Antifungal mechanism of ketone volatile organic compounds against Pseudogymnoascus destructans

ABSTRACT

Ketone volatile organic compounds have demonstrated favorable inhibitory activity against a wide range of pathogenic fungi, including Pseudogymnoascus destructans (Pd), the lethal pathogenic fungus responsible for white-nose syndrome in bats. However, the mechanism of fungal inhibition by ketones remains unclear. In this study, we employed transcriptomic analysis to conduct RNA sequencing on Pd treated with 2-undecanone and 2-nonanone, aiming to investigate the effects of these ketones on the gene expression profiles of Pd. The results indicated that 2-undecanone and 2-nonanone inhibit spore germination in Pd and cause significant damage to its mycelium. The minimum inhibitory concentrations (MIC) were determined to be 25.94 μg/mL and 135.41 μg/mL, respectively. Transcriptomic analysis revealed these ketones affects Pd through multiple pathways, inducing lesions in the cell wall and membrane, and disrupting ribosomal stability by interfering with rRNA modifications and ribosome assembly. Additionally, we found that 2-undecanone impacts enzymes involved in the tricarboxylic acid cycle, disrupting energy metabolism by interfering with critical metabolic pathways in aerobic organisms. In contrast, 2-nonanone directly damages Pd DNA, triggering the activation of DNA damage repair mechanisms. This study provides a theoretical basis for exploring novel antifungal strategies targeting Pd, suggesting that ketones may serve as potential in vitro defense and control tools, laying the groundwork for the subsequent development of efficient fumigants.

Introduction

Microorganisms naturally produce a wide range of volatile organic compounds (VOCs) through metabolic processes, including ketones, ethers, aldehydes, alkenes, alcohols, and pyrazines [1,2]. These important secondary metabolites are characterized by low molecular weight, low boiling points, high vapor pressure, and volatility at ambient temperatures [3]. Research has shown that microbial volatile organic compounds (mVOCs) can be transmitted over long distances in atmospheric and liquid media, but their transmission is more localized in soil. These compounds mediate intracellular signaling and inter-organism interactions while also regulating biological health [4]. For instance, dimethyl disulfide has been shown to promote plant growth, significantly increasing biomass [5]. Additionally, 2,3-butanediol and certain alkanes can induce systemic resistance in plants, enhancing their tolerance to biotic stress [6]. Several compounds, including ketones, have also demonstrated the ability to inhibit the growth of pathogenic fungi or act as antibiotics [7,8].

In recent years, the emergence of increasingly stubborn fungal diseases has posed a significant threat to the species composition of both animal and plant hosts, accounting for approximately 65% of pathogen-driven host losses [9]. VOCs are emerging as potential sustainable and effective antimicrobial agents for the biocontrol of fungal pathogens [7,10]. Their application is of substantial significance for developing novel strategies for the prevention and management of fungal diseases. Compared to bacteria, fungi exhibit significant differences in cellular components and morphological structures, leading to distinctly different damage responses when treated with VOCs [8]. In addition to disrupting cell wall and membrane integrity, which leads to leakage of intracellular contents [11], VOCs can cause DNA damage, cytoplasmic and protoplasmic aggregation, and destruction of organelles such as mitochondria [12,13]. Fungal damage is predominantly manifested through significant abnormalities in hyphal morphology and structure [14,15], increased vacuolation [16], and inhibition of normal conidial development and germination [17].

Among the common VOCs produced by bacteria, ketones exhibit significant antifungal activity against various pathogens [7], and increasing research is identifying them as potential antifungal agents against pathogenic fungi [18]. For instance, 2-nonanone and 2-heptanone, produced by Pseudomonas, display strong antifungal activity, significantly inhibiting the growth of Agrobacterium tumefaciens C58 [19]. Additionally, 2-nonanone effectively suppresses the mycelial growth of Colletotrichum acutatum [20]. 2-undecanone produced by Bacillus velezensis completely inhibits the growth of Fusarium graminearum [21]. 6-methyl-2-heptanone, generated by Bacillus subtilis ZD01, disrupts the internal structure of conidia in Alternaria solani, leading to downregulation of pathogenic genes expression. Although numerous studies have highlighted the potent inhibitory effects of ketones on various pathogenic fungi, there remains a lack of research into the underlying mechanisms of their actions.

