Enhanced antibacterial activity of 3D-printed niosome-curcumin/ceftizoxime scaffolds against drug-resistant pathogens

Abstract

Hospital-acquired infections caused by multidrug-resistant (MDR) pathogens such as Methicillin-resistant Staphylococcus aureus (MRSA) and Carbapenem-resistant Klebsiella pneumoniae (CRKP) are a major health concern. In this study, ceftizoxime (CEF) and curcumin (CUR) were co-encapsulated into niosome nanoparticles (using thin-film hydration), and then embedded into a 3D-printed gelatin-alginate scaffold (Nio-CUR/CEF@SC). The Nio-CUR/CEF@SC were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), scanning electron microscopy (SEM), and Fourier-transform infrared spectroscopy (FTIR). The antibacterial activity was assessed using MIC, time-kill, and disc diffusion assays, while anti-biofilm activity was evaluated using crystal violet (CV) and minimum biofilm eradication concentration (MBEC) assays. Gene expression of virulence and resistance genes was measured using qRT-PCR, and cytotoxicity was tested via MTT assay on HFF cells. The Nio-CUR/CEF@SC system exhibited high encapsulation efficiency (CUR:78%; CEF: 80%), uniform nanoscale size (208–308 nm), and sustained dual-drug release over 72 h. This formulation reduced MIC values against MRSA and CRKP to 0.25–1 µg/mL (over 64-fold improvement vs. free drugs), produced large inhibition zones (up to 31.5 mm), and achieved strong time-kill and anti-biofilm effects (> 2 log₁₀ CFU/mL reduction). It also led to significant downregulation of MRSA ((hla, hlb, pvl)_ and CRKP (blaTEM, blaCTXM, blaOXA-48) virulence/resistance genes and showed > 90% viability on normal fibroblasts at effective doses. This study demonstrates that 3D-printed Nio-CUR/CEF@SC is an effective drug delivery system for the treatment of MRSA and CRKP infections in vitro. The engineered nanocarrier has potential for further research on infection therapies and offers a promising approach to combat drug-resistant pathogens.

Introduction

Despite advances in antibiotic therapy, the global rise of multidrug-resistant (MDR) pathogens such as Methicillin-resistant Staphylococcus aureus (MRSA) and Carbapenem-resistant Klebsiella pneumoniae (CRKP) has become a significant challenge for public health. Resistance mechanisms, including enzymatic degradation, efflux pumps, and especially biofilm formation, substantially limit the effectiveness of conventional antibiotics [1–4]. New therapeutic approaches are needed to control and eradicate these resilient infections.

Recently, nanotechnology-based drug delivery systems have emerged as promising strategies to overcome antibiotic resistance [5–7]. Niosomes, as non-ionic surfactant-based vesicles, have shown great potential for delivering antibacterial agents due to their ability to encapsulate both hydrophilic and hydrophobic drugs, improving drug stability, sustained release, and targeted delivery while minimizing toxicity [8–10]. Several studies have reported the synergistic antibacterial and antibiofilm effects of conventional antibiotics and natural phytochemicals, such as curcumin, when loaded onto nanocarriers [11–13]. However, the clinical translation of such systems remains limited, particularly for MDR pathogens like MRSA and CRKP.

Ceftizoxime (CEF), a third-generation cephalosporin antibiotic, possesses a broad spectrum of activity but faces decreased efficacy due to widespread resistance among clinical isolates [14]. Curcumin (CUR), a polyphenolic compound from Curcuma longa, exhibits promising antimicrobial and anti-biofilm properties but suffers from poor aqueous solubility and bioavailability [15]. Encapsulation of CEF and CUR in niosomal nanoparticles can potentially enhance their pharmacological effects and overcome the limitations of free agents [16]. Bio scaffolds deliver drugs and biomaterials to target organs through various routes to treat bacterial infections and diseases. 3D gelatin-alginate scaffolds are used for multi-target treatments due to properties such as biodegradable, biocompatible and simultaneous release of several biological agents [17–19]. Integration of these nanodrugs into 3D-printed gelatin-alginate scaffolds further offers localized and sustained drug delivery at infection sites, addressing biofilm-related resistance [20–22].

To date, there are limited studies investigating the co-delivery of ceftizoxime and curcumin via niosomal carriers within 3D-printed biopolymer scaffolds for combating MDR pathogens. To address this gap, the present study was designed to evaluate the antibacterial and anti-biofilm efficacy of CEF and CUR co-loaded niosome nanoparticles embedded in a 3D-printed gelatin-alginate scaffold (Nio-CUR/CEF@SC) against clinical MRSA and CRKP isolates. This work aims to provide a novel therapeutic approach to manage biofilm-associated drug-resistant infections with enhanced efficacy and reduced toxicity.

