Duchesnea indica (Andr.) Focke extracts exerted anti-inflammatory effect via inhibiting MAPK/ERK pathway in LPS-stimulated RAW264.7 cells

Abstract

Duchesnea indica (Andr.) Focke (DIF), a medicinal plant from the Rosaceae family, possesses therapeutic properties such as heat-clearing and detoxification, dispersion of stasis detumescence, blood-cooling, and hemostatic effect. The latest research unveiled a diverse array of pharmacologically active compounds from DIF, showcasing a broad spectrum of pharmacological effects. However, there was limited attention given to the comprehensive investigation of its high molecular weight compounds, particularly polysaccharides. In this study, DIF extracts were prepared by water-extraction and alcohol-precipitation method and the pharmacological effect was detected. The results demonstrated that the total polysaccharide content, reducing sugar content, total flavonoid content, and total polyphenol content in DIF extracts were 32.62 ± 0.91 %, 13.41 ± 0.18 %, 1.07 ± 0.07 %, and 12.16 ± 0.27 %, respectively. Although the total antioxidant activity of DIF extracts were significantly low than that of the vitamin C group, its ability to scavenge ABTS, DPPH, and superoxide anion radicals was similar to that of the vitamin C group. Furthermore, DIF extracts demonstrated significant inhibition on NO and MDA levels while simultaneously enhancing SOD activity in LPS-stimulated RAW264.7 cells. Finally, DIF extracts significantly reduced the mRNA level of pro-inflammation cytokines interleukin (IL)-6, IL-1β, inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2) and tumor necrosis factor (TNF)-α, and directly inhibited the phosphorylation level of extracellular regulated kinase and mitogen-activated protein kinase (ERK-MAPK) pathway. Taken together, these results indicated that DIF extracts exhibited an anti-inflammatory and antioxidant effect in LPS-induced RAW264.7 mouse macrophages by directly inhibiting ERK-MAPK signaling pathway. Based on these findings, DIF extracts provided new insights into the treatment and prevention of diseases related to oxidative stress and inflammation.

Graphical abstract

Highlights

• •The main compositions of DIF extracts are total polysaccharides, reducing sugars and total polyphenols.
• •DIF extracts exhibited desirable antioxidant and anti-lipid peroxidation effects.
• •DIF extracts exerted anti-inflammation effect via ERK/MAPK pathway in LPS-stimulated RAW264.7 cells.

1. Introduction

Traditional Chinese Medicine (TCM) and its metabolic products have been widely recognized and supported by the World Health Organization (WHO) due to their pivotal contribution to the prevention and management of diseases, leading to the integration of conventional medicine into healthcare systems worldwide [1]. Therefore, the safety and multi-target properties of TCM and natural products have made them become potential candidates for treating inflammatory diseases. Duchesnea indica (Andr.) Focke (DIF), commonly known as “SheMei” in Chinese, is a widely distributed perennial herb in China. The entire plant possesses medicinal and nutritional value and belongs to the Rosaceae family. DIF exhibited the clearing heat, detoxifying, promoting blood circulation and removing blood stasis function according to traditional Chinese medicine theories [2]. The modern pharmacology research demonstrated that the extracted component of DIF exhibits multiple pharmacological activities, primarily encompassing anti-tumor, antimicrobial, antioxidant, antiviral, and immunomodulation [[3], [4], [5], [6], [7]]. Duchesnea indica (Andr.) Focke extracts, prepared by our lab, have been previously reported for their pharmacological activity, but the anti-inflammation effect of DIF extracts was unclear currently.

