Simultaneous detection of canine astrovirus and canine kobuvirus by duplex qPCR: validation and evidence of extraintestinal viral RNA in naturally infected dogs

Abstract

Canine astrovirus (mamastrovirus 5 [MAstV5], formerly CaAstV; family Astroviridae, taxon species Mamastrovirus canis) and canine kobuvirus (aichivirus A2 [AiV-A2], formerly CaKoV; Picornaviridae, Kobuvirus aichi) are emerging enteric viruses increasingly detected in both diarrheic and subclinical dogs. Although primarily associated with gastrointestinal illness, recent evidence suggests a potential for systemic dissemination, which remains insufficiently explored. To improve detection, we developed and validated a duplex quantitative real-time PCR (dqPCR) assay for simultaneous identification of MAstV5 and AiV-A2. Primers and TaqMan probes were designed based on conserved regions of the MAstV5 ORF1b and AiV-A2 3D polymerase genes. Assay optimization included primer-probe concentration titration and thermal gradient analysis. Analytical performance was assessed using synthetic plasmid standards and RNA from non-target viruses, including canine parvovirus (CPV), canine morbillivirus (CDV), and canine enteric coronavirus (CCoV). Our dqPCR assay had high linearity (R² > 0.99) and sensitivity, with limits of detection of 10 copies/μL for MAstV5 and 100 copies/μL for AiV-A2. No cross-reactivity or interference was observed in coinfection simulations across various target ratios. Intra- and inter-assay CV values were <2.2%, indicating excellent reproducibility. Validation using 50 clinical rectal swabs and tissue samples from 25 autopsied dogs revealed 1 additional AiV-A2–positive case undetected by RT-PCR but confirmed by sequencing. Importantly, viral RNA was also found in extraintestinal tissues—spleen, liver, trachea, and mesenteric lymph nodes—suggesting systemic distribution in naturally infected dogs. Our dqPCR assay provides a sensitive, specific, and efficient tool for the detection of MAstV5 and AiV-A2, supporting both clinical testing and epidemiologic studies.

Canine astrovirus (mamastrovirus 5 [MAstV5], formerly CaAstV; family Astroviridae, taxon species Mamastrovirus canis [https://ictv.global/report/chapter/astroviridae/astroviridae]) and canine kobuvirus (aichivirus A2 [AiV-A2], formerly CaKoV; Picornaviridae, Kobuvirus aichi [https://ictv.global/report/chapter/picornaviridae/picornaviridae/kobuvirus]) are emerging viral agents increasingly detected in domestic dogs worldwide. Canine kobuvirus was formerly abbreviated as CaKoV.^3,7,10,14 Both viruses are small (~30 nm), non-enveloped, positive-sense, single-stranded RNA viruses. Although frequently detected as part of the canine enteric virome, their biological behavior and pathogenic roles remain incompletely understood.

MAstV5 has been detected in both diarrheic and subclinical dogs across diverse regions, including China, Korea, Japan, Italy, France, Brazil, and Hungary.^{1,16,17,24,32} Similarly, AiV-A2 was initially reported in the United States and later identified in the United Kingdom, Italy, Korea, China, Thailand, and Brazil.^{4,5,9,11,18,20} While both viruses are frequently detected in fecal samples from diarrheic dogs, their occurrence in subclinical animals raises questions about their clinical relevance and pathogenic potential.

Several studies have reported coinfections involving MAstV5 or AiV-A2 alongside other established enteric pathogens, such as canine parvovirus (CPV), canine enteric coronavirus (CCoV), and canine morbillivirus (CDV).^15,20,25 These coinfections may exacerbate disease severity or alter viral replication dynamics, yet the nature of these interactions remains poorly defined. Additionally, the high genetic diversity of MAstV5 and AiV-A2—including frequent recombination and mutation—complicates their detection, classification, and the understanding of their clinical behavior.

