IRF6 C-terminal phosphorylation links inflammation and cell–cell adhesion in oral keratinocytes: implications for oral lichen planus

Abstract

Background

Oral Lichen Planus (OLP) is classified by the World Health Organization as an Oral Potentially Malignant Disorder (OPMD). OLP is characterized by chronic inflammation, which may contribute to its malignant transformation. In this study, we examined whether Interferon Regulator Factor 6 (IRF6), a key regulator of immune responses and epithelial homeostasis, modulates inflammation in oral keratinocytes via Toll-Like Receptor 2 (TLR2). This regulation may contribute to the malignant transformation of OLP.

Methods

Primary Human Oral Keratinocytes (HOKs) were exposed to lipopolysaccharide (LPS) and fibroblast-stimulating lipoprotein (FSL-1) to activate TLR signaling. To assess the transcriptional and post-transcriptional effects of IRF6, HOKs were transfected with constructs expressing wild-type IRF6, a C-terminal phosphomimic variant (hIRF6-DDD), or a phospho-inhibitory variant (hIRF6-AAA). RT-qPCR was performed to evaluate gene expression of TLR signaling components and immuno-cytochemistry (ICC) was used to assess the localization of cell adhesion proteins.

Results

Our results indicate that, in HOKs, the phosphorylation state of the IRF6 C-terminus modulates adherens junctions, influences IRAK1 colocalization, and regulates CCL5 expression—a chemokine essential for T-cell recruitment in epithelial tissue.

Conclusions

These findings suggest that post-translational modification of IRF6 is a key regulator of immune homeostasis in the oral epithelium, priming epithelial cells to initiate an immune response upon loss of epithelial integrity and bacterial adhesion.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12865-025-00757-w.

Background

Oral Lichen Planus (OLP) is a chronic inflammatory autoimmune mucocutaneous disease that affects the stratified squamous epithelium of the oral mucosa [1]. OLP has a global prevalence of 0.49–1.43% in the adult population with a female predominance ratio of 2:1 [2, 3]. Clinically, OLP manifests in three forms: reticular/papular/plaque-like lesions, erythematous lesions, and ulcerative lesions [3]. The World Health Organization classifies OLP as a potentially malignant oral disorder (OPMD) with an estimated 1.1% risk of malignant transformation [4, 5].

Despite extensive research, the precise mechanisms underlying OLP remain unclear, likely due to its complex pathophysiology involving both innate and adaptive immune responses [6]. OLP is generally considered a T cell-mediated hypersensitivity reaction, but the exact role of these cells remains incompletely understood [7]. Furthermore, the involvement of oral keratinocytes and the innate immune response in this process is poorly characterized. It is hypothesized that an unidentified exogenous antigen, autoantigen, or superantigen triggers an inflammatory response in the oral epithelium, leading to basal epithelial keratinocyte apoptosis and chronic inflammation [8].

Oral epithelial cells serve as the primary interface between the host and the external environment, playing a crucial role in defense mechanisms. Beyond their physical barrier function, these cells express pattern recognition receptors (PRRs) such as Toll-like receptors (TLRs), allowing them to actively participate in immune defense as frontline sentinels [9, 10]. TLRs are essential for detecting pathogens and orchestrating the host response, regulating the balance between pro- and anti-inflammatory signaling [11]. Specifically, TLRs activation triggers the production of inflammatory cytokines, chemokines, and type I interferons (IFNs) in epithelial cells, enabling oral keratinocytes to regulate immune responses. This process is largely mediated by the TLR-dependent signaling pathways, which differentially engage adapter proteins such as MyD88 and TRIF [12] and activate Interleukin-1 receptor-associated kinase 1 (IRAK1) leading to the induction of NFκB and Interferon Regulatory Factors (IRFs) [13].

