated $\alpha$2$\delta$1 antibody was titrated into liquid which concentration was 7.5 $\mu$g/mL. Cells were trypsinized, washed, collected and co-incubated with FITC labeling Mab 1B50-1 at 4${}^{\circ }$C for 30 min. Having been filtered through a 50-$\mu$m nylon mesh, the viable and single cells were gated for analyses on a flow cytometer (Becton Dickinson, San Jose, CA, USA). Expression of these proteins was then measured by flow cytometer software.

2.4. Self-renewal

100 single cells per well were counted and plated into 96-well ultra-low attachment plate (Corning Incorporated Life Sciences, Acton, MA) and harvested in serum-free DMEM/F12 medium (Invitrogen), supplemented with B27 (1:50), 20 ng/ml epidermal growth factor, 20 ng/ml basic fibroblast growth factor (Peprotech, Rocky Hill, NJ) and 1% methylcellulose (Sigma-Aldrich), incubating at 37${}^{\circ }$C and in 5% CO${}_2$ for 2–3 weeks. The spheres over 100 $\mu$m in diameter were measured by a stereomicroscope (Olympus Corporation, Tokyo, Japan).

2.5. Real-time PCR

Total RNA was extracted with RNeasy Mini Kit (QIAGEN) and reverse transcribed to cDNA with M-MLV transcriptase (Invitrogen). qRT-PCR was performed with the SYBR Green PCR Master Mix (Toyobo Co. Ltd., Osaka, Japan) on ABI 7500-Fast real-time PCR system (Applied Biosystems, Waltham, MA, USA). Relative expression was calculated as 2${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{Ct}}$, followed by the primer sequences: CACNA2D1-F: ACAGCAAGTGGAGTCAATCA; CACNA2D1-R: AC TGCTGCGTGCTGATAAGA; NANOG-F: TGCCTC ACACGGAGACTGTC; NANOG-R: TGCTATTCTTC GGCCAGTTG; OCT4-F: GACAACAATGAAAATCT TCAGGAGA; OCT4-R: CTGGCGCCGGTTACAGA ACCA; MDR1-F: GCCTGGCAGCTGGAAGACAAA TAC; MDR1-R: ATGGCCAAAATCACAAGGGTT AGC; ABCG2-F: GGAGGCCTTGGGATACTTTGAA; ABCG2-R: GAGCTATAGAGGCCTGGGGATTAC; GAPDH-F: GACCCCTTCATTGACCTCAAC; GAP DH-R: CTTCTCCATGGTGGTGAAGA.

2.6. Wound healing assay

Growing cells in culturing were scratched in the 60 mm dishes to disrupt the cellular growth, and creating a break in the cells that simulates an injury. Growth of the cell culture was monitored until it is clear that the cells are healthily dividing and spreading across the dish. 24 hours later, the cells in culture fill the gap and close the wound. The width of gap from one side to the other side was measured by photo imaging. The process of creating a wound healing assay takes with a series of photographs to document the movement of cell behaviors.

2.7. Boyden chamber assay

The invasive capability of cells was determined by using a Boyden chamber with 8-$\mu$m pore (BD Biosciences). Briefly, a single-cell suspension (200 $\mu$L) containing 1 $\times$ 10${}^5$ cells was added to the inner chamber with FBS-free medium after the addition of 500 $\mu$L of complete culture medium to the bottom chamber. After placing in 37${}^{\circ }$C CO${}_2$ incubator for 24 h, removed the membranes and scraped off the cells in chamber. Invaded cells that adhered on the lower surface of the membrane were fixed with methanol and stained with 1% toluidine blue in 1% borax. Migration capability was determined by counting the number of cells through inverted a stereomicroscope.

2.8. Tumorigenicity assay in NOD/SCID mice

FACS-purified cells or $\alpha$2$\delta$1/OE cells were suspended into 200 $\mu$L which was 1:1 mix of RPMI 1640 or DMEN and Matrigel (BD Biosciences, Bedford, MA, USA), then transplanted s.c. into the 4- to 6-week-old NOD/SCID mice (Vitalriver, Beijing, China). Tumor formation was monitored weekly. All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals with protocols approved by the Animal Care and Use Committee at Peking University Cancer Hospital.