Despite their frequent detection in fecal samples, few studies have systematically investigated the tissue distribution or systemic spread of these viruses. For instance, researchers documented the extraintestinal presence of AiV-A2 in the liver and spleen of a puppy, ²³ whereas MAstV5 has rarely been detected beyond the gastrointestinal tract. ¹⁹ Studies in related species, such as pigs and foxes, suggest that kobuviruses and astroviruses may have broader tissue tropism than previously assumed,^6,23 highlighting the need for further exploration in canine hosts.

Molecular surveillance of MAstV5 and AiV-A2 typically relies on conventional RT-PCR or singleplex real-time PCR (rtPCR), which limits detection throughput and efficiency. Given the clinical overlap among enteric viruses and the increasing frequency of coinfections, there is a pressing need for a sensitive, rapid, and multiplex-capable detection tool. Duplex quantitative real-time PCR (dqPCR) offers simultaneous detection of multiple targets within a single reaction, optimizing sample usage, reducing costs, and improving both epidemiologic surveillance and clinical testing.

In response to these gaps, we aimed to develop and validate a dqPCR assay targeting the ORF1b gene of MAstV5 and the 3D polymerase gene of AiV-A2. The assay was evaluated using clinical fecal samples and tissue specimens from autopsied dogs to assess its analytical performance, detection limits, and potential utility in characterizing viral distribution in gastrointestinal and extraintestinal tissues. This molecular platform may enhance detection capabilities and support future research into the pathogenic potential and systemic relevance of MAstV5 and AiV-A2 in canine populations.

Materials and methods

The animal sampling and research protocols for our study were reviewed and approved by the Institutional Animal Care and Use Committee (2231006) and the Institutional Biosafety Committee (2131019) of Chulalongkorn University (Bangkok, Thailand). Approval was also obtained from the Animal Ethics Committee (NLU-220217) of Nong Lam University (Ho Chi Minh City, Vietnam). All procedures were performed in accordance with the relevant guidelines and regulations.

Primer and probe design

Primers and TaqMan probes for the dqPCR assay were designed to specifically amplify conserved regions of the MAstV5 and AiV-A2 genomes. Full-length viral genome sequences were retrieved from GenBank and aligned using MEGA X to identify highly conserved target regions. ¹² The ORF1b gene of MAstV5 (GenBank OR220022) and the 3D polymerase gene of AiV-A2 (PP320363) were selected as target regions.

Initial primer and probe candidates were designed using Primer3 and subsequently validated in silico. ²⁶ Specificity screening was performed via BLASTn against the NCBI non-redundant nucleotide database to exclude off-target amplification, ¹ including potential cross-reactivity with canine host sequences and other canine viruses. Thermodynamic properties, such as melting temperature (Tm), GC content, self-dimerization, hairpin formation, and heterodimer potential, were evaluated using an in silico analysis tool (OligoAnalyzer 3.1; Integrated DNA Technologies). Primer-probe sets exhibiting low ΔG values and minimal secondary structure potential were selected for further assay optimization (Table 1). Specificity of the designs was further verified using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) to confirm absence of cross-reactivity with other known canine enteric pathogens.

Table 1.

Primer and probe sequences used for duplex qPCR detection of canine astrovirus and canine kobuvirus.

Virus	Direction	Sequence, 5′–3′	Genome position	Product size, bp
MAstV5	Forward	GGAGGAAATACCAAAAACTTCAT	3494–3621*	128
	Reverse	CATGGTAGTGGAGAATTGG
	Probe	FAM-TATGTTGAAAATCTGGTCAATCGTACTGTG-BHQ1
AiV-A2	Forward	GTCATCTACGCAACAGAAC	6922–7052†	131
	Reverse	ACTTCATAGATTGTGGACGT
	Probe	HEX-ATCCACCCCTCCTTCATCAGAG-BHQ1

AiV-A2 = aichivirus A2, canine kobuvirus; MAstV5 = mamastrovirus 5, canine astrovirus.