Material and Method

Materials

Tween 60, Span 60, cholesterol, CEF, CUR, chloroform, DMEM, calcium chloride, Cefoxitin, Imipenem, Meropenem antibiotic discs, Amicon (Ultra-15 Membrane, MWCO 30,000 Da), PBS, alginate (viscosity: 15–25 cP, 1% in H₂O), gelatin, and bacterial culture media were purchased from Merck, Germany.

Preparation of niosome loaded with Curcumin and Ceftizoxime

Niosome nanoparticles were prepared using the Thin-Film Hydration (TFH) method. First, Tween 60, Span 60, cholesterol, CEF, and CUR were dissolved in 10 mL chloroform and added to a round-bottom flask. The solvent (chloroform) was evaporated entirely using a rotary evaporator (Heidolph Instruments, Germany) at 60 °C and 150 rpm for 1 h to produce a uniform, thin lipid film on the inner wall of the flask. After evaporation, the flask containing the dried thin film was removed from the rotary evaporator and hydrated with 10 mL of PBS (pH 7.4) at 60 °C and 120 rpm for 1 h. This hydration step was performed on a magnetic stirrer (not the rotary evaporator), which disperses the lipid film and forms multilamellar vesicles. The sample was sonicated (Hielscher UP50H ultrasonic processor, Germany) for 5 min to obtain Nio-CUR/CEF [23].

3D-printing of niosome-based-loaded scaffolds

3D-printing Nio-CUR/CEF@SC was prepared using the procedure described by Zaer et al., study [20]. Briefly, gelatin was dissolved in DMEM (Dulbecco’s Modified Eagle’s Medium) and alginate and was mixed for one hour before loading it into syringes. The samples were centrifuged for 1 min at 1000 rpm to remove air. A scaffold with dimensions of 7 mm × 0.15 mm, a string thickness of 2 mm, and 1.3 mm spacing between strings was constructed. The printing process was carried out at room temperature (25 °C). A 21-gauge syringe attached to a 2 mL plastic cartridge was used to dispense the bio-ink onto glass microscope slides. The bio-printed glasses were frozen at 4 °C. The cross-linking of the printed scaffolds was performed using 300 mM calcium chloride. Additionally, the diameters and thicknesses of the samples were measured after printing using a digital caliper.

Preparation of niosome functionalized with gelatin/alginate composite

Nio-CUR/CEF@SC was prepared using the sonication method, where the scaffold was placed in 1× PBS and sonicated at 100 W (3 s on/9 s off cycles) for 10 min. The obtained suspension was characterized and used for further experiments.

Investigating the physicochemical properties

The average size, polydispersity index (PDI), and zeta potential of Nio-CUR/CEF@SC were measured using dynamic light scattering (DLS; Brookhaven Instruments Corp., USA). The morphology of Nio-CUR/CEF@SC was assessed by obtaining micrographs with a transmission electron microscope (TEM; Philips Leo 906E, Germany, operating at 80 kV) and a scanning electron microscope (SEM; MIRA3, TESCAN, Czech Republic). Fourier-transform infrared (FTIR) spectra of Nio-CUR/CEF@SC were recorded using KBr discs on a PerkinElmer FTIR spectrophotometer (Spectrum Two, USA). FTIR analysis was performed over the scanning range of 4000–400 cm⁻¹, with a resolution of 4 cm⁻¹ at room temperature [24–26].

Swelling assay

Inducing swelling of lyophilized scaffolds was performed using PBS at 37 °C for time intervals of 0, 60, 120, 180, 240, 300 and 360 min. The scaffolds were weighed, and excess water was removed using paper sheets. The following formula calculates swelling ratios:

Ww (Swollen mass weight of scaffolds), Wd (the dried mass weight of scaffolds) [20].

Biodegradation assay

Hydrolytic degradation was used to evaluate the degradation of scaffolds. Scaffolds were immersed in PBS for 7 and 14 days before freeze-drying, and buffer salts were removed with distilled water. The weight loss percentage was calculated by following the formula:

(m0 is the starting weight of scaffolds, and m1 is its weight at the end of the experiment) [20].

Entrapment efficiency

Entrapment Efficiency (EE) is a critical parameter for niosomes loaded with drugs, as established by previous research [27]. To measure the EE of CUR and CEF in Nio@SC, Amicon Ultra-15 ultrafiltration was performed at 4000× g for 30 min at 4 °C. Spectrophotometry was then used to determine the amount of free drug at specific wavelengths for each drug (214 nm for CEF and 421 nm for CUR). The EE of Nio-CUR/CEF@SC was calculated using the following equation:

Drug release study

The following method was used to perform the in vitro release of CUR, CEF in free form and from the scaffold. First, 10 mL of niosomes were added to a dialysis bag (MWCO = 12 kDa). The dialysis bag was placed in 10 mL of PBS (pH = 7.4) and gently stirred (50 rpm) with a small stir bar at 37 °C. A small volume was removed at predetermined intervals and replaced with fresh medium. 1 mL of the sample was used to determine the concentration of CEF and CUR, and replaced with an equal volume of phosphate buffer. The optical absorption was measured at 214 nm for CEF and 421 nm for CUR [27].