One key member of this Interferon Regulatory Factor family is IRF6, which is not only implicated in inflammation but also plays a critical role in epithelial proliferation, differentiation, and junctional assembly [14]. Within this framework, we propose that IRF6, downstream of TLR2, as part of the MyD88-IRAK1 pathway, modulates inflammatory cytokine production in oral keratinocytes [15]. Previously, Kwa et al., 2014 found that IRF6, at least in part, controls the expression of CC chemokine Ligand 5 (CCL5), a key mediator of T cell recruitment and inflammation [16]. Huynh et al., 2016 subsequently demonstrated that IRF6 regulates IL-36γ expression in human oral epithelial cells, a cytokine known to activate multiple innate immune cells and contribute to mucosal inflammation [17]. More recently, Pham et al., 2025 reported that IRF6 modulates the expression of additional inflammatory cytokines, including IL-1β, IL-6, IL-17A, and IL-22, in salivary acinar cells in the context of Sjögren’s syndrome [18].

Given this dual role in immune regulation and inflammation, IRF6 may be a pivotal factor in the chronic inflammation and hypersensitivity seen in OLP patients, processes that are closely linked to its malignant potential.

To further investigate the role of IRF6 phosphorylation in this signaling cascade, we engineered mutant IRF6 constructs with altered phosphorylation states at three key serine residues in its C-terminus. Phosphorylation of these C-terminal serines has previously been identified as essential to the function of IRF6, mainly to the function of its protein binding domain as well as its transcriptional activity and nuclear translocation, via phosphorylation of these C-terminal serine residues [16, 19, 20]. Using a primary human oral keratinocyte (HOK) culture model, we assessed how these IRF6 modifications influence TLR-mediated cytokine production, with a particular focus on its role in shaping the chronic inflammatory environment characteristic of OLP. Our findings provide new insights into how IRF6 contributes to inflammation-driven epithelial dysregulation, potentially influencing the progression and malignant transformation of OLP.

Methods

Cell culture of human oral keratinocytes (HOKs)

Primary human oral keratinocytes (HOKs) (ScienCell, Cat #2610) were cultured in Oral Keratinocyte Medium (Science Cell, Cat #2611) supplemented with keratinocyte growth supplement (Science Cell, Cat. # 2652) (basal calcium concentration 0.12 mM). Differentiation was induced by adding CaCl₂ to the culture medium at a final concentration of 1.2 mM for 24 h. HOKs were stimulated with TLR agonists, lipopolysaccharide (LPS Sigma-Aldrich, cat #L2630) or fibroblast-stimulating lipoprotein1 (FSL-1, Invivogen, Cat # tlr-fsl), at a concentration of 100 ng/ml, and cells were analyzed at 2- and 24-h post-stimulation.

Expression vectors and transfection

The full-length human IRF6 (hIRF6) cDNA was cloned into the pcDNA-DEST53 vector (Invitrogen) for expression in HOKs, with the in-frame C-terminal GFP used to detect transfected cells. Three variants of this expression vector were generated: wild-type hIRF6 (pcDNA_DEST53_hIRF6_WT) and two constructs each targeting three key serine residues located in the C-terminal region that were previously found to be critical for protein interactions and activation of IRF6 (16,19–20). The first of these two constructs was a phosphomimic variant of hIRF6 (pcDNA_DEST53_hIRF6_DDD), in which serines at positions 413, 418, and 424 were substituted with aspartic acid (DDD) to mimic the phosphorylated state. The second was a phospho-inhibitory variant of hIRF6 (pcDNA_DEST53_hIRF6_AAA), in which the same serines were replaced by alanine (AAA) to mimic the dephosphorylated state. Expression constructs were transfected into HOKs using the Invitrogen™ Neon™ Electroporation System (Invitrogen), with optimized parameters: 1600 V, 10 ms pulse width, and 3 pulses for both 10 µL and 100 µL tips at 8 × 10⁶ cells/mL and 1 × 10⁷ cells/mL respectively.