Pseudogymnoascus destructans (Pd), the lethal causative agent of white-nose syndrome (WNS) in bats [22,23], has led to regional extinction of bat populations and poses a serious threat to biological health and ecosystem stability [24]. However, in contrast to North America, no large-scale bat mortality events attributed to Pd have been documented in Eurasia [25,26]. Bat populations in China, for example, tend to show lower fungal loads of Pd, which do not result in mortality [27]. This suggests that there may be host resistance mechanisms at play. Investigating the resistance strategies of Chinese bat species could provide valuable insights into potential management approaches for WNS in North American bat populations. Previous research on the biocontrol of WNS has primarily focused on isolating and screening antagonistic bacterial strains against Pd and identifying VOCs with antifungal activity [28,29]. For example, the antagonistic strain Pseudomonas yamanorum GZD14026 has been shown to metabolize octanoic acid, 3-methyl-3-buten-1-ol, and 3-tert-butyl-4-hydroxyanisole, effectively inhibiting Pd growth at low concentrations [30]. Additionally, compounds such as 1-octen-3-ol and trans-2-hexenal have demonstrated to ability to suppress Pd mycelial growth and prevent conidial germination [31], with trans-2-hexenal also influencing Pd gene expression. This includes significant downregulation of virulence factor-related genes, such as those encoding superoxide dismutase and subtilisin-like serine protease [32]. However, research on the underlying mechanisms by which VOCs produced through bacterial metabolism inhibit Pd remains limited, and few studies have specifically examined the role of ketones in inhibiting Pd growth.

In our previous studies, we identified antagonistic bacterial strains isolated from the wing membranes of Myotis pilosus in China that can metabolize and produce substantial amounts of VOCs, demonstrating strong inhibitory effects against Pd grown on sabouraud dextrose agar (SDA) [33]. Among these, 2-undecanone and 2-nonanone were found to be potent inhibitors of Pd, completely suppressing its growth even at low concentrations [33]. In this study, RNA sequencing (RNA-seq) was conducted on Pd treated with 2-undecanone and 2-nonanone to investigate the impact of these ketones on gene expression patterns. By examining various aspects, including morphological structure, energy metabolism, and genetic information processing, this research aims to elucidate the antifungal mechanisms of ketones against Pd. The findings will provide a theoretical basis for exploring novel antifungal strategies targeting Pd, suggesting that ketones may serve as potential in vitro defense and control tools, laying the groundwork for the subsequent development of efficient fumigants.

Materials and methods

Ketone volatile compounds and Pd

Standards for 2-nonanone (CAS: 821–55-6) and 2-undecanone (CAS: 112–12-9) were purchased from Shanghai Macklin Biochemical Technology Co., Ltd. Pseudogymnoascus destructans JHCN111a (hereafter referred to as Pd) was preserved by the Key Laboratory of Animal Resource Conservation and Utilization at Northeast Normal University in Jilin Province.

Antifungal activity of ketone volatile compounds against Pd

To obtain Pd spore suspension, frozen glycerol stocks of Pd were inoculated onto SDA plates and incubated under controlled conditions (13°C, 90% relative humidity) for three weeks. After incubation, 10 mL of phosphate-buffered saline with 0.05% Tween 20 (PBST₂₀) was added to the Pd spores to facilitate scraping. The resulting suspension was then filtered to remove mycelia, and the spores were counted using a hemocytometer. Finally, the spore concentration was adjusted to 10⁵ spores/mL.

100 μL of Pd spore suspension was evenly inoculated at a concentration of 2 × 10⁵ spores/mL onto SDA plates. After allowing to inoculum to dry, the plates were inverted and different volumes (100 μL, 50 μL, and 10 μL) of VOC standards were inoculated onto sterile paper disks, which were then placed at the center of the inner lid of the plates. The plates were incubated under 13°C and 90% humidity for 14 days, during which the inhibition of Pd growth was observed and recorded, with three biological replicates for each treatment. The concentrations of the compounds were adjusted using a two-fold dilution method on a 14-day basis, and plate images were processed using ImageJ (v1.54f) software after incubation to determine the minimum inhibitory concentration (MIC) and the half-maximal inhibitory concentration (IC₅₀) [34]. Antifungal activity was defined as the ability of a VOC to inhibit the growth of Pd, which was assessed by measuring the reduction in growth area or the absence of visible growth around the paper disk. The MIC was determined as the lowest VOC concentration at which no visible Pd growth was observed compared to the control. The IC₅₀ was defined as the VOC concentration that resulted in a 50% reduction in the Pd growth area.

Effects of ketone volatile compounds on the morphology of Pd

Pd strains were inoculated separately onto SDA agar plates containing IC₅₀ concentrations of 2-nonanone and 2-undecanone, and cultured for 21 days. Each treatment group had four biological replicates. Fresh mycelia were then quickly cut into pieces measuring 1–2 mm³ and immersed in an adequate volume of 2.5% glutaraldehyde fixative solution to fully submerge the mycelia. The samples were fixed at room temperature in the dark for 2 hours and subsequently transferred to 4°C for low-temperature fixation for 24 hours. After fixation, the excess glutaraldehyde was removed, and samples were dehydrated through a graded ethanol series of 30%, 50%, 70%, 90%, and 100%, with each step lasting 30 minutes. Following dehydration, the samples were dried for 24 hours and sputter-coated with gold. Untreated mycelia served as controls. The samples were then observed and photographed under a scanning electron microscope (SEM, HITACHI Regulus 8100, Japan).