Stability of the prepared formulation

The stability of the best formulation was obtained by measuring the vesicle size, PDI (Polydispersity index), Zeta potential, EE% of Nio-CUR/CEF@SC during storage of the samples at 25 ± 1 °C and 4 ± 1 °C for up to 2 months. Samples were then determined for their physical properties (e.g., particle size (nm), PDI, Zeta potential and EE) [28].

Identification and selection of clinical and standard strains

This descriptive analysis comprised 400 clinical samples collected from various hospital laboratories in Tehran. The specimens were sourced from the hospital biobank (blood, urine, wound exudates, and other clinical specimens). From a total of 400 clinical isolated, 53 (13.25%) were found to be S. aureus and 89 (22.25%) were found to be K. pneumoniae using standard biochemical and microbial tests. Antibiotic strain sensitivity was assessed using the disc diffusion technique according to the Clinical and Laboratory Standards Institute (CLSI) following the detection and confirmation of S. aureus. The standard strains S. aureus ATCC 43,300 and K. pneumoniae BAA-1706 were used as positive controls. Chromogenic agar media (CHROMagar™ Staph aureus, CHROMagar™ MRSA, CHROMagar™ KPC; CHROMagar, France) were used for presumptive identification of Staphylococcus aureus and/or detection of methicillin-resistant or carbapenem-resistant strains. A loopful of each isolate was streaked onto the respective chromogenic agar plate and incubated at 37 °C for 18–24 h. Colony color and morphology were interpreted according to the manufacturer’s instructions; typical mauve colonies were considered presumptive S. aureus on CHROMagar Staph aureus, and pink-to-red colonies indicated ESBL-producing K. pneumoniae on CHROMagar KPC. Results were further confirmed by standard biochemical tests. To identify the target genes in bacterial isolates, genomic DNA was extracted following the instructions of the Cinna Gene extraction kit (Cinna Pure DNA Kit, Alborz, Iran), and purity was assessed using a spectrophotometer at 260 nm. PCR tests were used to detect genes hla, hlb, and pvl (in MRSA) and blaTEM, blaCTXM, and blaOXA48 (in CRKP) in the isolates.

Antibacterial activity of CUR, CEF, CUR/CEF, Nio-CUR/CEF@SC

Determination of MIC values

The MIC of CUR, CEF, CUR/CEF, and Nio-CUR/CEF@SC was determined using the broth microdilution method in a 96-well microplate with Mueller-Hinton broth (MHB), resulting in values from 0.25-0.5-1-2-4-8-16-32-64-128-256-512, 1024 µg/mL (CUR/CEF ratio was 1:1). Bacterial suspensions, standardized to 0.5 McFarland and diluted in MHB, were added to each well to achieve a final concentration of 4–5 × 10⁵ CFU/mL. After overnight incubation at 37 °C, the MIC was identified as the lowest agent concentration that inhibited visible bacterial growth [26, 29, 30].

Time-Kill assay and disc diffusion method

Antibacterial activity of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC against MRSA and CRKP clinical strains was determined over 72 h using the microplate technique. Briefly, 100 µL of the samples at sublethal concentrations (sub-MIC=½MIC) were added to 96-well microtiter plates preloaded with 100 µL of each bacterial suspension. After incubation at 37 °C, the optical density at OD 600 nm was measured at 8, 16, 24, 32, 40, 48, 56, 64 and 72 h using a microplate reader [31].

Antibacterial activity of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC against MRSA and CRKP clinical strains was also evaluated using disc diffusion method. Briefly, sterile blank filter paper discs (6 mm diameter, Oxoid, UK) were used for the disc diffusion assay. Each disc was impregnated with 10 µL of the respective test formulations at the =½MIC concentration under aseptic conditions. Discs were allowed to air-dry in a sterile laminar flow hood until the solvent evaporated completely. The loaded discs were then immediately placed onto Mueller-Hinton agar plates inoculated with the test microorganism. Standard antibiotic discs and discs loaded with solvent only were included as positive and negative controls, respectively. All discs were tested in triplicate.

Anti-biofilm activity

Microtiter plate-based crystal Violet

The anti-biofilm effectiveness of CUR, CEF, CUR/CEF, and Nio-CUR/CEF@SC against MRSA and CRKP biofilms was evaluated using a microtiter plate-based crystal violet (CV) assay [32]. For the purposes of this study, clinical isolates of Staphylococcus aureus exhibiting an OD < sub > 570</sub > greater than 0.4, and Klebsiella pneumoniae isolates with an OD < sub > 570</sub > greater than 0.6 in the crystal violet microtiter plate assay were classified as strong biofilm formers. Initially, 180 µl of MHB culture medium and 20 µl of pathogenic bacterial suspension were added to each well to achieve an OD of 0.600. The plates were then incubated at 37 °C with agitation at 120 rpm for 48 h to promote biofilm formation. After incubation, 100 µl of each test solution at ½ MIC concentration, as well as unaltered MHB medium (as a negative control), were added to the respective wells. Biofilms were subsequently fixed with 175 µl of 2% sodium acetate solution, followed by staining with 175 µl of 0.1% crystal violet (CV) solution for 30 min in the dark. The wells were then washed with PBS to remove excess stain. Finally, 200 µl of ethanol was added to each well, and the absorbance was measured at 570 nm [26, 28, 33].