2.9. Statistics

GraphPad Prism was used to analyze the data. The unpaired two-sided Student’s t-test was performed to evaluate the significance between groups. One-way ANOVA followed by Dunn’s test procedure was applied for multiple comparisons. 0.05 was considered to be statistically significant. Data are represented as the mean and SD if not otherwise indicated. Representative data from at least three biologically independent experiments with similar results are presented. Tumorigenic cell frequency was calculated based on extreme limiting dilution analysis using the webtool at http://bioinf.wehi.edu.au/software/elda/ [12]. $p⩽$ 0.05 was considered statistically significant.

3. Results

3.1. $\alpha$2$\delta$1 is expressed on the membranes of breast cancer cells

To determine whether $\alpha$2$\delta$1 acts as a potential biomarker for TICs in breast cancer cells, we first performed an immunofluorescence assay to validate the expression of $\alpha$2$\delta$1 on the surface of the cell membranes of the ZR-75-1, MDA-MB-231 and MDA-MB-435s cell lines (Fig. 1A). Using FACS analyzing, the percentage of $\alpha$2$\delta$1${}^{+}$ cells ranged from 1.52% to 2.79% in different cell lines, a small subset of the total cells (Fig. 1B). We further cultured the sorted cells in Petri dishes for 2 weeks, and the proportion of $\alpha$2$\delta$1${}^{+}$ cells decreased from 92.4% to 3.25%, which returned to the percentage of $\alpha$2$\delta$1${}^{+}$ cells in the parental cells (Fig. 1C). These results suggested that $\alpha$2$\delta$1${}^{+}$ cells are a subpopulation of cells in breast cancer cell lines, and the $\alpha$2$\delta$1${}^{+}$ cells have the ability to differentiate $\alpha$2$\delta$1${}^{+}$ cells and $\alpha$2$\delta$1${}^{-}$ cells.

Figure 1.

$\alpha$2$\delta$1${}^{+}$ Breast cancer cells showing tumorigenesis and differeces. A. Immunofluorescence staining for 1B50-1 detecting the expression of $\alpha$2$\delta$1 in breast cancer cell lines. $\alpha$2$\delta$1${}^{+}$ cells show green fluorescence by FITC labeling (bar $=$ 20 $\mu$m). B. Flow cytometric sorting of the $\alpha$2$\delta$1${}^{+}$ cells in the breast cancer cell lines ZR-75-1, MDA-MB-231 and MDA-MB-435s incubated with FITC fluorescencelabeled 1B50-1 antibody. The $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ breast cancer cells were sorted. C. Flow cytometric results showing the percentage of $\alpha$2$\delta$1${}^{+}$cells in the control cells, the FACS-purified $\alpha$2$\delta$1${}^{+}$ cells and the $\alpha$2$\delta$1${}^{+}$ cells cultured in 10% serum-containing medium for 2 weeks (cultured).

3.2. $\alpha$2$\delta$1${}^{+}$ cells have a high tumorigenic capacity among breast cancer cells