Immunocytochemistry (ICC) and Western analysis

HOKs were seeded in µ-Slide 8-well chambers (Ibidi, Cat #80806). For transfection experiments, cells were transfected and incubated overnight to allow attachment. Once attached, HOKs were cultured with or without stimulation for the duration(s) specified in the Results section. Where appropriate, differentiated cells were treated with 1 µg/mL cycloheximide (Sigma-Aldrich, Cat #C7698) for 2 h to inhibit new protein synthesis and induce cell cycle arrest. Cells were fixed with 4% paraformaldehyde for 10 min, then permeabilized with 0.1% Triton™ X-100 for 10 min. Blocking was performed with 2% bovine serum albumin (BSA) for 1 h at room temperature. The following primary antibodies were used for immunostaining: anti-E-Cadherin (BD Biosciences, Cat #610182)(1:100), anti-CCL5 (Invitrogen, Cat #710001)(1:250), anti-IRAK1 (Santa Cruz, Cat #SC-5288) (1:50), anti-ERP29 (Invitrogen, Cat #PA3-011)(1:500), and anti-IRF6 (Genetex, Cat #GTX104862)(1:500) (only used on non-transfected cells). These were incubated overnight at 4°C. The next day, the corresponding secondary antibodies, Alexa Fluor 568 anti-mouse (Invitrogen, Cat #A-11004)(1:1000), Alexa Fluor 568 anti-rabbit (Invitrogen, Cat #A-11036) 1:1000, or Alexa Fluor 488 anti-rabbit (Invitrogen, Cat #A-11008) 1:1000 were incubated for 1 h at room temperature along with DAPI (Thermo Fisher, Cat #D1306) for nuclear staining. Cells were washed three times with PBS, and fluorescent images were acquired using a Leica Stellaris Confocal Microscope. Image processing and analysis were conducted using LAS X software (version 4.6.1.27508).

For Western analysis, cells were washed twice with PBS, and protein was extracted using 50 µL of lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris, pH 8.0) supplemented with 1 × protease inhibitor cocktail (Roche, 11836170001). The lysates were centrifuged at 14,000 rpm for 10 min to remove insoluble cellular debris. Protein was quantified by BCA Protein Assay (Pierce) and normalized. Immuno analysis of whole cell lysate eluate was performed and quantified using capillary electrophoresis on a Wes Simple Western (ProteinSimple) automated platform using the following antibodies: anti-IRF6 (Cell Signaling, Cat #6948) (1:50) & B-actin (Cell Signaling, Cat #4970) (1:1000) and an HRP-conjugated secondary antibody of the appropriate species (ProteinSimple). Experiments were repeated in full 3 times.

Image quantification

Cell size and fluorescence intensity were measured using Fiji software [21]. Co-localization analysis was performed using the JACoP plugin in Fiji [22], which included the calculation of the Pearson correlation coefficient [23] and Manders’ overlap coefficient [24].

RNA extraction and reverse transcription and quantitative PCR (RT-qPCR)

Total RNA was extracted and purified from cells using the RNeasy Mini Kit (Qiagen, Germany), according to the manufacturer's instructions. RNA yield and purity were assessed using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). Reverse transcription was performed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Cat #4,368,814). Primers were designed and validated for target specificity using nBLAST (https://blast.ncbi.nlm.nih.gov/; see Table 1). cDNA amplification was performed using the SYBR™ Green Universal Master Mix (Thermo Fisher Scientific, Cat 4309155). Reactions were run on a StepOnePlus™ Real-Time PCR System (Fisher Scientific, Cat #15320855). Product sizes were verified by electrophoresis, and relative gene expression was calculated using the ΔΔCt method [25].

Table 1.

Primer sequences

Gene	Forward Sequence (5’ → 3’)	Reverse Sequence (5’ → 3’)
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA
IRF6	CCCCAGGCACCTATACAGC	TCCTTCCCACGGTACTGAAAC
NFKβ1	GCAGCACTACTTCTTGACCACC	TCTGCTCCTGAGCATTGACGTC
CCL5	CCTGCTGCTTTGCCTACATTGC	ACACACTTGGCGGTTCTTTCGG

Statistical analysis

Statistical analyses were performed using GraphPad Prism version 8.01 (La Jolla, CA, USA). Normality was assessed using the Shapiro–Wilk test, and homoscedasticity was evaluated using the Levene test. Non-parametric data were analyzed using the Mann–Whitney U or Kruskal–Wallis tests, and parametric data were analyzed using student’s t-test or ANOVA. The median, mean, and standard error of the mean (SEM) were calculated for all comparisons. A p-value of < 0.05 was considered statistically significant.