Determination of minimum biofilm eradication concentration (MBEC)

MBEC assay evaluates the ability of CUR, CEF, CUR/CEF, and Nio-CUR/CEF@SC to disrupt pre-formed biofilms. MRSA and CRKP strains capable of biofilm formation were washed in wells with sterile distilled water, after which 200 µl of serial dilutions of the prepared formulations were added. The plates were incubated aerobically at 37 °C for 24 h. Subsequently, the optical density (OD) of the biofilms was measured at 570 nm. TSB medium served as the negative control, while untreated cultures of clinical and standard isolates were used as positive controls. MBEC was defined as the lowest concentration at which the mean OD of the biofilm was less than or equal to the OD of the negative control [26, 28, 34].

Gene expression in treatment with the formulations

The expression of biofilm genes hla, hlb, and pvl in MRSA isolates and blaTEM, blaCTXM, and blaOXA48 in CRKP isolates was analyzed with quantitative reverse transcription polymerase chain reaction (qRT–PCR) employing the particular primers listed in Table 1. RNA was isolated from pre-treatment resistant bacteria utilizing an RNX-Plus kit (Sina Gene, Iran) and cDNA was synthesized using the YTA Kit protocol (Yekta Tajhiz, Iran). The expression of virulence genes relative to the 16 S rRNA gene, used as a reference, was analyzed using a LightCycler from Bioneer in Daejeon, South Korea. The final reaction volume was 15 µl, comprising one µl of cDNA, one µl of forward primer, one µl of reverse primer, eight µl of master mix, and four µl of deionized water (Merck, Germany). The thermal cycling protocol included an initial denaturation step for five minutes at 95 °C, succeeded by 40 cycles of 20 s at 95 °C, 40 s at 58 °C, and 40 s at 72 °C. The concluding phase was designated to occur at 53–95 °C to provide melting curves. Gene quantitative relative expression was analyzed using the 2^−ΔΔCt method [35].

Table 1.

The primer sequence of the studied genes

Primer	Sequence (5 − 3)	Size (bp)	Reference
hla-F	TATTAGAACGAAAGGTACCA	163	[36]
hla-R	ACTGTACCTTAAAGGCTGAA
hlb-F	GGAGTGATAATGATGGTGAA	140	[36]
hlb-R	TTAGTTAGTTGAGCACTATT
pvl-F	AAATGCTGGACAAAACTTCTTGG	108	[37]
pvl-R	TTTGCAGCGTTTTGTTTTCG
blaTEM-F	AAACGCTGGTGAAAGTA	752	[38]
blaTEM-R	AGCGATCTGTCTAT
blaCTXM-F	TTTGCGATGTGCAGTACCAGTAA	544	[38]
blaCTXM-R	CGATATCGTTGGTGGTGCCATA
blaOXA48-F	GCGTGGTTAAGGATGAACAC	438	[38]
blaOXA48-R	CATCAAGTTCAACCCAACCG
16 S rRNA-F	TATCAGGACCATCTGGAGTAGG	122	[36]
16 S rRNA-R	CATCAACTTCACCTTCACGC

Cytotoxicity assay

The cytotoxicity experiment was conducted on HFF normal cells using the MTT technique, in accordance with standard ISO 10993-5. A 24-cell plate containing 5 × 10⁴ cells was used for each well. Sterile samples of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC at different concentrations (10.63, 21.25, 42.5 and 85 µg/mL) were positioned in the center of each plate under aseptic circumstances. After pre-treatment for 24 h, an adequate volume of MTT (1 mg/ml) was added to the cell layer. The interaction of Formosan solvent with isopropanol and the OD₅₆₀ nm of each cell was assessed. Then, the proportion of viable cells or the cell survival rate was determined using the following Eqs. [39, 40]:

Statistical analysis

The statistical calculation of this study was performed using SPSS version 20 and GraphPad Prism V.8 software, and the results were analyzed by one-way analysis of variance (One way ANOVA), and the difference in expression of target genes between control and treated samples was calculated using the Tukey’s HSD post-hoc test. The data were presented as mean ± standard deviation (SD), and P less than 0.5 was considered significant.