Inflammation represents a defensive response by the organism aimed at eliminating harmful stimuli and initiating tissue healing, thus serving as a crucial process in maintaining homeostasis [8]. Effective management of excessive inflammation is crucial in the clinical treatment of inflammatory diseases. Macrophages, as crucial innate immune cells, are widely distributed throughout lymphatic and non-lymphoid tissues [9,10]. Previous studies have established that macrophages perform three fundamental physiological roles, as professional phagocytes, they can eliminate pathogens, cell debris, and apoptotic cells through engulfment processes on the one hand. On the other hand, functioning as potent secretory cells, they release a sophisticated array of bioactive molecules including enzymes, complement proteins and signaling cytokines. Meanwhile, serving as anti-presenting cells, they collaborate with dentritic cells to process and present foreign antigens, thereby bridging innate and adaptive immunity through T-cell activation [11]. Therefore, macrophages play a pivotal role in maintaining homeostasis, regulating immune response, facilitating tissue repair, modulating obesity, and influencing cancer progression [12,13]. The stimulation of macrophages by LPS results in the activation of mitogen-activated protein kinase (MAPK) and nuclear factor kappa-B (NF-κB), leading to the release of a substantial quantity of inflammatory factors, which subsequently causes dysregulation in both the immune system and inflammatory response [[14], [15], [16]]. The inducible nitric oxide synthase (iNOS), responsible for the production of nitric oxide (NO) by macrophages in response against microbial infections, is often associated with synergic effects combined with acute phase proteins and cytokines, as IFNs and TNFs, leading to enhanced phagocytosis. Alternatively, an excessive production of iNOS and consequently NO may have negative effects by promoting excessive inflammation or apoptosis [17,18]. Therefore, targeting the excessive release of inflammatory cytokines and NO during the inflammatory response process may represent a promising therapeutic strategy for treating inflammatory diseases.

Overall, the antioxidant and anti-inflammatory effects of DIF extracts on LPS-induced RAW264.7 cells in the present work were investigated. The results showed that DIF extracts significantly inhibited the NO and MDA content in LPS-stimulated RAW 264.7 cell, as well as reduced the expression of inflammation factors by inhibiting the phosphorylation of ERK/MAPK pathway.

2. Materials and methods

2.1. Preparation of DIF extracts

The DIF was procured from the Yellow River Traditional Chinese Medicine Market in Gansu Province, China. The DIF extracts was obtained through a water-extraction and alcohol-precipitation method as described in previous literature [2]. Briefly, 60.0 g of dried DIF powder was precisely weighed and mixed with distilled water at a solid-liquid ratio of 1:30 (w/v). The mixture underwent three rounds of reflux for 2 h (h) each time at a constant temperature of 94 °C. The filtered liquid was combined and compressed to a volume fraction of one-fourth after being centrifuged at 3400 rpm for 7 min (min). Sevage reagent (chloroform/n-butanol = 4/1, v/v) was added in a volume ratio of one-third to remove proteins from the upper aqueous phase through magnetic agitation and further centrifugation and the process was repeated until no protein layer remained in the middle. The dialysate obtained after dialysis was mixed with anhydrous ethanol at a 4:1 ratio and incubated overnight at 4 °C. The supernatant was removed after being centrifuged at 3400 rpm for 7 min. The obtained precipitate was subjected to three rounds of washing, with each round using a volume of anhydrous ethanol, acetone, and ether that was twice the volume of the precipitate. Subsequently, the precipitation was dissolved in twice its volume of distilled water and subjected to repeated dialysis for further purification. Additional rounds of dialysis were performed, followed by freeze-drying and weighing of the resulting dialysate to obtain the DIF extracts.

2.2. Determination of total polysaccharide and deoxidize sugar content

The total polysaccharide content of DIF extracts was determined by phenol sulfuric acid method [19]. Different concentrations of a glucose standard solution (2.0 mL) were added to a test tube, followed by the addition of 5 % phenol solution (1.0 mL). The concentrated sulfuric acid at volume of 5.0 mL was added and the mixture was incubated for 10 min after being shaken sufficiently. Then the resulting solution was boiled in water for 15 min and immediately cooled for 20 min. Furthermore, 2 mL of DNS reagent was added to various concentrations prepared glucose solutions in order to measure the reducing sugar content of DIF. The mixture was thoroughly mixed and then boiled in water for 5 min. Distilled water at 9.0 mL was added after being cooled at room temperature (RT). Finally, the total polysaccharide and reducing sugar content of DIF were determined by measuring wavelengths at 450 nm and 540 nm using a microplate photometer, respectively. The total polysaccharide and deoxidize sugar content were calculated according to the standard curve.