Results

IRF6 expression is significantly upregulated during HOK cell differentiation

Immunocytochemistry was used to visualize endogenous IRF6 and E-Cadherin localization in non-transfected HOKs (Fig. 1A-B). Following 24-h differentiation induction, cells exhibited increased size (Fig. 1C-D) and organized into multilayered structures. These morphological changes were also evident in unstained cells (Supplementary file 1, Supplementary Fig. 1). Concomitantly, this morphological change was accompanied by a significant increase in IRF6 expression throughout the cytoplasm, as confirmed by elevated IRF6 mRNA levels (Fig. 1E) and IRF6 protein levels (Fig. 1F-G). These results are consistent with the previously described role of IRF6 in keratinocyte differentiation.

Fig. 1.

Role of IRF6 in differentiation of HOKs. Immunocytochemistry was performed to visualize IRF6 (green) and E-Cadherin (red) localization in HOKs following differentiation induced by 1.2 mM CaCl₂. Cells were analyzed 24 h post-stimulation. A-B Representative images of non-transfected HOKs in their undifferentiated A and differentiated B states, highlighting morphological differences. C-D Quantification of nuclear and cytoplasmic areas using ImageJ in undifferentiated and differentiated HOKs. E Relative mRNA expression levels of IRF6 in undifferentiated and differentiated non-transfected HOKs determined by RT-qPCR. F-G Protein expression levels of IRF6 in undifferentiated vs differentiated HOKs assessed by Western analysis. *All graphical data are presented as mean ± SEM, (n = 3), with significance indicated by * p < 0.05, ** p < 0.005 and *** p < 0.0005

Differentiation enhances the inflammatory response in HOK cells

To determine whether IRF6 expression is further induced by TLR2/4 stimuli, differentiated and undifferentiated HOKs were stimulated with LPS and FSL-1, mRNA and protein levels were analyzed at 2- and 24-h post-stimulation. NFκB was used as a control for mRNA activation. Although notably higher IRF6 protein levels were seen in differentiated HOKs than in undifferentiated cells, these levels did not significantly change with stimulation, after normalization to β-actin (Fig. 2A–B). In undifferentiated cells, IRF6 mRNA levels also remained unchanged at 2 h post-stimulation (Fig. 2C). In contrast, differentiated HOKs showed a small but significant increase in IRF6 expression in response to stimulation, particularly with FSL-1 (Fig. 2D), suggesting that differentiation may prime enhances the inflammatory responsiveness of HOKs.

Fig. 2.

Inflammatory response of differentiated HOKs. HOKs were differentiated using 1.2 mM CaCl₂ for 24 h and subsequently stimulated with 100 ng/ml of LPS or FSL-1 for 2 h. Gene expression levels were quantified using RT-qPCR and normalized to GAPDH expression. A-B IRF6 protein expression in response to LPS and FSL-1 stimulation in undifferentiated and differentiated HOKs. C-D Relative mRNA expression levels of IRF6 and NFKβ1 in undifferentiated C and differentiated D HOKs following LPS or FSL-1 stimulation, demonstrating the effect of differentiation on inflammatory gene induction. *All graphical data are presented as mean ± SEM, (n = 3), with significance indicated by indicated by * p < 0.05, ** p < 0.005 and *** p < 0.0005

IRF6 phosphorylation influences its localization and cell–cell adhesion

To investigate the role of IRF6 phosphorylation in HOK differentiation, cells were transfected with one of three GFP-tagged IRF6 variants (wild type, phosphomimic, and phospho-inhibitory) and treated with CaCl₂ (1.2 mM) for 24 h to induce differentiation. Cells expressing wild-type IRF6 (hIRF6-WT) or the phosphomimic IRF6 (hIRF6-DDD) exhibited well-defined cell–cell junctions, as indicated by E-Cadherin staining (shown in red in Fig. 3A-B). In contrast, cells expressing the phospho-inhibitory IRF6 variant (hIRF6-AAA) displayed irregular and less mature junctions with elongated, non-uniform E-Cadherin staining (Fig. 3C). Quantification of E-Cadherin fluorescence intensity confirmed that junctional staining was significantly reduced in hIRF6-AAA-expressing cells compared to those expressing hIRF6-WT and hIRF6-DDD (Fig. 3D). These results demonstrate that IRF6 phosphorylation plays a critical role in maintaining epithelial cell–cell adhesion. Although differences in fluorescence intensity might suggest variable transfection efficiency, this possibility was ruled out by quantitative PCR using Cycle3-GFP as a reporter (Supplementary file 1, Supplementary Table 1). The results confirmed comparable mRNA expression levels for all three IRF6 construct.