Results

Scaffold characterization

The niosomal formulations were synthesized by the TFH method. The synthesized Nio-CUR/CEF@SC were characterized by measuring the EE % of drug, size, Zeta-potential and PDI using DLS. CEF and CUR were validated at 214 and 421 nm, showing a linear regression with a correlation coefficient of 0.9967 and 0.9997, respectively. Table 2; Fig. 1A presents the DLS results of these samples’ characterization. The best formulation was selected as formulation number 3. According to Table 2; Fig. 1A, the average sizes, PDI, EE(CEF)%, EE(CUR)% and Zeta-potential of Nio-CUR/CEF@SC (F3) were 258.5 ± 6.2 nm, 0.209 ± 0.012, 80.2 ± 1.63%, 78.1 ± 1.53% and 29.8 ± 2.14, respectively. Also, the average sizes and PDI of blank-F3 formulation were 208.1 ± 4.9 nm and 0.177 ± 0.012, respectively.

Table 2.

Characterization of Niosomal formulations (Nio-CUR/CEF@SC): zeta potential, encapsulation efficiency (EE), polydispersity index (PDI), size, and composition parameters

Formulation	Span 60: Tween 60 (molar ratio)	Lipid content (µmol)	Curcumin/Ceftizoxime (mg/ml)	Sonication time (min)	Surfactant: cholesterol (molar ratio)	Size (nm)	PDI	EE (%) CEF	EE (%) CUR	Zeta potential (mV)
F1- scaffold	50:50	300	50/1	5	0.5	308 ± 8.2	0.2 ± 0.01	68 ± 1.2	65 ± 1.5	12.6 ± 2.6
F2-Scaffold	50:50	300	50/1	5	1	281 ± 5.8	0.23 ± 0.02	73 ± 1.1	70 ± 1	20.8 ± 2.55
F3-Scaffold	50:50	300	50/1	5	2	258 ± 6.2	0.2 ± 0.01	80 ± 1.6	78 ± 1	29.8 ± 2.14
F3-SC-B	50:50	300	50/1	5	2	208 ± 4.9	0.17 ± 0.01	-	-	-

Fig. 1.

A DLS, (B) SEM and (C) TEM micrograph of Nio-CUR/CEF@SC. D FTIR spectrum of Nio, CEF, CUR, Nio-CUR/CEF, Nio-CUR/CEF@SC

As illustrated in Fig. 1B–C, the morphology of Nio-CUR/CEF@SC were investigated using SEM and TEM. The SEM of scaffolds revealed a distinctly outlined, extremely porous arrangement. The resulting hydrogel has a very porous structure with interconnected pores. The TEM results demonstrated that the synthesized niosomes embedded in GT-AL polymeric composite (Nio-CUR/CEF@SC) are spherical and range in size about 100 nm. These particle sizes are much lower than hydrodynamic diameters obtained by DLS, which is due to drying samples in the TEM sample preparation procedure.

The FT-IR spectra for each component and synthesized product including Nio, CEF, CUR, Nio-CEF/CUR and Nio-CUR/CEF@SC are displayed in Fig. 1D. The FTIR results indicate peaks related to the functional groups present in the niosome compounds, including the 1110 cm − 1 peak related to the stretching C-O alcohol bond and the 1736 cm⁻¹ peak related to the stretching C = O alcohol bond in the structure of cholesterol, Tween 60, and Span 60. The spectra of pure CEF revealed the peaks at 3326 cm⁻¹ that confirmed the presence of an OH group. The peaks observed for pure Cur at 1620 cm⁻¹, 1310 cm⁻¹, and 991 cm⁻¹ corresponded to stretching of the methoxy group’s C = C, C-O stretching, and C-O-C symmetric stretching vibration. The bands associated with the OH group and C-O stretching have also manifested in the 3326 and 1310 cm⁻¹, which may have contributed to incorporating CEF and CUR into the niosome structure. In Nio-Nio-CUR/CEF@SC, by transforming niosome into a gelatin-alginate scaffold, the band associated with the stretching C–O bond of Nio-CUR was visible in the 1423 cm⁻¹ region, which can confirm the insertion of Nio-CUR/CEF in scaffold structure.

Release of CUR and CEF from scaffolds

This study evaluated the release profiles of CUR, CEF, and Nio-CUR/CEF@SC under a physiological pH of 7.4 (Fig. 2A and B). The release of CUR and CEF from scaffolds can be described as having two distinct phases. Initially, there is a rapid release that lasts for about 1–8 h. This is followed by a slower but continuous release, which continues for 72 h and can reach up to 45.6% and 42.5% of the total CUR and CEF, respectively. However, the release of pure CUR and CEF was reached to 100% after 6 h.

Fig. 2.

In vitro, the drug release profiles of (A) CUR, (B) CEF and Nio-CUR/CEF from dialysis bag

Stability of Nio-CUR/CEF @SC formulation

The behavior of nanocarriers in vitro and in vivo is influenced by their stability. Hence, an assessment was conducted to evaluate the short-term stability of the scaffolds with the most optimal size, PDI, drug entrapment efficiencies and Zeta-potential over a duration of two months. The evaluation was centered on the observation of alterations in EE, size, PDI and Zeta-potential of the scaffolds that were stored at a temperature of 4 °C and 25 °C (Fig. 3A and E).