Preparation of RNA and transcriptome sequencing analysis

100 μL of 2 × 10⁵/mL Pd spore suspension was inoculated onto SDA agar medium containing 2-nonanone and 2-undecanone, respectively. After incubating these with the control group for 21 days, the mycelia was harvested using sterile scrapers. Each group comprised four replicates. RNA was extracted from the Pd using the TRIzol Reagent (Life Technologies, California, USA) according to the manufacturer’s instructions. The concentration and purity of the extracted RNA was assessed using a Nanodrop 2000 spectrophotometer, and RNA integrity was verified through agarose gel electrophoresis. The samples were sent to Shanghai Majorbio Bio-Pharm Technology Co., Ltd. for library construction using the Illumina® Stranded mRNA Prep, Ligation from Illumina (San Diego, CA). Following quality control of the libraries, sequencing was performed on the Illumina NovaSeq X Plus platform. After obtaining the raw transcriptome data, quality control was performed, which included the removal of adapter sequences, filtering out low-quality reads (Q < 0.02), and excluding reads with more than 10% ambiguous base information [35]. Subsequently, Hisat2 (v2.1.0) was used to align the clean data with the reference genome (GCF_001641265.1) [36]. After assembly, RSEM (v1.3.3) was employed to calculate the number of reads per million (TPM) corresponding to each transcript to estimate gene expression levels [37]. Gene functional annotation information from the following databases were obtained: NR (v2022.10), Swiss-Prot (v2022.10), Pfam (v35.0), EggNOG (v2020.06), GO (v2022.0915), and KEGG (v2022.10).

Differential expression analysis

To investigate the differences in gene expression between the treatment groups and the control group, differential gene expression analysis was performed using DESeq2 (v1.24.0) [38]. P-values were corrected using the Benjamini and Hochberg method [39], with the criteria for significant differential expression defined as FDR < 0.05 & |log2FC| ≥ 1. Goatools (v0.6.5) was used to conduct GO enrichment analysis for the differentially expressed genes (DEGs) [40], and R (v4.1.0) for KEGG pathway enrichment analysis [41] (Table S2, Table S3). Fisher’s exact test was utilized, with multiple testing correction performed via the Benjamini and Hochberg method, and significant enrichment was determined with corrected P-values < 0.05.

To visualize the gene expression patterns, principal component analysis (PCA) was performed using the dudi.pca() function from the ade4 package in R [42]. Additionally, ANOSIM was conducted based on Bray-Curtis distances using the anosim() function from the vegan package to assess inter-group differences [43].

qRT-PCR analysis

Quantitative real-time reverse transcription-PCR (qRT-PCR) was used to randomly verify the transcription levels of eight genes. The extracted RNA was used as a template to reverse transcribe the RNA into cDNA, following the instructions provided in the MightyScript Plus First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai). The total reaction volume was 20 μL, comprising 1 μL of RNA template, 3 μL of 5X gDNA digester mix, and 11 μL RNase-free ddH₂O. After incubation at 42°C for 5–15 minutes, 5 μL of 4X III M-MLV RT mix was added. The reaction conditions were set at 25°C for 5 minutes, 55°C for 15 minutes, and inactivated at 85°C for 5 minutes. After completing the reverse transcription, quantitative PCR (qPCR) was performed according to the instructions provided with the SGExcel FastSYBR qPCR Kit (Sangon Biotech, Shanghai). ACT1 was selected as the internal reference gene, and the primers used are listed in Table 1. The qPCR (total volume of 20 μL) contained the following components: 10 μL of 2X SGExcel FastSYBR Mixture, 0.4 μL of forward primer, 0.4 μL of reverse primer, 1 μL of cDNA template, 0.2 μL of 100X ROX Reference Dye and 8 μL of RNase-free ddH₂O. The reaction conditions included enzyme activation with pre-denaturation at 95°C for 3 minutes, followed by denaturation at 95°C for 5 seconds, and annealing at 60°C for 20 seconds, for a total of 40 cycles. The 2^−ΔΔCt method was used to calculated relative gene expression levels [44], with each reaction performed in triplicate.

Table 1.

Genes ID and primer sequences used in qRT-PCR.

Gene ID	Gene Description	Forward primer	Reverse primer
VC83_07844	actin	AGTAGCAGCCCTCGTCATTG	GACAACACCGTGCTCGATTG
VC83_04645	Aconitate hydratase mitochondrial	GTTCGGCGGCATGGTTCTTG	GTTACGGTTGTAGGATGAGATGATGG
VC83_01361	Major allergen Asp f 2	TCGCTGTCGTATTTCGCTCTTG	TGCTCCTCCTCAACTACCTTTCC
VC83_00970	Heat shock protein 78, mitochondrial	AGCACAACGCCTCAACAACTATG	CATCCAATCCAGTCTCGCCATC
VC83_07327	Probable glucan endo-1,3-β-glucosidase eglC	TCAAGTCCGCCAGGCTATCG	ACCGTTCACCCAGTCGTTCC
VC83_01131	26S proteasome complex subunit	GAGACCGAAGTACCAGATAACAACAC	TTTGCTCGCCTTCTTTAGTTCCTC
VC83_03131	succinate dehydrogenase complex, subunit B	AGTCCATCAAGCCATACCTCCAG	TTCTTGCGGTCCTCTACACTCTG
VC83_08709	RNA binding protein snu13	CGAGGACAAGAACGTGCCATAC	CGTTGGTGGTGATGCTGGTC
VC83_01344	catalase A	AGGTTGTTGACTGCTATGGTGTTG	CCTTCTCCAAGCCCTCCCTTATAC