To test whether $\alpha$2$\delta$1 affects the capacity of sphere formation in vitro, we cultured a subset of the $\alpha$2$\delta$1${}^{+}$ cells of ZR-75-1, MDA-MB-231 and MDA-MB-435s obtained from FCS sorting in conditioned medium to test self-renewal. The spheres of the $\alpha$2$\delta$1${}^{+}$ cells grew faster and larger than those of the $\alpha$2$\delta$1${}^{-}$ cells (Fig. 2A). The sphere forming efficiency (SFE) of the $\alpha$2$\delta$1${}^{+}$ cells were 24.4%, 25.4% and 21.4% compared with that of the $\alpha$2$\delta$1${}^{-}$ cells which was 8.3%, 9.3% and 4.3% respectively. Furthermore, we expanded the $\alpha$2$\delta$1${}^{+}$ cells to form spheres again, and further experiments were carried out with subsequent serial propagations. The SFEs of the $\alpha$2$\delta$1${}^{+}$ cells were 41.2%, 40.5% and 32.8% with significant differences (Fig. 2B). A tumorigenesis assay was performed by subcutaneous injection of the cells into NOD/SCID mice with cell limiting dilutions. As shown in Fig. 2C, the purified $\alpha$2$\delta$1${}^{+}$ cells and $\alpha$2$\delta$1${}^{-}$ cells were injected into the NOD/SCID mice on the right and left sides, respectively. We observed that as few as 100 $\alpha$2$\delta$1${}^{+}$ cells could form tumors in 5 NOD/SCID mice, while the $\alpha$2$\delta$1${}^{-}$ cells seldom formed tumors, except for a few tiny nodules. The frequency of tumorigenic cells was significantly different between the $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ breast cancer cells (Table 1). Then, 1000 and 100 cells of the $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ breast cancer cells sorted from the $\alpha$2$\delta$1${}^{+}$ cells formations were injected into secondary NOD/SCID mice, and the results suggested that the tumor-initiating ability after serial transplantation of the $\alpha$2$\delta$1${}^{+}$ cells was consistent with a strong tumorigenic ability (Fig. 2D, Table 1). In addition, knockdown $\alpha$2$\delta$1 on $\alpha$2$\delta$1${}^{+}$ sorting cells was used to test the sphere formation influence on stemness. The spheres were specifically inhibited by as much as 21%–37% when MDA-MB-435s $\alpha$2$\delta$1${}^{+}$ cells were treated with shRNAs of $\alpha$2$\delta$1 (Fig. 2E). These results showed that the tumorigenic capacity of the $\alpha$2$\delta$1${}^{+}$ breast cancer cells was significantly higher than that of the $\alpha$2$\delta$1${}^{-}$ cells both in vitro and in vivo.

Figure 2.

The self-renewal property of the $\alpha$2$\delta$1${}^{+}$ breast cancer cells was stronger in vitro and in vivo. A. Representative phase contrast micrographs show the spheres formed by the sorted $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ breast cancer cells (bar $=$ 100 $\mu$m). B. Spheroid forming efficiency (SFE) of the FACS-sorted $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ fractions. The ability of the spheres formed by the $\alpha$2$\delta$1${}^{+}$ cells to form secondary spheroids is also shown ($\alpha$2$\delta$1${}^{+\text{2nd}}$). * One-way ANOVA test. C. Representative photograph showing 1${}^{\text{st}}$ tumor formation in NOD/SCID mice injected s.c. with 1000 and 1,00 sorted $\alpha$2$\delta$1${}^{+}$ (right side) and $\alpha$2$\delta$1${}^{-}$ (left side) of breast cancer cells. Tumors were dissected at termination to analyze the tumor-initiating ability of the $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ breast cancer cells by counting the tumor numbers. D. The 2${}^{\text{nd}}$ tumorigenicity in NOD/SCID mice sourcing form the 1${}^{\text{st}}$ tumors was presented. E. Representative phase contrast micrographs show the spheres formed by $\alpha$2$\delta$1 shRNAs silencing on the sorted $\alpha$2$\delta$1${}^{+}$ MDA-MB-435s (bar $=$ 100 $\mu$m).

Table 1.

limiting dilution analysis for tumor formation between $\alpha$2$\delta$1+ and $\alpha$2$\delta$1 cells in breast cancer cell lines

Groups	1${}^{\text{st}}$				2${}^{\text{nd}}$
	Tumor formation		Frequency of	$p$	Tumor formation		Frequency of	$p$
	1000	100	tumorigenic cell (95%)	value	1000	100	tumorigenic cell (95%)	value
MDA-MB-231${}^{\text{a2d1+}}$	4/4	5/5	1(1/125-1)		5/5	4/4	1(1/121-1)
MDA-MB-231${}^{\text{a2d1-}}$	1/4	2/5	1/1278 (1/4483-1/364)	*3.26e-6	1/5	1/4	1/2408 (1/8100-1/716)	*1.29e-6
MDA-MB-435s${}^{a2d1+}$	5/5	4/5	1/62.1(1/185-20.9)		5/5	5/5	1(1/100-1)
MDA-MB-435s${}^{\text{a2d1-}}$	3/5	1/5	1/920.7 (1/2617-1/323.9)	*6.18e-4	0/5	1/5	1/5450 (1/30090-1/987)	*1.28e-8

*: Significant, 0.05, using Mann-Whitney U test for the comparison between two groups. Frequency of tumorigenic cell was used the webtool at http://bioinf.wehi.edu.au/software/elda/.