Fig. 3.

Physical stability analysis of Nio-CUR/CEF@SC stored at a temperature of 4 °C and 25 °C for changes of (A)optimal size, (B) PDI, (C) EE (CUR), (D) EE (CEF) and (E) Zeta-potential drug entrapment efficiencies and Zeta-potential over a duration of two months (*:P < 0.05, **:P < 0.01 and ***:P < 0.001)

Figure 3A and B indicates an increase in the optimum size and PDI of the sample through the storage time. We monitored a substantial increase in size (at both temperatures) and PDI (at 25 °C) after one month storage (P < 0.01). Figure 3C and D indicates a reduction in the optimum EE of the sample (CUR and CEF) at 25 °C (P < 0.001) for one-month of storage and at 4 °C (P < 0.001) for two-month of storage. Figure 3E also shows that the Zeta-potential decreased statistically at both temperatures (P < 0.001) after two- weeks of storage. According to the above-mentioned temperatures, the stability of the sample stored at 4 ± 2 °C is greater than the sample stored at 25 ± 2 °C, which could be due to the higher stability of hydrophobic niosome at low temperatures [41].

Swelling, mechanical and biodegradation behavior of scaffolds

The water uptake value was used to analyze the swelling behavior of both Gel-Alg-SC, and Nio-CUR/CEF@SC, and the findings are presented in Fig. 4A. Interactions between gelatin and alginate chains and water molecules lead to swelling of these bio polymers, but cross-linking prevents and reduces it. The results revealed that in 240 min and all of the time intervals beyond that, the swelling ratio is 100% and there is not any difference in swelling ratios between Gel-Alg-SC, and Nio-CUR/CEF@SC. While in time intervals 60 min, 120 min and 180 min, the swelling ratio of Nio-CUR/CEF@SC is significantly higher than Gel-Alg-SC (P < 0.001).

Fig. 4.

A Gel-Alg-SC and Nio-CUR/CEF@SC swelling over 60, 120, 180, 240, 300 and 360 min. B Mechanical characteristics of Gel-Alg-SC and Nio-CUR/CEF@SC. C Gel-Alg-SC and Nio-CUR/CEF@SC biodegradation study over 7 and 14 days

The data relating to the mechanical properties test in compressive conditions is presented in Fig. 4B. Comparing the data of Gel-Alg-SC, and Nio-CUR/CEF@SC shows that the addition of Nio-CUR/CEF in scaffold has statistically increase modulus in compressive states (P < 0.001). In addition, the examination of the maximum strain data shows that the presence of Nio-CUR/CEF in the structure has caused an increase in the fracture strain in compressive condition (P < 0.001).

In-vitro hydrolytic degradation of Gel-Alg-SC, and Nio-CUR/CEF@SC has been examined in 7, 14 days at 37 °C and pH = 7.4. The percentages of weight loss for both scaffolds are indicated in Fig. 4C. Results demonstrated that in a time interval of 7 and 14 days, the percentage of degradation in Nio-CUR/CEF@SC was significantly lower than Gel-Alg-SC (27.9% and 38 (for 7 days) and 42.5 and 78.3% (for 14 days) related to Nio-CUR/CEF@SC, and Gel-Alg-SC, respectively). While, in 14 days, the degradation percentage of each formulation was considerably higher than degradation after 7 days (P < 0.001).

Bacterial identification and antibiotic resistance pattern

Table 3 shows the number of antibiotic-resistant S. aureus isolates according to the antibiogram test. 46 (86.7%) of S. aureus were resistant to Cefoxitin (most observed resistance). Vancomycin susceptibility was found in 49 (92.5%), which indicates that most of the isolates are sensitive to vancomycin antibiotic. Among 46 isolates resistant to cefoxitin, 33 isolates could form biofilm using the colored agar test. Among 33 isolates, 14 isolates were strong-biofilm bacteria, and had hlyA, hlyB and pvl genes (identified using PCR).

Table 3.

Antibiotic resistance of S. aureus isolates

Antibiotic	No. of the resistant strain	Resistant percentage relative to total strain	Sensitivity percentage
Cefoxitin	46	86.7	13.3
Penicillin	43	81.1	18.9
Ciprofloxacin	41	77.3	22.7
Cotrimoxazole	39	73.5	26.5
Ampicillin	42	79.2	20.8
Amoxicillin	43	81.1	18.9
Azithromycin	16	30.1	69.9
Tetracycline	31	58.4	41.6
Gentamycin	18	33.9	66.1
Vancomycin	4	7.5	92.5

Among 89 K. pneumoniae isolates, 23 (25.84%) carbapenem-resistant strains were found, which showed simultaneous resistance to the three antibiotics imipenem, meropenem, and ertapenem (by disk diffusion method) and were considered as the strains under investigation. Among 23 isolates resistant to carbapenems, 15 isolates could form a strong biofilm, 18 isolates (78%) have blaTEM genes, 17 isolates (73.9%) have blaCTXM, and 14 isolates (60%) have blaOXA48 genes. Then, 12 isolates (52.1%) which had all genes and could form biofilm were selected for further study (established by PCR test).