Fig. 3.

Role of IRF6 in HOKs junctions. Immunocytochemistry was performed to visualize E-Cadherin (red) localization in differentiated HOKs transfected with various hIRF6 constructs (green). Cells were analyzed 24 h post-stimulation A-C Representative images of HOKs transfected with wild-type IRF6 (hIRF6-WT) A, phosphomimic IRF6 (hIRF6-DDD) B and phospho-inhibitory IRF6 (hIRF6-AAA) C, demonstrating the impact of IRF6 phosphorylation on cell–cell junction formation. D Quantification of E-Cadherin fluorescence intensity at cell–cell junctions in transfected HOKs analyzed using ImageJ. *All graphical data are presented as mean ± SEM, (n = 3), with significance indicated by indicated by * p < 0.05, ** p < 0.005 and *** p < 0.0005

Phosphomimic hIRF6 enhances perinuclear colocalization with IRAK1, amplified by cell cycle arrest

To investigate potential interactions between IRF6 and TLR signaling, immunocytochemistry was performed to assess the localization of IRAK1, a key downstream effector of TLR signaling, in HOKs transfected with the different IRF6 variants. In cells expressing hIRF6-WT, IRAK1 displayed a perinuclear distribution and showed moderate colocalization with IRF6 (Fig. 4A), as indicated by a Pearson’s correlation coefficient of 0.59. In contrast, cells transfected with hIRF6-AAA exhibited a more uniform cytoplasmic distribution of IRF6 and exhibited minimal overlap with IRAK1 (Fig. 4C; Pearson’s coefficient 0.4). Notably, cells expressing hIRF6-DDD demonstrated stronger perinuclear colocalization with IRAK1(Fig. 4B), reflected by a higher Pearson’s coefficient of 0.70. These findings suggest that IRF6 C-terminal phosphorylation directly impacts the localization of IRAK1, potentially modulating the strength of TLR signaling.

Fig. 4.

Phosphomimic hIRF6-DDD enhances perinuclear colocalization with IRAK1 in differentiated HOKs, amplified by cell cycle arrest. Immunocytochemistry was performed to assess the localization of IRAK1 (red) A-C in differentiated HOKs transfected with various hIRF6 constructs (green). Quantitative colocalization analysis using JACoP included Pearson’s and Manders’ coefficients, scatter plots, and correlation coefficients to evaluate the interaction between IRAK1 and hIRF6 A-C. HOKs transfected with wild-type hIRF6 (hIRF6-WT) A exhibited significant perinuclear colocalization of IRAK1 and hIRF6, a phenomenon that was further enhanced in cells transfected with the phosphomimic hIRF6 variant (hIRF6-DDD) B, as indicated by prominent colocalization signals. In contrast, cells transfected with the phospho-inhibited hIRF6 variant (hIRF6-AAA) C displayed a more diffuse cytoplasmic distribution of hIRF6 with minimal colocalization with IRAK1, suggesting a weaker interaction between these two proteins. D-F To further investigate the subcellular localization of hIRF6, immunocytochemistry was performed to assess its relationship with the endoplasmic reticulum (ER) marker ERP29 (red) in differentiated HOKs transfected with various hIRF6 constructs and subsequently treated with cycloheximide to induce cell cycle arrest. Wild-type hIRF6 D and the phosphomimic hIRF6-DDD E exhibited close but distinct localization with ER vesicles, whereas the phospho-inhibited hIRF6-AAA F showed a diffuse cytoplasmic distribution with minimal aggregation. Magnified views of the boxed regions in D-F highlight ERP29 localization (right) and its overlap with hIRF6 fluorescence (left), emphasizing the spatial relationship between hIRF6 and ER vesicles. D-F Arrows indicate areas of mutually exclusive fluorescence between hIRF6 (green) and ERP29 (red), suggesting potential interaction with ER compartments. Pearson coefficient was performed, (n = 3)