3.3. $\alpha$2$\delta$1 overexpression in breast cancer cells maintain the TIC properties

The full-length sequence of $\alpha$2$\delta$1 was transfected into MDA-MB-231 and MDA-MB-435s cells to establish stable $\alpha$2$\delta$1/OE cell lines, and we validated the $\alpha$2$\delta$1 mRNA level in different cells using real-time PCR (Fig. 3A). Next, the mRNA levels of stemness associated genes, such as Oct-4, Sox-2, Nanog, MDR1 and ABCG2, were further detected by qRT-PCR between the $\alpha$2$\delta$1/OE cells and their controls. The fold change was higher in the $\alpha$2$\delta$1/OE cells than in the controls (Fig. 3B). To determine whether overexpression of $\alpha$2$\delta$1 in the breast cancer cell lines can significantly enhance tumor initiation, we performed a sphere formation assay to verify the self-renewal ability of the $\alpha$2$\delta$1/OE cells. The results showed that overexpression of $\alpha$2$\delta$1 significantly increased the formation of spheres in vitro (Fig. 3C). The SFE of the $\alpha$2$\delta$1/OE cells was 24.1% and 34.6% for the MDA-MB-435s and MDA-MB-231 cells, respectively, while it was 8.5% and 15.1%, respectively, for the control cells. Moreover, the SFE was increased to 45.8% and 40.6% for the $\alpha$2$\delta$1/OE cells after secondary sphere formation (Fig. 3D). In addition, we subcutaneously injected 1000 and 100 cells with or without $\alpha$2$\delta$1 overexpression into the NOD/SCID mice. Compared with the control cells, the breast cancer cells overexpressing $\alpha$2$\delta$1 had a faster rate of tumorigenesis, larger tumor volume and higher tumorigenicity (Fig. 3E). The high tumor formation rate of the $\alpha$2$\delta$1/OE cells proved that $\alpha$2$\delta$1 plays an important role in maintaining the self-renewal ability of breast cancer cells in vivo (Fig. 3F). In addition, Mab 1B50-1 was used to rescue the self-renewal ability upon $\alpha$2$\delta$1/OE cells. As shown in Figure G and H, the spheroid formation was significantly inhibited by Mab 1B50-1. Thus, we showed that the self-renewal and tumorigenic ability of TICs in breast cancer cells depended on $\alpha$2$\delta$1 involvement.

Figure 3.

$\alpha$2$\delta$1 Expression is associated with stemness-related expression in breast cancer cells. A. qRT-PCR analysis of the expression of $\alpha$2$\delta$1 in the $\alpha$2$\delta$1-overexpressing ($\alpha$2$\delta$1 OE) and control breast cancer cells. Data presented as a fold difference over the control cells, which was defined as 1 (calibrator). Error bars indicate the SD. B. qRT-PCR analysis of the expression of stemness associated genes in the $\alpha$2$\delta$1 OE and control cells. *Student’s t test. C. Representative phase contrast micrographs showing how spheroids formed by the control cells and $\alpha$2$\delta$1/OE breast cancer cells (bar $=$ 100 $\mu$m). D. SFE of the MDA-MB-231 and MDA-MB-435s cells overexpressing $\alpha$2$\delta$1 and the control cells in vitro. One hundred cells per well were plated ($n=$ 6). All error bars indicate the SD. * One-way ANOVA test. E. Tumors from 1000 and 100 $\alpha$2$\delta$1/OE cells in transplanted NOD/SCID mice were displayed, compared with control group injection. F. The frequency of tumorigenicity in mice. *Student’s t test. G. Compared with the IgG control group, the spheroids formation was presented at MDA-MB-231 $\alpha$2$\delta$1/OE cells underling Mab1B50-1 treatment (bar $=$ 100 $\mu$m). H. The spheroids formation was presented at MDA-MB-435s $\alpha$2$\delta$1/OE cells. (bar $=$ 100 $\mu$m). *Student’s $t$ test.