2.3. Determination of total flavonoids content

The total flavonoid content was tested using the aluminum nitrate method described in previous study [20]. A solution containing 10 mg/mL of DIF extracts and varying concentrations of standard quercetin (Aladdin, China) were added to a 96-well plate. Simultaneously, a mixture of aluminum nitrate solution (100 g/L) and potassium acetate solution (9.8 g/L) was added to distilled water. The absorbance at 429 nm was measured after being set at RT for 60 min darkly. The content of total flavonoids was calculated according to the standard curve of quercetin.

2.4. Determination of total polyphenols content

Briefly, DIF extracts (0.5 mg/mL) and standards were added to the 96-well plate, respectively. Then, the folin-phenol solution was added to each well and mixed for 5 min at 30 °C darkly. Afterwards, Na₂CO₃ solution was added and incubated for 1 h at 30 °C in the dark. The absorbance at 747 nm was measured, and total polyphenols were calculated based on the standard curve of gallic acid.

2.5. The antioxidant activity of DIF extracts

FRAP solution (pH 3.6 sodium acetate buffer, 300 mmol/L; 2, 3, 5-Triphenyltetrazolium Chloride solution, 10 mmol/L; and ferric chloride solution, 20 mmol/L mixed in a ratio of 10:1:1) at volume of 180 μL was added to each well of a 96-well plate. Subsequently, each well was incubated with either a DIF extracts or positive control solution (0.5 mg/mL) for 5 min at 37 °C while the standard wells were incubated with different concentrations of FeSO4 standard solutions (5 μL). Finally, the antioxidant capacity of DIF extracts was determined by measuring the absorbance at a wavelength of 593 nm.

2.6. The free radical scavenging assay

The free radical scavenging activity was assessed using ABTS, DPPH, and superoxide anion radical scavenging assays [21]. Initially, the ABTS working solution was prepared by mixing equal volumes of 2, 2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) solution and K₂S₂O₈ solution and incubating at RT for 16 h darkly. The diluted ABTS working solution was subsequently mixed with the DIF extracts solution and reacted for 6 min constantly at RT prior to measuring the absorbance at 734 nm. The DPPH radical scavenging assay was conducted as follows: the samples and positive control at volume of 50 μL were added to 96-well plate, followed by the addition of a mixture containing 100 μL ddH₂O and 25 μL DPPH anhydrous ethanol solution. The reaction was carried out in darkness at 30 °C for 30 min, and the absorbance at 517 nm was measured. The superoxide anion radical scavenging assay involved preparing the sample group with a mixture of Tris HCl buffer solution, DIF extracts solution, and pyrogallic acid solution, the positive group with a mixture of Tris HCl buffer solution, DIF extracts solution, and HCl solution, and the control group with a mixture of Tris HCl buffer solution, H₂O, and pyrogallic acid solution. The above mixture was quickly mixed and stopped reaction with 6 mol/L HCl. The absorbance at 325 nm was measured after being placed at 37 °C for 10 min. The free radical scavenging rate was calculated as follows: The free radical scavenging rate (%) = [A0 − (Aa − Ab)]/A0 × 100. (Note: A0 indicates the OD value of control, Aa indicates the OD value of each sample, Ab indicates the OD value of positive control.)

2.7. The cell viability detection by cck-8 assay

The cell viability was measured by cck-8 assay according to the instruction. Briefly, RAW264.7 cells were cultured at a density of 5 × 10⁵ cells per well and incubated for 12 h at 37 °C. Then various concentrations of DIF extracts and LPS + DIF extracts were added to each well and incubated for an additional 12 h. Each well was treated with 100 μL DMEM and 10 μL cck-8 reagent after being washed with PBS twice. The plate was mixed adequately and incubated at 37 °C for 1 h before the absorbance at 490 nm was measured using a multi-functional micro-plate reader. The cell viability was calculated according to the formula as follows: The cell survival rate (%) = (OD450 (drug treatment group) - OD450 (control group))]/[(OD450 (no drugs) - OD450 (control group))] × 100 %).