Antimicrobial activity of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC

MIC values

The antimicrobial properties of synthetic Nio-CUR/CEF@SCagainst tested strains were investigated. According to Tables 4 and 5, Nio-CUR/CEF@SC was the most successful agent at preventing the growth of the tested MRSA and CRKP bacteria. The MIC range of the CUR, CEF, and CUR/CEF was 128–256 µg/ml, 64–128 µg/ml, and 16–64 µg/ml, respectively, whereas the MIC ranges of Nio-CUR/CEF@SC was 0.25–0.5 µg/ml against MRSA isolates. The MIC value of the CUR, CEF, and CUR/CEF was also 64–256 µg/ml, 64–128 µg/ml, and 16–64 µg/ml, respectively, while the MIC value of scaffolds was 0.25–1 µg/ml against CRKP isolates Therefore, Nio-CUR/CEF@SC increased antibacterial efficiency at least 64 times, compared to combination form of drug. It shows significant antibacterial effectiveness against the studied microorganisms in comparison to pure form of drugs and their combination forms.

Table 4.

MIC values of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC formulations against MRSA isolates

Strain No.	CEF	Nio-CEF	CUR	CUR/CEF	Nio-CUR/CEF	Nio-CUR/CEF@SC
3	64	32	256	64	0.5	0.25
5	64	16	128	32	1	0.5
6	64	16	256	64	0.5	0.25
9	64	8	128	32	0.5	0.25
12	64	8	128	32	0.5	0.25
14	128	16	128	32	1	0.5
15	64	8	128	32	0.5	0.25
18	64	16	256	64	0.5	0.25
19	64	16	256	64	0.5	0.25
20	64	8	256	64	1	0.5
22	64	8	128	32	1	0.5
25	128	8	128	32	0.5	0.25
26	64	16	128	32	0.5	0.25
30	64	8	256	32	1	0.5
Standard strain	64	8	128	16	0.5	0.25

Table 5.

MIC values of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC formulations against CRKP isolates

Strain No.	CEF	Nio-CEF	CUR	CUR/CEF	Nio-CUR/CEF	Nio-CUR/CEF@SC
1	64	8	128	32	1	0.5
2	64	8	128	32	1	0.5
3	64	4	64	16	0.5	0.25
6	64	8	128	32	1	0.5
8	128	32	256	64	1	0.5
11	64	8	64	16	2	0.5
13	64	8	64	16	2	0.5
14	128	16	256	32	1	0.25
16	64	4	128	32	0.5	0.25
17	64	8	128	32	1	0.5
21	128	16	256	64	2	1
22	128	32	256	64	2	1
Standard strain	64	8	64	16	0.5	0.25

Disc diffusion results

Using a disk diffusion experiment, CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC suspensions at MIC concentrations were examined for antibacterial activity against MRSA and CRKP isolates grown on Muller-Hinton agar medium at 37 °C for 24 h. Figure 5 illustrates how the antibacterial agents may break apart bacterial cells. At MIC doses, the MRSA and CRKP strains had the most incredible sensitivity to Nio-CUR/CEF@SC, approximately recording inhibitory zone diameters of 31.5 and 30.5 mm, respectively. There was no significant difference between the inhibitory zone diameters of CUR, CEF, and CUR/CEF at MIC value against MRSA and CRKP clinical and standard strains. However, the inhibitory zone diameters dramatically increased in the medium of bacteria treated with Nio-CUR/CEF@SC compared to other groups (P < 0.001).

Fig. 5.

Diameter of zone inhibition (mm) of CEF, CUR, CUR/CEF and Nio-CUR/CEF@SC against MRSA strains (A1-A3) CRKP and (B1-B3)

Time-kill assay

The time-kill assay of MRSA and CRKP isolates against different sub-MIC of CUR, CEF, CUR/CEF, and Nio-CUR/CEF@SC is illustrated in Fig. 6. The inhibitory effect of Nio-CUR/CEF@SC was monitored as the most significant reduction in the bacterial mass. The MRSA and CRKP bacterial mass were significantly reduced after treatment with MIC doses of CUR and CEF after 72 h incubation, compared to the non-treated group. However, there was no significant difference between CUR and CEF treatment, while CUR/CEF MIC concentration had significant bacteriostatic effects against both clinical strains in comparison to CUR and CEF treatments. In 72 h, as can be seen, the bacteriostatic effect of Nio-CUR/CEF@SC is significantly higher than those of free CUR, free CEF and CUR/CEF.

Fig. 6.