To further investigate the perinuclear localization of IRF6, HOKs were transfected, differentiated, and treated with cycloheximide (1 µg/mL) for 2 h to inhibit new protein synthesis and induce cell cycle arrest. Under these conditions, perinuclear aggregation of IRF6 was markedly increased in cells expressing hIRF6-WT and hIRF6-DDD (Fig. 4D-E). These IRF6 aggregates were found to be closely associated with the ER marker ERP29, though complete colocalization was not observed. In contrast, cells expressing hIRF6-AAA displayed a diffuse cytoplasmic distribution of IRF6, with minimal aggregation (Fig. 4F). These observations highlight the critical role of IRF6 phosphorylation in perinuclear organization, which may, in turn, influence cellular signaling dynamics, intracellular vesicle trafficking, and/or secretion.

Phosphorylation of IRF6 significantly upregulates CCL5 mRNA expression in differentiated HOK cells

Given that CCL5 has been identified as a transcriptional target of IRF6 [17] and it also plays an important role in TLR2 signaling, CCL5 expression was measured following the stimulation of HOKs with FSL-1 and LPS. A specific response to FSL-1 was observed in differentiated HOKs (Fig. 5A). Further analysis revealed that CCL5 expression was significantly higher in cells transfected with hIRF6-DDD compared to cells transfected with either the hIRF6-WT and hIRF6-AAA constructs (Fig. 5B), suggesting that phosphorylation-activated IRF6 enhances the transcriptional activation of CCL5.

Fig. 5.

Phosphorylated IRF6 Enhances CCL5 Expression and Promotes Its Nuclear Localization in HOKs. HOKs were differentiated using 1.2 mM CaCl₂ for 24 h and subsequently stimulated with 100 ng/ml of LPS or FSL-1 for 2 h. Gene expression levels were quantified using RT-qPCR and normalized to GAPDH expression. A-B mRNA expression of CCL5 in non-transfected A and hIRF6-transfected B HOKs under identical stimulation conditions, highlighting the role of IRF6 in modulating the inflammatory response. *All graphical data are presented as mean ± SEM, (n = 3), with significance indicated by indicated by * p < 0.05, ** p < 0.005 and *** p < 0.0005. Immunocytochemistry was performed to assess the subcellular localization of CCL5 (red) in differentiated HOKs transfected with various hIRF6 constructs (green). C HOKs transfected with wild-type hIRF6 (hIRF6-WT) exhibit predominantly cytoplasmic localization of CCL5. D HOKs transfected with the phosphomimic hIRF6 variant (hIRF6-DDD) show prominent nuclear translocation of CCL5, indicating a potential regulatory role of IRF6 phosphorylation in CCL5 nuclear localization. E HOKs transfected with the phospho-inhibited hIRF6 variant (hIRF6-AAA) exhibit limited nuclear localization of CCL5, suggesting that phosphorylation of IRF6 may be necessary for facilitating CCL5 nuclear translocation

Phosphomimic hIRF6 promotes CCL5 nuclear translocation

To assess CCL5 localization, immunocytochemistry was performed in HOKs transfected with IRF6 variants. In cells expressing hIRF6-WT or the phospho-inhibited hIRF6-AAA variant, CCL5 protein was predominantly cytoplasmic. However, in cells expressing the phosphomimic hIRF6-DDD, CCL5 exhibited nuclear localization (Fig. 5C-E), suggesting that phosphorylated IRF6 plays a role in modulating CCL5 localization and function during inflammatory responses.

Discussion

This work highlights a previously unrecognized role for IRF6 phosphorylation in coordinating keratinocyte differentiation, epithelial integrity, and inflammatory responses. These findings have important implications for understanding the immune mechanisms underlying OLP and other oral inflammatory diseases.