Results

Anti-Pd activity of ketone volatiles

2-Undecanone completely inhibited the growth of Pd at volumes of 100 μL (1.30 mg/mL), 50 μL (0.64 mg/mL), and 10 μL (0.13 mg/mL). Similarly, 2-nonanone completely inhibited Pd at 100 μL (1.29 mg/mL) and 50 μL (0.64 mg/mL), while at 10 μL (0.13 mg/mL), it suppressed most Pd growth (Figure 1). Compared to 2-nonanone, 2-undecanone exhibited a stronger inhibitory effect. We subsequently determined that the MIC of 2-nonanone against Pd was 135.41 μg/mL, with an IC₅₀ of 38.69 μg/mL. For 2-undecanone, the MIC was 25.94 μg/mL and the IC₅₀ was 6.49 μg/mL.

Figure 1.

Effect of different concentrations of 2-nonanone and 2-undecanone on the inhibition of pd. (a) Control group; (b) Experimental group.

Ketone volatiles affect morphological and structural changes in Pd

In the control group, Pd hyphae appeared straight and uniform, characterized by a smooth and full appearance, glossy rounded tips, and regular, well-defined septation, showing no visible damage. In contrast, the 2-undecanone group exhibited irregular morphology, including surface ruptures, collapsed and shrunken hyphae, rough deformities, and breakage. The 2-nonanone group also displayed significant hyphal shrinkage and bending (Figure 2).

Figure 2.

Morphology of Pd mycelia observed at 10000x under SEM. (a) Untreated; (b) Treated with IC₅₀ of 2-undecanone; (c) Treated with IC₅₀ of 2-nonanone.

Overall transcriptional response of Pd to ketone volatiles

RNA sequencing of 12 Pd samples yielded a total of 627.47 million reads, with an average of 52.29 million reads per sample (ranging from 44.68 to 63.95 million reads). After quality control, 621.09 million reads were retained, averaging 51.76 million reads per sample (ranging from 44.17 to 63.37 million reads). The clean data aligned to the reference genome showed a mapping rate ranging from 90.82% to 94.3% across all samples. Additionally, the Q20 values exceeded 98%, and the sequencing error rate was only 0.01%, indicating high sequencing quality suitable for downstream analyses (Table S1).

PCA was conducted to compare gene expression levels between the treatment groups with the control group. Both the 2-undecanone and 2-nonanone groups clustered separately from the control group (2-undecanone vs. control: R² = 0.700, P_adj = 0.038; 2-nonanone vs. control: R² = 0.444, P_adj = 0.038, Figure 3(a)).

Figure 3.

Transcriptomic analysis of Pd gene expression following treatment with ketones. (a) PCA comparing the 2-nonanone and 2-undecanone groups to the control group; (b) Volcano plot of DEGs in the 2-undecanone group; (c) Volcano plot of DEGs in the 2-nonanone group.

Using DESeq2 for differential expression analysis between the treatment groups and the control group, a total of 1,603 DEGs were identified in the 2-undecanone group, of which 915 were significantly upregulated and 688 were significantly downregulated (Figure 3(b)). In the 2-nonanone group, 1,349 DEGs were identified, with 714 significantly upregulated and 635 significantly downregulated (Figure 3(c)). GO enrichment analysis of DEGs revealed that the 2-undecanone group were enriched with 26 significantly downregulated pathways, including ribosome biogenesis, RNA processing, and RNA helicase activity, while only one pathway was significantly upregulated. In contrast, the 2-nonanone group exhibited enrichment in a greater number of pathways, with 30 significantly downregulated pathways, such as rRNA processing, protein kinase binding, and regulation of protein serine/threonine kinase activity; 15 of these pathways overlapped with those in the 2-undecanone group (Figure 4(b)). Additionally, 41 significantly upregulated pathways were identified in the 2-nonanone group, including DNA replication initiation, chromosome organization, cellular response to DNA damage stimulus, and polyketide metabolic process (Figure 4(a)). KEGG enrichment analysis of the DEGs revealed that both treatment groups showed significant downregulation in pathways related to ribosome biogenesis. Notably, the 2-nonanone group exhibited significant upregulation in pathways involved in DNA damage repair and replication, such as mismatch repair and base excision repair.

Figure 4.

Significantly enriched GO pathways in Pd treatment with VOC. (a) Significantly upregulated pathways in the 2-undecanone and 2-nonanone groups; (b) Significantly downregulated pathways in the 2-undecanone and 2-nonanone groups.

Figure 4.

(Continued).