2.8. The NO, MDA and SOD content detection

The levels of NO, MDA, and SOD in cell supernatant treated with DIF extracts and LPS were quantified using assay kits (Beyotime, China), and the concentration was determined based on standard curves.

2.9. Real-time quantitative polymerase chain reaction (RT-qPCR)

The total RNA from RAW264.7 cell that treated with LPS and DIF extracts was extracted according to the Trizol reagent and synthesized into cDNA based on the PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China). The mRNA expression of cytokines were detected by TB Green ® Premix Ex Taq™ II and calculated in accordance of 2^−ΔΔCt method. Each sample was standardized using CT value of β-actin and the sequence of primers used in this study listed in Table 1.

Table 1.

The primers used for qRT-PCR.

Primers	The serial number	Primer sequence (5′-3′)
iNOS	NM_001313921.1	F: 5′- ACTCAGCCAAGCCCTCACCTAC -3′
		R: 5′- TCCAATCTCTGCCTATCCGTCTCG 3′
COX-2	NM_011198.4	F: 5′- ATTCCAAACCAGCAGACTCATA -3′
		R: 5′- CTTGAGTTTGAAGTGGTAACCG -3′
IL-6	NM_001314054.1	F: 5′- GTTCTCTGGGAAATCGTGGA -3′
		R: 5′- GCATTGGAAATTGGGCTAGG -3′
IL-1β	NM_008361.4	F: 5′- GCAGGCAGTATCACTCATTGT -3′
		R: 5′- GGCTTTTTTGTTGTTCATCTC -3′
TNF-α	NM_001278601.1	F: 5′- AAGGGAGAGTGGTCAGGTTGC -3′
		R: 5′- CAGAGGTTCAGTGATGTAGCG -3′
β-actin	NM_007393.5	F: 5′- CCACCATGTACCCAGGCATT -3′
		R: 5′- AGGGTGTAAAACGCAGCTCA -3′

2.10. Western Blot (WB)

The total proteins in RAW264.7 cell that treated with LPS and DIF extracts were collected in accordance with M-PER™ Mammalian protein extraction reagent (Thermo Scientific, American). The protein concentration was detected by BCA protein concentration detection kit and adjusted to the equivalent concentration. Subsequently, sample at 10 μL was subjected to SDS- polyacrylamide gel electrophoresis after blending with 5X SDS solution and boiling at 100 °C for 10 min. Then, the protein was transferred into polyvinylidene fluoride (PVDF) membrane and blocked with QuickBlock Blocking Buffer at RT for 15 min, followed by washing with PBST thrice. The membrane was incubated the primary antibody at 4 °C overnight after being washed with TBST thrice. Finally, the membrane was visualized by using an enhanced chemiluminescence (ECL) under the Odyssey system after being incubated with secondary antibody at 37 °C for 1 h darkly, and the gray value of the corresponding protein was analyzed by Image-J software, the antibody used in this work was showed in Table 2.

Table 2.

The detailed information of antibody for WB.

Name	Dilution ratio	kDa	Resource
ERK	1:2000	44	Cell Signaling Technology (USA)
p-ERK	1:1000	42	Cell Signaling Technology (USA)
p38	1:1000	40	Cell Signaling Technology (USA)
p-p38	1:1000	43	Cell Signaling Technology (USA)
NF-κB p65	1:1000	65	Cell Signaling Technology (USA)
β-actin	1:1000	40	Abmart (Shanghai, China)
Goat Anti-Rabbit &Mouse IgG-HRP	1:5000	–	Abmart (Shanghai, China)
Goat anti-Mouse IgG AF488	1:300	–	Abmart (Shanghai, China)

2.11. Statistical analysis

All experiments were performed with at least three replications. Statistical analysis was performed using Prism 7.0 Software (GraphPad, La, Jolla, CA), and difference was evaluated by student's t-test. For all comparisons, P < 0.05 was considered statistically significant, P < 0.01 was considered to be extremely significant.