IRF6 has been extensively investigated for its role in epithelial and keratinocyte differentiation and has been implicated in various craniofacial disorders secondary to disruption of a post-transcriptional role in the maintenance of cell–cell junctions [14, 19]. However, its functional activation, via phosphorylation, in epithelial homeostasis and immune regulation remain less understood. In this study, we show that in addition to its significant upregulation during the differentiation of human oral keratinocytes, the phosphorylation state of the IRF6 C-terminus also regulates both the maintenance of cell–cell junction integrity and enhances TLR2 signaling via both transcriptional and post-transcriptional roles. Specifically, compared to cells expressing wildtype IRF6, cells expressing the phospho-inhibitory version of IRF6 (hIRF6-AAA) were found to have less mature junctional complexes and were compromised in their ability to activate CCL5 both at the transcriptional and post-transcription levels. In contrast, the phosphomimic version of IRF6 (hIRF6-DDD) maintained junctional integrity and appeared to significantly amplify the inflammatory potential of oral keratinocytes, as evidenced by the increased mRNA expression and nuclear localization of CCL5 following FSL-1-mediated TLR2 activation. Taken together, these data support the notion that IRF6 functions to maximize the TLR2 signaling response and help strengthen (or reinforce) epithelial adhesion, providing a dual mechanism against epithelial attachment and infection by pathogenic bacteria. Conversely, reduced IRF6 function or activation may limit both the epithelial barrier function and the inflammatory response following bacterial adhesion.

Recent studies have linked microbial dysbiosis in OLP patients to the progression of the disease [26, 27] with certain pathogenic microorganisms interacting with the TLR2 pathway to exacerbate inflammatory responses. It is therefore tempting to speculate that common variants in IRF6, which are known to impact its function and increase risk of orofacial clefting may also compromise the inflammatory response to oral pathogens. Consistent with this is the reported increased bacterial colonization of the oral cavity of Irf6 knockout mice and the consequent marked elevation of both dental caries and periodontitis-associated alveolar bone loss [28].

These findings are consistent with earlier work by Kwa et al. (2014) [16], who demonstrated that IRF6 is a downstream effector of the TLR2–IRAK1 pathway. In their study, co-immunoprecipitation experiments confirmed that IRF6 physically interacts with IRAK1, and that its activation is dependent on MyD88 and IRAK1, but not on TRIF or TBK1 [29]. Furthermore, they showed through gene silencing and promoter reporter assays that IRAK1 mediates TLR2-induced CCL5 expression at least in part via IRF6 activation. This suggests that IRF6 is not only regulated by TLR signaling but is also required for full transcriptional activation of CCL5 in epithelial cells.

Our study builds on this prior evidence showing that IRF6 phosphorylation impacts TLR pathway protein interactions and cellular signaling [16, 19, 20]. Here, we provide further evidence that C-terminal phosphorylation of IRF6 also determines its subcellular localization, its influence on signaling pathway responses, and the regulation of cytokine production. In this regard, the regulation of CCL5 is particularly significant, given its role in recruiting T cells and mediating chronic inflammation [30]. Furthermore, increased levels of CCL5 have been seen in OLP patients [31, 32]. For example, Shan et al. (2019) demonstrated upregulation of the CCL5–CCR5 axis in OLP lesions [32], while Zhang et al. (2022) showed that CCL5 produced by FAP-α⁺ immunofibroblasts promotes CD4⁺ T-cell infiltration in OLP [33]. In addition, in a 3D in vitro OLP model of oral mucosa, the induction of CD4 + and CD8 + T cells, and cytokines such as IFN gamma and TNFα, generated an increase in CCL5 protein production [34].

In this study, we also observed CCL5 nuclear localization in hIRF6-DDD-transfected cells, suggesting a compelling regulatory mechanism that may amplify or sustain inflammatory signaling during epithelial injury. Although the ability of CCL5 to internalize into the nucleus was previously reported in endothelial cells [35] this is the first time it has been shown in oral keratinocytes in an inflammatory context. The exacerbated inflammatory response in hIRF6-DDD-expressing cells aligns with previous studies linking CCL5 to enhanced T cell activation and recruitment in OLP lesions, which may contribute to a chronic inflammatory microenvironment [36] and the progression of OPMDs to oral cancer [37]. While OLP is classified as a potentially malignant disorder, its transformation rate is notably low [4, 38], and its malignant potential remains a subject of debate [38–40]. Chronic inflammation is widely recognized as a key driver of malignant transformation [37, 41]; however, CCL5 has also been identified as an immune-protective factor, playing a pivotal role in immune surveillance in solid tumors [42]. This dual role of CCL5 may provide insight into the relatively low malignant transformation rate observed in OLP. The role of IRF6 in modulating epithelial adhesion strength may further contribute to the tumorigenic potential of OPMDs by influencing metastatic properties of dysplastic epithelial cells.