3.4. $\alpha$2$\delta$1 increases the migration of breast cancer cells

To further elucidate the function of the $\alpha$2$\delta$1/OE breast cancer cells, we studied the metastatic potential of the $\alpha$2$\delta$1/OE cells by wounding assays. Twenty-four hours after a scratch was made in the cells, $\alpha$2$\delta$1 significantly increased the cell migration speed compared with that of the control group (Fig. 4A). We measured cell migration and found that the migration of the breast cancer cells overexpressing $\alpha$2$\delta$1 was increased 1.4–2.7-fold (Fig. 4B). Furthermore, a Boyden chamber assay was carried out to observe the difference in migration between the $\alpha$2$\delta$1/OE cells and the control cells (Fig. 4C). The number of MDA-MB-231 cells and MDA-MB-435s cells overexpressing $\alpha$2$\delta$1 passing through the lower chamber was significantly higher than that of the control group (Fig. 4D). These data showed that the migration ability of breast cancer cells was significantly enhanced after overexpression of $\alpha$2$\delta$1. To gain insight into the downstream targets of $\alpha$2$\delta$1, we analyzed RNA sequencing data from the $\alpha$2$\delta$1/OE cells and the control cells of both MDA-MB-231 cells and MDA-MB-435s cells. A total of 4463 upregulated genes were found in both types of $\alpha$2$\delta$1/OE cells. These genes were closely associated with ECM remodeling, inflammation, movement, EMT, metabolism etc. as shown by KEGG analysis. We found that 20 genes that were upregulated had a more than twofold increase in the $\alpha$2$\delta$1/OE cells compared to the control cells (Fig. 4E). These results provided several interesting pathways, indicating the contribution of $\alpha$2$\delta$1 to stemness characteristics.

Figure 4.

Migration enhanced by overexpressing $\alpha$2$\delta$1 breast cancer cells. A. Wound Healing Assay was performed between $\alpha$2$\delta$1 cells and controls. photographs were examined at 0 h and 24 h to observe migration under the microscope (bar $=$ 100 $\mu$m). B. The movement distance ($\delta$W) of breast cancer cells (W: the width from one side of the wound healing cells to the other side of wound healing cells, W0: the width of 0 hour, W24: the width of the 24${}^{\text{th}}$ hours, $\delta$W $=$ (W24-W0)/2) after 24 h were measured by Image J software. Bars represent the mean $\pm$ SD of three independent experiments. *Student’s $t$ test. C. Boyden chamber assay investigates invasive ability of $\alpha$2$\delta$1/OE and control cells. D. Cell number of migrations were counted with 6 random fields. Bars represent the mean $\pm$ SD of three independent experiments. *Student’s $t$ test. E. Diagram of candidates of regulatory cell signal pathways and associated transcript factors and downstream of related genes from sequencing of $\alpha$2$\delta$1 OE and control cells.

3.5. $\alpha$2$\delta$1 has no concern with the different molecular classification of breast cancer