^*Primers and probe were designed based on the available MAstV5 sequence OR220022.

^†Primers and probe were designed based on the available AiV-A2 sequence PP320363.

Standard plasmid construction and quantification

To prepare quantitative standards for the dqPCR assay, synthetic DNA fragments corresponding to the target regions of MAstV5 (ORF1b; GenBank MN882002) and AiV-A2 (3D gene; JQ911763) were commercially synthesized (GeneArt; ThermoFisher). Each fragment was cloned into a plasmid vector and propagated in Escherichia coli. After purification, plasmid DNA concentrations were measured (NanoDrop 2000 spectrophotometer; ThermoFisher), and DNA purity was assessed based on OD260:280 ratios. The number of plasmid copies per microliter (copies/μL) was calculated using the following formula:

$$copynumber=\frac{\left(6.02\times {10}^{23}\right)\times \left(\frac{\mathrm{ng}}{\mu \mathrm{L}}\times {10}^{-9}\right)}{\left(DNAlength\times 660\right)}$$

where 6.022 × 10²³ is the Avogadro number, 660 g/mol is the average molecular weight of a DNA base pair, and the plasmid length includes both the vector backbone and inserted target sequence. ¹³ Standard plasmid stocks were serially diluted 10-fold in nuclease-free water to produce working solutions ranging from 10⁹–10⁰ copies/μL. Aliquots of each dilution were stored at −20°C until use. These standards were used to construct calibration curves for the quantitative evaluation of the duplex assay.

DqPCR assay optimization

We optimized our dqPCR assay (MyGo Mini S real-time PCR instrument, software v.3.6.3; Azura Genomics) to enable efficient and simultaneous detection of both MAstV5 and AiV-A2 targets within a single reaction. Optimization focused on primer and probe concentrations, annealing temperature, and amplification efficiency within the duplex format. Each reaction was performed in a total volume of 20 µL, containing 10 µL of 2× qPCRBIO probe mix (PCR Biosystems), 0.8 µL of variable primer concentrations (0.1–0.9 µM; 0.08–0.72 µmol/reaction), 0.4 µL of probe concentrations (0.1–0.7 µM; 0.04–0.28 µmol/reaction), 1 µL of standard plasmid DNA (104 copies/µL), and RNase-free water. A temperature gradient from 51–61°C was applied to identify the optimal annealing temperature, which maximized amplification efficiency while minimizing nonspecific signals. Amplification quality was assessed based on curve morphology, cycle threshold (Ct) consistency, and endpoint fluorescence intensity.

In addition, systematic titration of primer and probe concentrations was conducted to balance fluorescence signal intensity between the 2 targets and minimize competitive interference. Final assay conditions were selected based on optimal efficiency, specificity, and signal balance, following the MIQE guidelines. ² Standard curves were generated using 10-fold serial dilutions of plasmid DNA, and the concentrations of unknown samples were interpolated from Ct values. Only results with consistent Ct values across triplicates and coefficient of determination (R²) values ≥0.99 were included in the quantitative analysis.

Sample collection, RNA extraction, and cDNA synthesis

We included 50 rectal swab samples, previously screened for MAstV5 and AiV-A2 using conventional RT-PCR and sequencing, ¹⁹ to evaluate the performance of our dqPCR assay. All rectal swab samples were also screened for CPV, CCoV, and CDV using specific PCR or RT-PCR assays, following protocols described previously.^21,22,30 Of these, 25 samples tested positive for MAstV5, AiV-A2, or both; the remaining 25 were negative for both viruses. Additionally, tissue samples were collected from 25 dogs that died naturally due to severe gastrointestinal illness between 2021 and 2023. Autopsies were performed at the Department of Pathology, Faculty of Veterinary Science, Chulalongkorn University (Bangkok, Thailand), and at affiliated veterinary clinics in Ho Chi Minh City, Vietnam. All animals had clinical signs of diarrhea, with or without hemorrhage.