Functional analysis of differentially expressed genes

Cell walls and membranes

The cell wall and membrane of Pd are in direct contact with VOCs, leading to significant changes in the expression of genes involved in regulating the components of these structures. Following treatment with ketone, genes encoding α-1,3-glucan synthase, including AGS1_2, AGS1_3, AGS1_4, and AGS1_5, as well as the gene VC83_02184, which is involved in chitin biosynthesis, were significantly upregulated. In the 2-nonanone group, CHS2_1, which encodes chitin synthase 2, also showed significant upregulation. Additionally, several genes associated with cell wall remodeling exhibited significant differential expression in response to ketone exposure. Additionally, treatment with 2-undecanone suppressed the expression of Pd key genes involved in ergosterol biosynthesis, ERG11 and ERG6. The expression of several genes related to unsaturated fatty acid biosynthesis and fatty acid degradation was significantly downregulated following treatment with ketones, while genes associated with fatty acid biosynthesis were significantly upregulated (Table S4).

Genetic information processing and stress response

We found that some DEGs associated with ribosome biosynthesis were downregulated following ketone stimulation compared to the controls. The ribose moiety 2’-O-methylation and pseudouridylation modifications in the rRNA precursor scaffold were suppressed. Genes involved in pre-rRNA processing, ribosomal subunit synthesis, and regulatory factors were significantly downregulated under VOC treatments. For instance, the gene encoding mRNA turnover and ribosome assembly protein (MRT4) was downregulated by 4.67-fold and 13.31-fold following treatments with 2-nonanone and 2-undecanone, respectively. Additionally, the treatment with 2-nonanone led to significant upregulation of numerous genes involved in DNA damage repair, such as those encoding DNA repair protein RAD52 and replication protein A, as well as genes associated with DNA catalytic activity, including DNA ligases and DNA polymerases (Figure 5).

Figure 5.

Schematic diagram of DNA damage repair mechanisms. The genes encoding the proteins or enzymes labeled in the figure are all significantly upregulated.

Spore development and mitochondrial function

We observed that the homolog of the spore development regulator gene RYP2 from Ajellomyces capsulatus in Pd exhibited downregulation by 3.26-fold and 3.40-fold after treatment with 2-nonanone and 2-undecanone, respectively. Additionally, the VC83_07479, which is a homolog of the conidiophore development regulator-encoding gene abaA from Penicillium rubens, was also downregulated 5.55-fold after 2-nonanone treatment.

After ketone treatment, significant differences were observed in the expression of genes related to mitochondrial function. For instance, under 2-undecanone treatment, genes encoding key enzymes in the tricarboxylic acid (TCA) cycle, such as aconitase and succinate dehydrogenase, were significantly downregulated. Conversely, following treatment with 2-nonanone, the ATP hydrolysis pathway was significantly upregulated, indicating an acceleration or enhancement of the ATP hydrolysis process (Table 2).

Table 2.

Significant expression of some genes related to the regulation of spore development and the energy metabolism.

Gene ID	Full Name	Pd	2-Nonanone (log2FC)	2-Undecanone (log2FC)
Spore Development
VC83_07417	Spore development regulator RYP2	6.35	1.95 (−1.33)	1.87 (−1.17)
VC83_07479	Conidiophore development regulator abaA	14.47	2.61 (−2.12)	6.53 (−0.62)
Energy Metabolism
VC83_04645	Aconitate hydratase mitochondrial	506.11	264.78 (−0.56)	134.35 (−1.26)
VC83_03131	succinate dehydrogenase complex, subunit B	168.83	106.37 (−0.34)	37.39 (−1.54)
VC83_04015	aconitate hydratase	10.43	11.23 (0.46)	1.57 (−2.14)
VC83_08554	ornithine carbamoyltransferase	54.38	48.71 (0.18)	17.55 (−1.00)
VC83_06943	isocitrate dehydrogenase	8.04	1.01 (−2.63)	1.42 (−1.88)
VC83_04410	Succinyl-CoA synthetase subunit beta	143.57	197.76 (0.83)	44.29 (−1.02)
VC83_05013	pyruvate carboxylase	16.05	27.65 (1.18)	8.60 (−0.22)
VC83_04411	citrate synthase	171.03	309.16 (1.22)	75.06 (−0.51)
VC83_09290	Phosphoenolpyruvate Carboxylase	645.83	1184.39 (1.28)	575.48 (0.55)

Virulence

We examined 50 genes presumed to be associated with Pd virulence, as highlighted by Reeder et al. (2017) [45], and identified differential expression in 26 of these genes (Table 3). Among these, most genes encoding members of the subtilisin family showed no differential expression. However, the Tripeptidyl-peptidase sed2 gene, which is involved in extracellular protein degradation, was significantly downregulated. Additionally, the VC83_01361 gene, a homolog of the major allergen Aspf2 from Aspergillus fumigatus, which encodes other proteases in Pd, also exhibited lower expression levels following ketone treatment. Furthermore, some genes related to the heat shock response in Pd were found to be overexpressed.