3. Results

3.1. The main chemical compositions of DIF extracts

The results revealed that the levels of total polysaccharides, reducing sugars, total flavonoids, and total polyphenols in DIF extracts were determined to be 32.62 ± 0.91 %, 13.41 ± 0.18 %, 1.07 ± 0.07 %, and 12.16 ± 0.27 %, respectively (see Table 3).

Table 3.

The antioxidant activity of DIF extracts.

Drug group	FRAP (mmol/g)	ABTS (%)	DPPH(%)	O2−·(%)
DIF extracts	0.91 ± 0.13a	99.75 ± 0.19a	97.85 ± 1.35a	49.84 ± 3.15a
VC	5.62 ± 0.38b	100.14 ± 0.19a	95.55 ± 0.63a	36.15 ± 0.75a

Note: the difference between data with the different small letters with in row is significant (P < 0.05), and the difference between data with the same small letters with in row is no significant (P > 0.05).

3.2. Antioxidant activity of DIF extracts

The total antioxidant capacity of DIF extracts was significantly lower than that in the Vc group (P < 0.05). However, there were no significant differences observed in the scavenging rates of ABTS, DPPH and superoxide anion between the DIF extracts treatment group and the Vc group (P > 0.05), as presented in Table 2.

3.3. DIF extracts alleviated cell viability reduction in LPS-stimulated RAW264.7 cells

The results of the cck-8 assay indicated that DIF extracts did not exhibit any cytotoxic effects on RAW264.7 cells, whereas treatment with LPS leads to a decrease in cell survival rate. As illustrated in Fig. 1A, DIF extracts showed no cytotoxicity at concentrations below 400 μg/mL compared to the control group and even enhanced cell proliferation at higher concentration. However, exposure to 0.2 μg/mL LPS significantly reduces cell viability (P < 0.01). Interestingly, DIF extracts demonstrated a dose-dependent mitigation of reduced cell viability caused by LPS in RAW264.7 cells, as depicted in Fig. 1B.

Fig. 1.

A indicates the relative cell viability of the RAW264.7 cells in the presence of DIF extracts. B indicates the relative cell viability of the RAW264.7 cells in the presence of LPS. ^##P < 0.01 vs. the control group, ∗∗P < 0.01 vs. the LPS-treated group.

3.4. The effect of DIF extracts on lipid peroxidation in LPS-induced RAW264.7 cells

As shown in Fig. 2A, the RAW264.7 cells treated with LPS exhibited a significant increase in NO content in the supernatant compared to the blank control group (P < 0.01), but the RAW264.7 cells that treated with 400 μg/mL DIF extracts and 0.1 μg/mL dexamethasone significantly inhibited LPS-induced NO production (P < 0.01). In Fig. 2B, the mRNA expression of iNOS in RAW264.7 cells was weaker in the control group but significantly increased after being stimulated with LPS (P < 0.01). The pre-treatment with DIF extracts and dexamethasone obviously suppressed the mRNA expression of iNOS in LPS-induced cell (P < 0.01). DIF extracts significantly enhanced SOD activity (P < 0.01), while dexamethasone had no significant impact on SOD activity (Fig. 2C). The MDA content in RAW264.7 cells showed a significant increase after being stimulated with LPS (P < 0.01). Interestingly, both DIF extracts and dexamethasone treatment exhibited significant inhibitory effect on the LPS-induced increase in MDA level (Fig. 2D).

Fig. 2.

Effect of DIF extracts on lipid peroxidation induced by LPS in RAW264.7 cells. A, B, C, D represents the content of NO²⁻, the mRNA expression of iNOS, MDA content, total SOD activity in turn. ^##P < 0.01 vs. the control group, ∗∗P < 0.01 vs. the LPS-treated group.