Organ samples collected for analysis included the small intestine, mesenteric lymph nodes (MLNs), spleen, liver, kidneys, lungs, heart, and trachea. Fresh tissue samples were homogenized in AVL buffer (Qiagen) using a TissueRuptor (Qiagen), and the lysates were clarified by brief centrifugation at 12,000 × g for 5 min. From each homogenate, 200 µL of the supernatant was used for RNA extraction using a column-based viral RNA extraction kit (GeneAid), following the manufacturer’s protocol. Complementary DNA (cDNA) synthesis was performed (QuantiNova reverse transcription kit; Qiagen), as described previously. ¹⁹ All cDNA samples were stored at −80°C before dqPCR analysis.

Analytical specificity analysis

The analytical specificity of the dqPCR assay was assessed by testing for potential cross-reactivity with other common canine enteric viruses. Nucleic acid templates from CPV, CDV, and CCoV were obtained from the Center of Excellence in Animal Virome and Diagnostic Development, Faculty of Veterinary Science, Chulalongkorn University, Thailand.^21,22,30 These templates were subjected to dqPCR analysis under the same conditions optimized for MAstV5 and AiV-A2 detection.

Analytical sensitivity analysis

The analytical sensitivity, expressed as the limit of detection (LOD), was determined using 10-fold serial dilutions of plasmid DNA standards containing the target regions of MAstV5 and AiV-A2. Dilutions ranging from 10⁴–10⁰ copies/μL were prepared in nuclease-free water and tested in triplicate to assess reproducibility. The LOD was defined as the lowest concentration consistently detected in ≥95% of replicates, with clear amplification curves and valid Ct values. For each dilution, $\overline{x}$ Ct values and SDs were calculated. Standard curves were constructed by plotting Ct values against the log₁₀ of the input copy number, and amplification efficiencies were calculated from the slope of the linear regression line, in accordance with established qPCR guidelines. ³¹

Reproducibility and precision

The repeatability (intra-assay variability) and reproducibility (inter-assay variability) of the dqPCR assay were assessed using plasmid DNA standards at various concentrations: 10⁸–10² copies/μL for MAstV5, and 10⁸–10³ copies/μL for AiV-A2. Each dilution was tested in triplicate within a single run to assess intra-assay precision, and across 3 independent runs on separate days to evaluate inter-assay precision. Ct values obtained from each run were used to calculate the $\overline{x}$ , SD, and CV, using the formula:

$$\mathrm{CV}\left(\%\right)=\left(\frac{\mathrm{SD}}{\overline{\mathrm{x}}\mathrm{Ct}}\right)\times 100\%$$

Low CVs across all tested concentrations indicated high precision and consistent assay performance, in line with recommended quality thresholds for rtPCR assays.

Interference testing

To evaluate potential amplification interference between MAstV5 and AiV-A2 within the duplex reaction, plasmid mixtures were prepared at various target ratios: 1:1, 1:10, and 10:1 (MAstV5:AiV-A2). Each ratio was tested in triplicate under standard dqPCR conditions. The resulting Ct values and calculated copy numbers obtained from these duplex reactions were compared with those from corresponding monoplex reactions performed under identical conditions. This comparison assessed whether target competition or template-driven suppression affected detection accuracy in coinfection scenarios.

Clinical assay evaluation

To assess the diagnostic utility of the established dqPCR assay, 50 tissue samples—including 25 small intestine and 25 MLN specimens—were collected from autopsied dogs with severe gastrointestinal illness. All tissue samples were also screened for CPV, CCoV, and CDV using specific PCR or RT-PCR assays, following protocols described previously.^19,27 All animals had exhibited severe gastrointestinal signs, including hemorrhagic or watery diarrhea, before death or euthanasia. Samples were obtained between 2021 and 2023 from the Department of Pathology, Faculty of Veterinary Science, Chulalongkorn University, Thailand, and affiliated veterinary clinics in Ho Chi Minh City, Vietnam.