Table 3.

Among the genes hypothesized by Reeder et al. (2017) [42] to be associated with pd virulence, 26 were affected by ketone.

Gene ID	Full Name	Pd	2-Nonanone (log2FC)	2-Undecanone (log2FC)
Secreted Enzymes
VC83_01361	Major allergen Asp f 2	267.03	81.72 (−1.42)	134.54 (−0.35)
Heat Shock Response
VC83_02553	30 kDa heat shock protein	3141.77	5453.56 (1.16)	18,426.07 (3.48)
VC83_00970	Heat shock protein 78, mitochondrial	259.14	572.19 (1.56)	1102.43 (2.94)
VC83_00522	Protein psi1	461.22	487.67 (0.34)	1305.21 (2.39)
VC83_01964	Heat shock protein hsp88	266.17	334.44 (0.74)	501.57 (1.73)
VC83_08137	Heat shock protein hsp98	1148.11	1665.46 (0.94)	2333.34 (1.83)
VC83_01046	Heat shock 70 kDa protein 2	5572.21	4236.26 (0.00)	7249.80 (1.17)
VC83_02466	Uncharacterized protein C1711.08	433.16	502.17 (0.59)	1043.17 (2.07)
VC83_08187	Heat shock protein 82	1657.93	2495.59 (1.01)	4095.33 (2.12)
VC83_06435	Heat shock protein sti1 homolog	446.84	753.70 (1.15)	1448.95 (2.50)
Ion Homeostasis
VC83_01360	Zinc-regulated transporter 1	117.74	22.52 (−2.07)	76.27 (0.01)
VC83_07026	Calcium-transporting ATPase 3	52.38	94.21 (1.25)	187.96 (2.58)
VC83_06862	Calcium-transporting ATPase 3	8.23	9.05 (0.52)	21.56 (2.10)
VC83_00736	Na(+)/H(+) antiporter 1	6.88	11.60 (1.13)	7.80 (0.78)
Cell Wall Remodeling
VC83_03500	Spherulin-1A	80.72	47.38 (−0.40)	163.43 (1.58)
VC83_07327	Probable glucan endo-1,3-β-glucosidase eglC	482.77	913.09 (1.29)	1265.81 (2.03)
VC83_07145	Mannan endo-1,6-α-mannosidase DCW1	33.73	28.91 (0.14)	73.92 (1.81)
VC83_09076	Glucan 1,3-β-glucosidase	174.84	50.09 (−1.43)	34.24 (1.66)
VC83_00261	Mannan endo-1,6-α-mannosidase DFG5	27.91	30.36 (0.47)	6.02 (−1.58)
VC83_08448	Protein SUR7	332.59	97.52 (−1.44)	417.24 (0.88)
VC83_01650	Mannan endo-1,6-α-mannosidase DCW1	49.28	9.94 (−1.99)	10.33 (−1.68)
Other
VC83_06039	Putative heme-binding peroxidase	238.08	92.18 (−1.06)	123.41 (−0.33)
VC83_00225	Putative cryptochrome DASH, mitochondrial	9.06	9.59 (0.47)	14.17 (1.30)
VC83_01624	Leptomycin B resistance protein pmd1	28.72	63.52 (1.56)	37.33 (1.14)
VC83_08633	Threonine aspartase 1	2.69	2.63(0.35)	6.71 (2.07)
VC83_02181	Tripeptidyl-peptidase sed2	1.52	4.09 (1.83)	0.29 (−1.71)

qRT-PCR validation of DEGs

In eight randomly selected DEGs, genes related to cell wall (VC83_07327), heat shock response (VC83_00970), and DNA repair (VC83_01131) were up-regulated, and genes associated with ribosomes (VC83_08709), energy metabolism (VC83_04645, VC83_03131), oxidative stress (VC83_01344), and virulence (VC83_01361) were down-regulated (Figure 6). The results demonstrated expression trends consistent with the RNA-seq data, confirming the accuracy and reliability of the transcriptomic analysis.

Figure 6.

Relative gene expression levels of selected genes in control and experimental groups were compared by qRT-PCR and RNA-seq.

Discussion

Transcriptome sequencing, as an effective tool for exploring the interactions between antifungal agents and fungal pathogens [11,46], provides deeper insights into the VOCs that inhibit Pd mechanisms. Previous studies have demonstrated that the primary antifungal mechanism of mVOCs involves disrupting cell wall and membrane structures, leading to cell lysis, leakage of intracellular contents, and the induction of oxidative stress [10]. This antifungal mechanism is generally multilayered, involving genetic information processing, cell development, energy metabolism, and more [47,48]. Similarly, in this study, we found that ketones exerted multifaceted effects on Pd, influencing DNA integrity, cell wall and membrane composition, as well as ribosomal biogenesis and energy metabolism to varying degrees (Figure 7). While 2-nonanone exhibited a higher MIC compared to 2-undecanone, the latter significantly caused more severe mycelial breakage. These findings align with the idea that longer carbon chains do not necessarily reduce antifungal activity, which contradicts previous studies [49]. However, the GO enrichment analysis revealed that 2-nonanone affected a wider array of genes related to fungal growth and metabolism compared to 2-undecanone, despite a larger number of DEGs being observed under 2-undecanone treatment. This suggests that the activity of ketones might involve more complex biological mechanisms than can be captured by MIC alone. It is possible that 2-nonanone impacts a broader range of pathways, indicating a more complex interaction than MIC alone can account for.