3.5. The effect of DIF extracts on pro-inflammatory cytokines expression in LPS-treated RAW264.7 cell

The mRNA level of IL-6, IL-1β, COX-2 and TNF-α were significantly low in the control group (Fig. 3). Compared with the control group, there was a substantial increase on the mRNA expression of IL-6, IL-1β, COX-2 and TNF-α in after being treated with LPS (P < 0.01). However, the mRNA level of IL-6, IL-1β, COX-2 and TNF-α in the LPS-treated group were effectively inhibited after being pre-treated with 400 μg/mL DIF extracts and 0.1 μg/mL dexamethasone (P < 0.01). These results indicated that DIF extracts exhibited desirable anti-inflammation function.

Fig. 3.

The mRNA expression of pro-inflammation cytokines in RAW264.7 Cell. A, B, C, D represents the mRNA expression level of IL-6, IL-1β, TNF-α and COX-2 in turn. ^##P < 0.01 vs. the control group, ∗∗P < 0.01 vs. the LPS-treated group.

3.6. The effect of DIF extracts on the phosphorylation of ERK/MAPK in LPS-stimulated RAW264.7 cell

To further confirm whether DIF extracts exerted anti-inflammation effect through MAPK/ERK pathway, the phosphorylation level of MAPK/ERK was detected with WB technology. The results showed that the phosphorylation level of ERK and p38 in LPS-stimulated group was significantly up-regulated compared with the control group (P < 0.01). Interestingly, 400 μg/mL DIF extracts significantly inhibited the phosphorylation level of ERK and p38 compared to the LPS treatment group, as shown in Fig. 4.

Fig. 4.

A, B, C, D, E represent the level of ERK, p-ERK, p38, p-p38, p65, respectively. The signals of protein bands were determined by Image-J software. F represent the visualization result. ^##P < 0.01, ^#P < 0.05 vs. the control group, ∗∗P < 0.01, ∗P < 0.05 vs. the LPS-treated group.

4. Discussion

The inflammatory response is a complex biological process orchestrated by the immune system to protect the body from harmful stimulation. Macrophages, which is crucial effector cells involved in the inflammatory response, can be recognized by LPS to activate the release of pro-inflammatory cytokines, including iNOS, COX-2, IL-6, IL-1β, TNF-α, thereby leading to a substantial secretion of pro-inflammatory cytokines and generation of NO. Upon appropriate stimulation, macrophages effectively eliminate bacteria and other pathogens through NO secretion [6,22]. However, prolonged and excessive production of NO can have a deleterious impact on macrophages themselves by inducing oxidative stress through an imbalance between oxidation and anti-oxidation in the body [23]. Therefore, maintaining a normal immune status is important to prevent various diseases related to inflammation.

The investigation on the antioxidant activity and active components of Chinese herbal medicine holds significant importance in pharmacological research, as they can be developed into natural antioxidants with broad application prospects in the food, cosmetics, livestock farming and pharmaceutical industry. The widespread Chinese herbal medicine, DIF, possesses a wide range of pharmacological properties. Although the extract from Duchesnea indica (Andr.) Focke has been extensively researched for its anti-inflammatory, antiviral, and antibacterial activities, there is currently limited literature available regarding the antioxidant and anti-inflammatory effects of its extracts. In this study, the results indicated that DIF extracts exhibited religious antioxidant activity, inhibited NO production and pro-inflammation cytokines release, and suppressed the phosphorylation level of MAPK/ERK pathway.

The assessment of antioxidant capacity relies on the evaluation of DPPH radical scavenging ability, ABTS⁺ radical scavenging ability, hydroxyl radical scavenging ability, and superoxide anion radical scavenging ability, which serve as crucial indicators in scientific research [24]. The scavenging rates of hydroxyl, DPPH, and superoxide anion free radicals were found to increase with increasing concentration for both ethyl acetate extract and n-butanol extract of DIF [25]. Our findings demonstrated that DIF extracts significantly enhanced the scavenging rates of ABTS⁺, DPPH, and superoxide anion, thereby exhibiting robust antioxidant capacity. This observation is consistent with a previous study that reported higher total antioxidant capacity and scavenging rate in the total polyphenols derived from water extract and acetone extract of Duchesnea indica (Andr.) Focke [26,27]. The induction of lipid peroxidation leads to the production of the intermediate metabolite MDA and SOD, which can serve as an indicator for assessing lipid peroxidation [28]. Research has reported that the polysaccharides extracted from Ophiopogonis and Saliphylla officinalis can inhibit the increase of MDA content and decrease of SOD activity in LPS-stimulated macrophage, which is consistent with our finding that DIF extracts alleviates the down-regulation of MDA and SOD content induced by LPS stimulation in cells, exhibiting a strong inhibitory effect on lipid peroxidation in serum [29,30]. The results suggested that DIF extracts possessed the capacity to uphold the stability of cellular membranes, thereby preventing deleterious substances from compromising tissue and cell structure as well as function.