All samples were tested using the optimized dqPCR assay targeting MAstV5 and AiV-A2. For dogs testing positive in either intestinal or MLN tissue, additional organs—including the liver, spleen, kidneys, lungs, heart, and trachea—were further analyzed to investigate the extent of systemic viral distribution.

Statistical analysis

Quantitative data from dqPCR reactions—including Ct values, viral copy numbers, and assay performance metrics, such as standard curve R² values and amplification efficiency—were compiled and analyzed (Excel 2024; Microsoft). Descriptive statistics, including $\overline{x}$ , SD, and CV, were calculated to evaluate intra- and inter-assay precision, as well as consistency across replicates in sensitivity and interference experiments. All performance thresholds were interpreted in accordance with established best practices for rtPCR validation studies.

Results

Optimization and standard curve construction for dqPCR

Our dqPCR assay was successfully optimized for the simultaneous detection of MAstV5 and AiV-A2. Optimal conditions were selected based on 3 key criteria for both targets: the lowest Ct, highest fluorescence intensity, and highest amplification efficiency (Suppl. Table 1). Optimization included testing various primer-probe concentrations and a thermal gradient of 51–61°C. While intermediate temperatures (52–59°C) showed only marginal improvements, an annealing temperature of 60°C consistently yielded the best results, with the lowest Ct values (25.4 for MAstV5, 27.5 for AiV-A2), the strongest fluorescence signals, and the highest amplification efficiencies (88.3% for MAstV5, 79.3% for AiV-A2), as recorded by the MyGo Mini S system. Based on these findings, the final assay conditions included 8 pmol of each primer and 4 pmol of each probe, with an annealing temperature of 60°C. Reactions were performed in a total volume of 20 μL, and fluorescence was monitored using the FAM channel for MAstV5 and the HEX channel for AiV-A2. The optimized assay consistently produced robust and reproducible amplification curves, with no signal detected in the no-template controls.

Quantification performance was evaluated using 10-fold serial dilutions of plasmid standards of 10⁸–10⁴ copies/μL. The standard curve for MAstV5 yielded a slope of −3.64, R² of 0.999, and an amplification efficiency of 88.3%. For AiV-A2, the standard curve had a slope of −3.94, R² of 0.997, and efficiency of 79.3% (Fig. 1). Both targets demonstrated strong linearity across the entire dynamic range of detection.

Figure 1.

Amplification and calibration curves of the duplex quantitative PCR assay for detecting canine astrovirus (MAstV5) and canine kobuvirus (AiV-A2). A. The standard curve for MAstV5 was generated by plotting Ct values (y-axis) against the logarithm of plasmid copy number (x-axis) using 10-fold serial dilutions. B. The standard curve for AiV-A2 was constructed using the same settings as for MAstV5. Both targets had strong linearity and efficient amplification across the tested concentration range.

Sensitivity and specificity of the dqPCR assay

The analytical sensitivity of the dqPCR assay was determined using 10-fold serial dilutions of plasmid DNA standards. The LOD was the lowest concentration in which the target was detected consistently across all replicates. The LOD was 10¹ copies/μL for MAstV5 and 10² copies/μL for AiV-A2 (Table 2). A Ct ≤35, determined using the MyGo Mini software, was used as the cutoff for positivity.

Table 2.

Limit of detection for duplex quantitative PCR targeting canine astrovirus and canine kobuvirus, based on cycle threshold values across serial dilutions.