Figure 7.

Schematic diagram illustrating the multifaceted effects of ketones on Pd from various perspectives.

The cell wall and membrane serve as crucial protective barriers for fungal pathogens [50,51]. As a dynamic structure, the cell wall is essential for cellular vitality and the maintaining the morphological integrity of fungi. Due to their unique composition, the immune systems of many plants and animals have evolved to recognize conserved components of fungal cell walls, such as β-(1,3) glucans and chitin [52]. However, the presence of α-(1,3) glucans on the outer wall of pathogenic fungi often hinders the immune recognition of underlying β-(1,3) glucans by receptor proteins like C-type lectin Dectin-1 [53]. Our findings indicate that the expression of α-1,3-glucan synthase expression was upregulated following treatment with 2-nonanone and 2-undecanone, suggesting that Pd initiates a stress response in response to ketone stimulation. Cell wall polysaccharides, with rhamnose as a major component, are central to the toxic effects of Pd by promoting biofilm formation, shielding immune recognition, and inhibiting host inflammatory responses [54]. However, changes in the gene expression of key enzymes involved in rhamnose synthesis were not observed in this study. Similar to how VOCs produced by Bacillus subtilis CF-3 can damage the cell wall integrity of Colletotrichum gloeosporioides [47], our SEM observations revealed that 2-nonanone and 2-undecanone caused mycelial damage and degradation. This may explain differential expression of various genes in Pd related to cell wall components. Pd appears to counteract cellular damage induced by 2-undecanone and 2-nonanone through the differential expression of genes encoding cell wall components, leading to substantial changes in cell wall structure.

The cell membrane performs various critical functions and possesses essential characteristics [55]. Ergosterol, a key component of fungal cell membranes, is also a major target for antifungal drugs [56]. Many antifungal agents inhibit fungal growth by disrupting ergosterol biosynthesis, primarily by suppressing the expression of the ERG11 and ERG6 genes, which is a key mechanism of azole drugs in treating fungal infections [57]. After treatment with 2-undecanone, we found that ERG11 and ERG6 expression were downregulated by 3.71-fold and 3.20-fold, respectively, while ERG28 expression was reduced by 2.44-fold following treatment with 2-nonanone. This downregulation suggests that VOCs may induce cellular membrane damage by altering the expression of genes related to membrane component. The composition and content of lipids are also crucial for maintaining cell membrane integrity. A deficiency in unsaturated fatty acids or an excess of saturated fatty acids in the cell membrane can reduce membrane fluidity, increase rigidity, and ultimately lead to membrane rupture [58,59]. Following the treatment of Pd with ketones, we observed several genes associated with unsaturated fatty acid biosynthesis and fatty acid degradation were significantly downregulated, while genes related to fatty acid biosynthesis were upregulated. These genes play an essential role in maintaining membrane fluidity, indicating that the fluidity and integrity of the cell membrane may have been altered.

Energy metabolism is fundamental to the survival and reproduction of pathogenic fungi. Mitochondria generate ATP through the TCA cycle, providing essential energy for the cell [60]. This makes mitochondria a potential target for antifungal drugs, as any dysfunction can lead to cell death [61]. Studies have shown that VOCs produced by Pseudomonas fluorescens reduce the activity of malate dehydrogenase and succinate dehydrogenase in Botrytis cinerea, directly impacting the efficiency of the pathogen’s TCA cycle [11]. In our study, we found that 2-undecanone among the VOCs inhibits key catalytic enzymes of the TCA cycle, suggesting that it may disrupt Pd respiration and energy metabolism. Consistent with previous studies [62], our findings also revealed that ketones inhibit fungal spore development and formation. Pd treated with these ketones exhibited delayed germination compared to the control group. Additionally, these ketones significantly affect the virulence genes of Pd. Although PdSP1 [63], regarded as a major component of the Pd secretome, was not notably impacted [64], other affected proteases may serve as better targets for preventing fungal colonization [45]. Research indicates that heat shock proteins are involved in fungal morphogenesis, performing functions such as signaling, catalysis, and ATPase activity, and play a crucial role in defending against external stress [65–68]. Besides heat stress, various physical or chemical stimuli can also trigger the expression of heat shock proteins, aiding in the refolding of misfolded proteins to restore their functional structure [69].