For further understanding the role of $\alpha$2$\delta$1 in different molecular classification, the public data from TCGA and GEO were analyzed. The significance is not been found between normal tissues and tumor tissues (Fig. 5A). As well as at the typical molecular classifications, such as Luminal A, Luminal B, Her2 and Basal, $\alpha$2$\delta$1 expression was verified again using TCGA database. Expect for Luminal A, the mRNA level of $\alpha$2$\delta$1 was not obviously significant (Fig. 5B). In addition, the mRNA expression of $\alpha$2$\delta$1 from the individual indexes of triple-negative breast cancer were demonstrated, that no significance between the positive tissues and negative tissues in HER2, PR and ER (Fig. 5C and D), as well as in the TNBC positive and negative groups (Fig. 5F). Moreover, the response of $\alpha$2$\delta$1 undergoing chemotherapy drug treatment was discovered by gene chips from several GEO profiles. No significance of $\alpha$2$\delta$1 expression between sensitive and resistant samples in the datasets were identified upon Docetaxel and Tamoxifen (Figure G and H). However, we visualized the difference in Her2 positive patients between the two groups (Lapatinib sensitive and Lapatinib resistant patients) for $\alpha$2$\delta$1 gene over GEO dataset (Fig. 5I). Hence, using cell proliferation assay, we validated the effect of Docetaxel and Cisplatin reactions on $\alpha$2$\delta$1/OE cells. IC50 value of Docetaxel does not changes (Fig. 5J), but, compared with the control, $\alpha$2$\delta$1 had significantly enhanced proliferation in the presence of Cisplatin (IC50 from 33.54 $\pm$ 1.32 $\mu$mol/L to 146.4 $\pm$ 1.11 $\mu$mol/L, 0.05) in a dose-dependent manner (Fig. 5K). These evidences implicated that a higher IC50 value was exhibited in $\alpha$2$\delta$1/OE cells for some chemotherapy drugs, despite no difference was obviously available in breast cancer molecular classification.

Figure 5.

$\alpha$2$\delta$1 expression in different molecular classification and drug reaction. A. The mRNA level of $\alpha$2$\delta$1 between normal and tumor tissues from GEO dataset. B. The mRNA level of $\alpha$2$\delta$1 of different molecular classification from TCGA database. C. The mRNA level of $\alpha$2$\delta$1 between HER2- and HER2+ tissues from TCGA database. D. The mRNA level of $\alpha$2$\delta$1 between PR- and PR+ tissues from TCGA database. E. The mRNA level of $\alpha$2$\delta$1 between ER- and ER+ tissues from TCGA database. F. The mRNA level of $\alpha$2$\delta$1 between TNBC- and TNBC+ tissues from GEO dataset. G. The mRNA level of $\alpha$2$\delta$1 between Docetaxel resistant and Docetaxel sensitive tissues from GEO dataset. H. The mRNA level of $\alpha$2$\delta$1 between Tamoxifen resistant and Tamoxifen sensitive tissues from GEO dataset. I. The mRNA level of $\alpha$2$\delta$1 between Lapatinib resistant and Lapatinib sensitive samples from GEO dataset. J. Growth curve presents MDA-MB-231 cell proliferation under Docetaxel treatment. K. Growth curve presents MDA-MB-231 cell proliferation under Cisplatin treatment.

4. Discussion

In recent years, TICs have been considered an important cell population in breast cancer, especially for the occurrence and development of tumor processes. Tumors formed by asymmetric division of TICs have the ability to differentiate and maintain their own stem cell characteristics [13]. Because as few as 100 TICs can form implanted tumors in mice or single cell clones can form spheroids in serum free medium, the presence of TICs plays a critical role in tumorigenesis [14]. TICs of breast cancer are usually CD44${}^{+}$CD24${}^{-/\text{low}}$ [15], which can affect the biological behavior of tumor cells such as migration and extravasation [16], and are also key to tumor cell metastasis [17]. ALDH-l is considered another marker for TICs in breast cancer [18, 19] since it plays a role in early differentiation in stem cells [20]. It has been reported that the TICs of breast cancer also cause the resistance of tumor cells to chemotherapy and radiotherapy [21, 22, 23]. Transcription factors, such as OCT-4, Nanog, and SOX2, which maintain stem cell characteristics, can be detected in TICs in breast cancer [24]. Transcription of the OCT-4 gene in cancer cells significantly increased the subpopulation of ALDH1${}^{+}$ stem cells [25]. In addition, knocking out the OCT-4 gene in MCF-7 cells resulted in a loss of the characteristics of tumor stem cells [26]. These markers on the surface of TICs can be used as targets for drugs to limit the occurrence and development of breast cancer [27].