Copies/µL	Canine astrovirus					Canine kobuvirus
	Ct values				SD	Ct values				SD
	1st	2nd	3rd	$\overline{x}$		1st	2nd	3rd	$\overline{x}$
104	25.3	25.4	25.5	25.4	0.05	27.2	27.7	27.5	27.5	0.21
103	29.0	29.4	29.5	29.3	0.26	30.5	30.1	31.4	30.7	0.64
102	32.2	32.5	33.3	32.7	0.58	33.7	34.1	33.9	33.9	0.22
101	34.5	34.2	35.5	34.7	0.68	ND	ND	ND	ND	ND
100	ND	ND	ND	ND	ND	ND	ND	ND	ND	ND

Ct = cycle threshold; ND = not detected.

The analytical specificity of the assay was evaluated by testing nucleic acid templates from CPV, CDV, and CCoV. No amplification was detected with these non-target viruses, confirming that the primers and probes were highly specific for MAstV5 and AiV-A2. Only the respective targets generated fluorescence signals with their corresponding probe sets (Fig. 2).

Figure 2.

Specificity of the duplex quantitative PCR (dqPCR) assay for detecting canine astrovirus (MAstV5) and canine kobuvirus (AiV-A2). A. The dqPCR assay had specific amplification in the MAstV5 sample, with no amplification observed in other viral samples, including canine parvovirus (CPV), canine morbillivirus (CDV), and canine enteric coronavirus (CCoV). B. Specific amplification was observed only in the AiV-A2 sample, with no amplification detected in CPV, CDV, or CCoV samples.

Repeatability, reproducibility, and interference assessment of the dqPCR assay

The repeatability (intra-assay variation) and reproducibility (inter-assay variation) of the dqPCR assay were evaluated using plasmid standards at 5 concentrations (10⁸–10⁴ copies/μL) for both MAstV5 and AiV-A2. Each concentration was tested in triplicate across 3 independent runs on different days. Intra-assay CVs were 0.15–1.84%; inter-assay CVs were 0.34–2.14% (Table 3). The consistency of Ct values across replicates and runs confirmed the assay’s high precision and operational stability.

Table 3.

Reproducibility of duplex quantitative PCR for detection of canine astrovirus and canine kobuvirus, based on intra- and inter-assay variation in cycle threshold values.

Assay	DNA, copies/μL	Intra-assay			Inter-assay
		$\overline{x}$ Ct	SD	CV, %	$\overline{x}$ Ct	SD	CV, %
MAstV5	108	9.88	0.09	0.91	9.91	0.08	0.81
	107	13.3	0.05	0.38	13.4	0.10	0.75
	106	17.0	0.05	0.29	17.3	0.31	1.79
	105	20.6	0.03	0.15	20.8	0.24	1.16
	104	24.4	0.21	0.86	24.8	0.53	2.14
	102	32.5	0.35	1.08	32.7	0.48	1.47
AiV-A2	108	11.6	0.06	0.52	11.7	0.04	0.34
	107	14.4	0.22	1.53	14.0	0.25	1.79
	106	18.0	0.33	1.84	17.8	0.08	0.45
	105	21.8	0.19	0.87	22.0	0.30	1.36
	104	25.9	0.03	0.12	26.2	0.25	0.95
	103	30.8	0.41	1.33	31.0	0.56	1.80

AiV-A2 = aichivirus A2, canine kobuvirus; Ct = cycle threshold; MAstV5 = mamastrovirus 5, canine astrovirus.

To assess potential amplification interference in the duplex format, we tested 7 plasmid mixtures with various target ratios (10⁸:10⁸–10¹:10⁸ copies/μL of MAstV5 and AiV-A2). All combinations yielded reliable and quantifiable amplification curves for both targets (Table 4). No notable shift in Ct values or reduction in quantification efficiency was observed, confirming that the duplex assay retained high target specificity and was not affected by template competition or signal suppression, even under highly imbalanced conditions.

Table 4.

Interference testing of duplex quantitative PCR assay for canine astrovirus and canine kobuvirus using varying target ratios.