The MAPK represents a family of serine/threonine protein kinases, which can be activated by diverse extracellular stimuli, thereby inducing phosphorylation of downstream signaling molecules [31]. NF-κB serves as an inducible transcription factor that up-regulates the expression of genes encoding cytokines, chemokines, growth factors, cell adhesion molecules, and acute phase proteins [32,33]. The activation of NF-κB can induce the expression of pro-inflammatory cytokines and trigger the production of COX-2, iNOS, and other related enzymes [[34], [35], [36]]. COX-2 facilitates the synthesis of prostaglandins, thereby inducing the production of a series of inflammatory mediators. Moreover, iNOS activation stimulates the release of a substantial quantity of NO. The simultaneous activation of both COX-2 and iNOS initiates an amplification cascade in the inflammatory response, thus participating in various physiological and pathological processes within the body [37,38]. The cytokines (TNF-α, IL-1β, and IL-6) played a pivotal role in the initiation and progression of inflammation by up-regulating other pro-inflammatory cytokines to activate T cell and macrophage [39]. Previous study have shown that both alcohol extract of Duchesnea indica (Andr.) Focke and DEX can inhibit NO secretion in BV-2 cells under the action of herpes virus [6]. Our results also confirmed this point that DIF extracts significantly inhibit the excessive secretion of NO and the mRNA expression of iNOS in LPS-stimulated RAW264.7 cells. Furthermore, our findings demonstrated that DIP exerted a potent anti-inflammatory effect in LPS-induced RAW264.7 mouse macrophages by directly suppressing the MAPK/ERK signaling pathway. These results underscore the therapeutic potential of DIF extracts as an inhibitor of inflammatory mediators and highlight its significance in the management of inflammatory disorders. As confirmed by previous researches that many natural products exert anti-inflammation effect through multiple pathways, such as TLR4/MyD88/NF-κB pathway, MAPK/ERK, PI3K/AKT pathway, JAK/STAT pathway [[40], [41], [42]]. Collectively, these findings provide further evidence supporting the potential anti-inflammatory activity of DIF extracts, which may be attributed to its inhibitory effect on the phosphorylation of the MAPK/ERK signal pathway.

5. Conclusion

In summary, the research initially demonstrated that DIF extracts exhibited potential antioxidant and anti-lipid peroxidation effects, effectively protecting RAW264.7 cell viability damage that induced by LPS. Moreover, DIF extracts attenuated the excessive production of pro-inflammatory cytokines (iNOS, COX-2, IL-6, IL-1β and TNF-α), which may be attributed to the inhibition of phosphorylation in ERK/MAPK signaling pathway. The current findings offer compelling evidence in support of the significant antioxidant and anti-inflammatory properties of DIF extracts, thus justifying further the exploration and development of DIF.

CRediT authorship contribution statement

Haipeng Feng: Writing – original draft, Methodology, Investigation, Conceptualization. Qianqian Qiao: Formal analysis. Jingyan Zhang: Formal analysis. Kang Zhang: Methodology, Data curation. Lei Wang: Methodology, Data curation. Jianxi Li: Writing – review & editing, Project administration, Investigation, Conceptualization.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32171903), National Key Research and Development Program of China (2023YFD1800805), the Key Project of Gansu Province in Sciences and Technology in Agriculture (24ZDNA001)].

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Data availability

Data will be made available on request.