Ribosomes are critical organelles responsible for protein synthesis within cells [70]. Consistent with our findings, genes encoding ribosome biogenesis typically downregulate their expression in response to biotic or abiotic stress [71]. Functional enrichment analysis revealed that ketones primarily disrupt Pd through pathways related to genetic information processing. In particular, 36 DEGs associated with ribosome biogenesis in eukaryotes were downregulated in the 2-undecanone group, while 26 DEGs were downregulated in the 2-nonanone group. Notably, key internal rRNA modifications, such as 2’-O-methylation and pseudouridylation, were significantly inhibited by 2-undecanone. The expression of genes encoding essential ribosome assembly components, including Nop1 (which catalyzes methyl transferase activity), SNU13 (involved in U3 snoRNP complex assembly by binding to snoRNA), NOP56, NOP58, and others related to ribosome assembly, was also downregulated. Furthermore, we observed that 2’-O-methylation was inhibited in the 2-nonanone group, suggesting that both 2-nonanone and 2-undecanone disrupt RNA stability and interfere with ribosome assembly [72], potentially impairing Pd‘s protein synthesis capacity and efficiency. Recent studies have reported that various VOCs can cause DNA damage in fungi. For instance, Fourier-transform infrared (FTIR) spectroscopy analysis has revealed that 2-ethylhexanol induces alterations in the integrity of Fusarium oxysporum DNA [73]. Notably, sequencing results indicate that 2-nonanone appears to directly damage the DNA of Pd, leading to the upregulation of DNA damage repair mechanisms, including mismatch repair, base excision repair, nucleotide excision repair, and homologous recombination. Specifically, genes encoding MutS family proteins that recognize mismatches, DNA ligase I, DNA polymerases δ or ε which participate in long patch base excision repair, as well as Flap endonuclease 1 (FEN1), are upregulated. Additionally, the formation of Rad51 filaments in homologous recombination repair [74] is promoted. It is well known that VOCs can trigger the intracellular accumulation of reactive oxygen species (ROS), and an excessive amount of ROS can disrupt the redox state of fungal hyphae by damaging detoxification mechanisms [75,76]. For instance, linalool induces ROS accumulation and reduces the activity of many antioxidant enzymes in Fusarium oxysporum, ultimately leading to cell apoptosis [77]. In the 2-undecanone group, the expression of the CAT1, which encodes catalase (katE), was significantly downregulated, suggesting that 2-undecanone may impair the activity of antioxidant enzymes in Pd, thereby inducing an imbalance in oxidative stress regulation.

Although these ketones have shown potential in inhibiting Pd, the experiments were conducted using SDA, a fungal growth medium that may not accurately reflect conditions on bat skin or in cave environments [78]. Therefore, further pre-experiments are necessary to assess the effectiveness and safety of these findings in real-world scenarios. As noted by Gabriel et al. [79], the control of Pd with VOCs should be prioritized in North America, where it causes significant bat mortality, rather than in Eurasia, where the threat of Pd is less severe. Before applying these ketones directly to bats in North America, it is critical to determine whether they retain their inhibitory effects when fungus penetrates deeper into bat tissues. Environmental factors such as cave temperature and humidity must be carefully considered to ensure that VOCs diffuse properly and reach the desired concentration levels in bat roosting caves. Maintaining the lowest effective concentration is essential to minimize potential negative impacts on the cave ecosystem. Furthermore, continuous monitoring of VOCs concentrations should be carried out to ensure both safety and efficacy. While 2-nonanone and 2-undecanone exhibit low toxicity to vertebrates, they also possess insect-repellent and germicidal properties [80–82]. To minimize the impact on non-target organisms, localized spraying methods may be considered.

Conclusion

We used RNA sequencing analysis to elucidate the antifungal mechanisms of action for the two ketones, revealing the biological potential of 2-undecanone and 2-nonanone in managing WNS in bats. Our transcriptomic analysis indicates that these ketones significantly inhibit the spore germination of Pd and cause damage to its hyphal structures. Specially, they induce lesions in the cell wall and membrane of Pd, disrupting its stability by affecting rRNA modifications and interfering with ribosome assembly. Additionally, we observed that 2-undecanone affects enzymes involved in the TCA cycle, thereby disrupting energy metabolism by interfering with critical metabolic pathways in aerobic organisms. Furthermore, 2-nonanone directly damages the DNA of Pd, prompting the activation of DNA damage repair mechanisms in response to stress. This study provides a theoretical basis for exploring novel antifungal strategies targeting Pd, suggesting that ketones may serve as potential in vitro defense and control tools, laying the groundwork for the subsequent development of efficient fumigants. Future studies are needed to evaluate the efficacy, safety, and effects of ketones on host-pathogen interactions in complex biological environments, including bat infection models and field simulations.

Funding Statement

This work was supported by the National Natural Science Foundation of China [grant numbers 32171525 and 31961123001], Jilin Provincial Natural Science Foundation [grant number 20220101291JC] and Jilin Provincial Department of Education [grant number JJKH20241421KJ].

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

All raw sequence data have been deposited in the NCBI (PRJNA1177599). The datasets generated and analyzed during the current study are available in the Figshare repository (available at: https://doi.org/10.6084/m9.figshare.27367188).

Supplementary Information

Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2025.2569627