MAstV5:AiV-A2 ratio	MAstV5, $\overline{x}$ copies/μL	AiV-A2, $\overline{x}$ copies/μL
108:108	9.72 × 107	14.4 × 107
108:107	10.8 × 107	1.77 × 107
108:106	9.82 × 107	7.86 × 105
107:108	9.58 × 106	8.70 × 107
106:108	10.3 × 105	6.56 × 107
108:102	10.0 × 107	11.0 × 101
101:108	11.0 × 100	11.0 × 107

AiV-A2 = aichivirus A2, canine kobuvirus; MAstV5 = mamastrovirus 5, canine astrovirus.

Clinical application of dqPCR and viral load detection in canine tissues

All 25 rectal swab samples previously identified as positive for MAstV5 and/or AiV-A2 by conventional RT-PCR were confirmed positive using our dqPCR assay. Of these 25 samples, 13 were dual-positive for both MAstV5 and AiV-A2 by conventional RT-PCR; 6 samples were positive for MAstV5 only and 6 for AiV-A2 only. All 25 samples, including the 13 dual-positive cases, were consistently confirmed by the dqPCR assay. Among the 25 samples that tested negative by RT-PCR, 1 additional case was detected as AiV-A2–positive by dqPCR; Sanger sequencing of the dqPCR amplicon confirmed the presence of AiV-A2.

We further applied our dqPCR assay to 25 small intestine and 25 MLN samples collected from autopsied dogs with severe gastrointestinal illness. Several cases tested positive for viral RNA. Cases 4 and 5 were co-detected with both MAstV5 and AiV-A2; cases 1 and 2, along with case 7, were positive for AiV-A2 only.

In coinfected dogs, MAstV5 was detected in the small intestine, MLN, spleen, liver, trachea, and tracheal lymph nodes (TLNs), but was absent in the lungs. The Ct values for MAstV5 ranged from 23.9 (small intestine) to 34.9 (TLN). AiV-A2 was detected in all examined organs, with the lowest Ct value observed in the small intestine (25.2) and the highest in the kidney (34.8). Notably, in dog case 7—positive only for AiV-A2—viral RNA was absent from the small intestine but was present in the MLN, with the highest viral load observed in the trachea and the lowest in the kidney (Table 5).

Table 5.

Cycle threshold values of canine astrovirus and canine kobuvirus detected across canine tissue samples.

Virus	Dog	Tissue samples
		SI	MLN	Liver	Spleen	Kidney	Heart	Lung	Trachea	TLN
MAstV5	Case 4	23.9	28.6	ND	29.9	30.4	29.9	ND	28.0	ND
	Case 5	29.3	29.6	32.8	34.8	33.4	ND	ND	32.8	35.0
AiV-A2	Case 1	29.6	ND	ND	32.6	ND	32.1	ND	ND	ND
	Case 2	29.3	ND	ND	ND	33.5	31.8	ND	30.4	34.0
	Case 4	25.3	31.3	ND	ND	32.7	31.5	ND	31.0	ND
	Case 5	30.7	30.0	31.7	32.0	32.7	32.8	ND	31.1	34.3
	Case 7	ND	29.2	ND	32.7	34.9	33.3	33.4	28.6	30.2

AiV-A2 = aichivirus A2, canine kobuvirus; MAstV5 = mamastrovirus 5, canine astrovirus; MLN = mesenteric lymph node; ND = not detected; SI = small intestine; TLN = tracheobronchial lymph node.

As part of the investigation into coinfections with common canine enteric viruses, rectal swab and tissue samples were also screened for CPV, CCoV, and CDV. Among the 25 rectal swab samples that tested positive for MAstV5 and/or AiV-A2, 4 were coinfected with MAstV5, AiV-A2, and CPV; 1 sample was coinfected with MAstV5, AiV-A2, CPV, and CCoV; and 1 sample was coinfected with MAstV5, AiV-A2, CPV, CCoV, and CDV. The remaining 10 samples were negative for these additional viruses. Among the 25 autopsied dogs, 5 tested positive for MAstV5 and/or AiV-A2 in tissue samples. Coinfections with other enteric viruses were also observed in these cases. Specifically, cases 4 and 5 were coinfected with MAstV5, AiV-A2, and CPV; cases 1 and 2 were coinfected with AiV-A2 and CPV; and case 7 was positive for AiV-A2 only.