The interplay between IRF6 and TLR2 signaling offers new insights into how keratinocytes orchestrate immune responses during chronic inflammation. Given the central role of oral keratinocytes in immune homeostasis, targeting IRF6 phosphorylation status may represent a promising therapeutic avenue to help restore epithelial integrity and reduce inflammation, potentially preventing disease progression in OLP and other inflammation-related disorders. Given the complex immune landscape of OLP and its malignant potential, our study provides a valuable model for investigating the contributory role of oral keratinocytes and IRF6 and its interaction with the TLR2 pathway in chronic oral inflammation.

Conclusions

This study shows that IRF6 plays a pivotal role in the differentiation and inflammatory response of HOK cells that may have implications for our understanding of the mechanisms leading to OLP and potentially in other chronic oral inflammatory conditions. Our findings demonstrate that IRF6 phosphorylation significantly impacts its subcellular localization, influencing cell–cell adhesion and cytokine responses via the TLR2 pathway. Notably, the phosphomimic IRF6-DDD variant promoted CCL5 nuclear translocation and enhanced perinuclear colocalization with IRAK1, highlighting the likely role of IRF6 phosphorylation in inflammatory signaling in oral keratinocytes.

Based on our findings, we propose a model in which IRF6, in conjunction with TLR2 activation, regulates pro-inflammatory cytokines such as CCL5, contributing to the chronic inflammation observed in OLP. While preliminary, these results provide a framework for further investigations into OLP pathophysiology and TLR signaling in the oral mucosa. Additionally, our findings may inform future therapeutic strategies aimed at modulating IRF6 phosphorylation to restore epithelial homeostasis and reduce inflammation in OLP and related disorders.

Limitations

This study was conducted using an in vitro model of primary human oral keratinocytes (HOKs), which, although more physiologically relevant than immortalized cell lines, cannot fully replicate the complexity of the in vivo oral mucosal environment. Furthermore, while our findings suggest a role for phosphorylated IRF6 in regulating CCL5 expression and localization, processes relevant to chronic inflammation, the conclusions drawn regarding oral lichen planus (OLP) are based on correlations with previously published patient data. No direct analyses were performed using patient-derived tissue samples or in vivo models of OLP in this study. Therefore, although our results offer novel mechanistic insight into the role of IRF6 in keratinocyte-driven inflammation, further validation in patient samples and disease models will be essential to confirm the relevance of these findings to OLP pathogenesis.

Abbreviations

OLP

Oral lichen planus

OPMD

Oral potentially malignant disorder

IRF6

Interferon regulator factor 6

TLR2

Toll-like receptor 2

IRAK1

Interleukin-1 receptor-associated kinase 1

HOKs

Primary human oral keratinocytes

LPS

Lipopolysaccharide

FSL-1

Fibroblast-stimulating lipoprotein

PRRs

Pattern recognition receptors

CCL5

CC chemokine ligand 5

Authors’ contributions

Y.A.O–O: Experimental design and execution, data collection and analysis, manuscript writing and editing. M.T.P-S: Project conception, experimental design, data analysis, supervision, manuscript writing, and editing. L.L.C: Experimental design and execution, manuscript editing. T.C.C: Project conception, experimental design, data analysis, supervision, manuscript writing, and editing.

Funding

Stowers Family Endowment for Dental & Mineralized Tissue Research (TCC), Leica Stellaris 8 confocal microscope—grant# S10OD032373 (TCC), Comité para el Desarrollo de la Investigación (CODI), Universidad Antioquia 2020–33856 (MTPS).

Data availability

The raw data generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.