We previously reported that a subunit of the voltage dependent calcium channel called $\alpha$2$\delta$1 is associated with TICs in HCC [28]. As a potential precursor cell marker, $\alpha$2$\delta$1 was activated by PBX3 and maintained the stemness of liver cancer TICs. In this study, we examined breast cancer cell lines and discovered the role of $\alpha$2$\delta$1 in the maintenance of stemness properties. We detected the expression of $\alpha$2$\delta$1 in breast cancer cell lines, and 1.5–3% of the cells had $\alpha$2$\delta$1 on the surface of the cell membrane. $\alpha$2$\delta$1${}^{+}$ and $\alpha$2$\delta$1${}^{-}$ breast cancer cells were separately obtained according to $\alpha$2$\delta$1 antibody labeling and FCS sorting experiments. $\alpha$2$\delta$1${}^{+}$ cells presented a stronger tumorigenesis ability in vivo and in vitro and retained the potential of self-renewal and differentiation, similar to the characteristics of TICs. Overexpression of $\alpha$2$\delta$1 in control breast cancer cells demonstrated that stemassociated genes such as Oct4, Nanog, Sox2, ABCG2 and MDR1 were increased in the $\alpha$2$\delta$1 cells compared with the control cells. The formation of spheroids in vitro and the tumorigenic ability in NOD/SCID mice were significantly improved, suggesting that $\alpha$2$\delta$1 may be a candidate for TIC-enriched cells. Therefore, the mechanism of TIC regulation through $\alpha$2$\delta$1 should be investigated in breast cancer.

In this study, to assess the downstream targets of $\alpha$2$\delta$1, we examined TIC regulation in breast cancer. Several cell-signaling pathways and biological function were clustered and found using RNA sequencing and KEGG analysis. Highly scored transcription factors were further explored. Many candidate genes and proteins related to ECM remodeling, the inflammatory response, cell movement, EMT and metabolism were identified. Bioinformatics analysis suggested that $\alpha$2$\delta$1 showed no difference in these clinical pathological types of breast cancer, for example between HER2+/- or ER+/- or PR+/-. Therefore, we believe that nonspecific $\alpha$2$\delta$1 expression on the surface of cell membrane does not depend on whether breast cancer is a triple negative breast cancer or any other pathological types of breast cancer. However, there are still the limitations in our work: further study needs to elucidate the roles of $\alpha$2$\delta$1 targets, which is necessary for the maintenance of breast cancer stem properties; the cohort needs the clinical samples including in the independent RT-PCR validation; the mechanism of Lapatinib resistance in HER2+ cells should be proved by the additional evidence.

Compared with traditional radiotherapy and chemo-therapy, targeted TICs therapy is an important and accurate strategy for inhibiting tumor growth. Therefore, exploring the appropriate TIC surface marker and eliminating the TICs can effectively inhibit the rapid growth and recurrence of the tumor to prevent tumor progression. The purpose of this study was to identify the key molecular markers involved in the regulation of the invasive phenotype of breast cancer. We provided a theoretical basis for the TICs of breast cancer and suggestions for the possible clinical treatment of breast cancer. In the future, $\alpha$2$\delta$1 is going to be a potential target for inhibiting TICs in breast cancer therapeutic strategy.

Consent for publication

Not applicable.

Availability of data and material

All of the data and materials in this paper are available when requested.

Funding

This study was funded by the National Natural Science Foundation of China (82030080, 81872025), the Beijing Natural Science Foundation (7182030), the Clinical Features Research of Capital (No. Z151100004 015173), Open Project funded by Key laboratory of Carcinogenesis and Translational Research Ministry of Education/Beijing (2019 Open Project-03).

Authors’ contributions

Conception: Wei Zhao.

Interpretation or analysis of data: Meng Li, Weimin Zhang Xiaodan Yang and Guo An.

Preparation of the manuscript: Wei Zhao, Meng Li and Weimin Zhang.

Revision for important intellectual content: Wei Zhao.

Supervision: Guo An.

All authors were involved in writing the paper and all approved the submitted manuscript.

Conflict of interest

The authors declare that there are no conflicts of interest.