Discussion

We successfully developed and validated a dqPCR assay for the simultaneous detection of MAstV5 and AiV-A2, 2 under-characterized viruses within the canine enteric virome. Our dqPCR assay had excellent analytical performance, with strong linearity (R² > 0.99), high amplification efficiency, and no cross-reactivity with other common canine enteric viruses such as CPV, CDV, and CCoV. The assay achieved detection limits of 10 copies/μL for MAstV5 and 100 copies/μL for AiV-A2, surpassing the thresholds reported in previous monoplex qPCR assays. ²⁹ We selected the ORF1b region of MAstV5 and the 3D polymerase gene of AiV-A2 as target regions based on their high sequence conservation across circulating strains, ensuring reliable and broadly applicable amplification, as supported by previous molecular surveillance studies.^16,18 The use of TaqMan probes targeting these conserved regions contributed to the assay’s specificity and reproducibility.

A major strength of this dqPCR platform is its robustness under co-amplification conditions. Across a range of input ratios of both targets, the assay consistently maintained stable and accurate Ct values, with no evidence of signal interference or target competition. This overcomes a key challenge frequently reported in multiplex platforms, in which uneven template abundance often compromises quantification accuracy.^8,28 Furthermore, the assay had excellent intra- and inter-assay precision (CV <2.2%), reinforcing its reliability for routine detection and quantification applications.

Our study also adds significant biological insights through the detection of viral RNA in extraintestinal tissues from naturally infected dogs. Both MAstV5 and AiV-A2 RNA were identified not only in the gastrointestinal tract, but also in the spleen, liver, kidneys, trachea, and MLNs. Our findings align with previous isolated reports^18,23 describing similar extraintestinal detections in puppies and wildlife hosts. However, we systematically screened a broad range of organ tissues using a validated duplex assay in a clinically relevant canine cohort, providing more comprehensive evidence of possible systemic spread of these viruses.

Notably, in one AiV-A2–positive case (case 7), viral RNA was absent from the intestine but present in the MLNs and respiratory tissues, suggesting either early systemic dissemination or extraintestinal viral replication. Although we did not assess viral replication through antigen or strand-specific PCR assays, our findings warrant further investigation of the tissue tropism, persistence, and immunopathology of AiV-A2 and MAstV5, especially in the context of coinfections or immunocompromised hosts.

Compared to prior reports focused primarily on fecal or intestinal samples, our inclusion of both rectal swabs and postmortem tissues expanded the known tissue distribution of MAstV5 and AiV-A2. This highlights the assay’s broader detection and epidemiologic utility, particularly for retrospective autopsy investigations and pathogenesis studies. Although our primary aim was to develop a sensitive and specific dqPCR assay, the detection of coinfections with CPV, CDV, and CCoV in MAstV5- and AiV-A2–positive cases raises important considerations for future research. Previous studies^19,27 have suggested that these viruses may interact synergistically, potentially exacerbating gastrointestinal disease severity. However, the inability to culture MAstV5 and AiV-A2 in vitro continues to hinder direct assessment of their individual pathogenic roles.

Although the duplex format improves resource and time efficiency, scaling up to high-throughput formats—such as liquid-handling robotics or microfluidic PCR arrays—may enhance future surveillance capabilities. Additional strengths include its suitability for incorporation into triplex or broader multiplex panels, which could include other co-circulating enteric viruses, such as CCoV, sapovirus, or norovirus. However, some limitations remain. These include the lack of viral isolation, the absence of clinical outcome correlation, and the inability to confirm active replication. Addressing these limitations will be important in future investigation.