Time-Kill assay study of CEF, CUR, CUR/CEF and Nio-CUR/CEF@SC against (A) MRSA and (B) CRKP strains

Anti-biofilm activity of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC

In our study, the inhibitory activity of Nio-CUR/CEF@SC against MRSA and CRKP biofilms was assessed and compared with free CUR, free CEF, and combination form of CUR/CEF (Fig. 7). The CV and MBEC assay revealed that treatment of MRSA and CRKP isolates with sub-MIC concentration of Nio-CUR/CEF@SC formulation caused more biofilm formation inhibition against all isolates compared to the free CUR, free CEF, and combination form of CUR/CEF. Notably, there was no significant difference between biofilm formation inhibitory effects of CUR and CEF, while the anti-biofilm ability of CUR/CEF was significantly higher than free CEF and free CUR. According to MBEC results (Fig. 8), the Nio-CUR/CEF@SC (about 2.5 Log ₁₀ (CFU/mL)) decreased the CFU of all tested isolates by three-fold in comparison to free CUR and free CEF (about 7.5 Log ₁₀ (CFU/mL)) and by two-fold compared to CUR/CEF formulation (about ₅ Log ₁₀ (CFU/mL)).

Fig. 7.

Anti-biofilm study of CEF, CUR, CUR/CEF and Nio-CUR/CEF@SC against MRSA (A1-A3) and CRKP (B1-B3) strains using CV assay

Fig. 8.

Anti-biofilm study of CEF, CUR, CUR/CEF and Nio-CUR/CEF@SC against MRSA (A1-A3) CRKP and (B1-B3) strains using MBEC assay

Virulence and antibiotic resistance genes expression in treatment with CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC

To ascertain whether Nio-CUR/CEF@SC inhibits the target gene, the CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC were applied to MRSA and CRKP strains, and the expression of hla, hlb and pvl mRNA in MRSA and the expression of blaTEM, blaCTXM and blaOXA-48 mRNA in CRKP were detected by real-time PCR (Fig. 9). According to Fig. 9, the addition of the Nio-CUR/CEF@SC at a sub-MIC concentration to MRSA and CRKP caused the most significant reductions of expression of all tested genes (P < 0.001). There was no significant difference between the effect of CEF and CUR on the expression of hla, hlb and pvl mRNA in MRSA and the expression of blaTEM, blaCTXM and blaOXA-48 mRNA in CRKP strains, whereas CUR/CEF, significantly reduced the mRNA expression of mentioned genes in all tested bacteria compared to the free form of drugs (P < 0.001). However, Nio-CUR/CEF@SC showed more than two-fold downregulation of the mentioned genes expression in all tested bacteria compared to CUR/CEF formulation (P < 0.001).

Fig. 9.

The effects of CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC on the expression of hla, hlb and pvl in MRSA and the expression of blaTEM, blaCTXM and blaOXA48 in CRKP detected by real-time PCR

In vitro cytotoxicity assay

In vitro cytotoxicity of HFF cell line was investigated after being treated with different formulations of drugs (CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC) for 48 h. As shown in Fig. 10, no obvious evidence of toxicity was observed for all formulations (except CUR/CEF) at 5.31 µg/mL (minimal concentration) in comparison to the control group. On the other hand, the viability of the HFF cells treated with 10.63, 21.25, 42.5 and 85 µg/mL concentrations of free CEF and CR/CEF has significantly reduced compared to control group (P < 0.001). CUR and Nio-CUR/CEF@SC showed toxicity against normal cells at 21.25, 42.5 and 85 µg/mL concentrations compared to control cells and CUR/CEF combinations (P < 0.001). These results indicate that the encapsulation of CUR/CEF in Nio@SC can reduce the induced toxicity of combination drugs in higher concentration against human normal cells.

Fig. 10.

In vitro cytotoxicity of HFF cell line was investigated after treatment with different formulations of drugs (CUR, CEF, CUR/CEF and Nio-CUR/CEF@SC) for 48 h using MTT assay

Discussion

With the emergence of antibiotic-resistant bacterial strains over the past decade, hospital- and community-acquired MRSA and CRKP have spread worldwide [42, 43]. Hence, examining this pathogen’s prevalence in samples taken from Tehran’s pathological laboratories indicated a 13.25% and 22.25% S. aureus and K. pneumoniae prevalence. On the other hand, MRSA bacteria demonstrate resistance to a variety of antibiotics, and some of its strains have indicated vancomycin resistance [44]. The present study examined the sensitivity of S.aureus and K. pneumoniae isolates, indicating that 86.79% of the isolates were MRSA (resistant to cefoxitin) and 25.84% were CRKP, which was consistent with previous research [45–47]. In addition, 71.73% of MRSA and 65.21% of CRKP isolates were capable of forming biofilms, which are among the main factors of microbial resistance among nosocomial infections [4, 48]. Research by Mirghani et al. found that the development of biofilms slows down the rate at which antibiotics penetrate the body, making it more difficult to treat infections caused by bacteria [48]. Among MRSA and CRKP isolates, 42.42% of MRSA isolates had hla, hlb and pvl genes and 52.1% of CRKP isolates had blaTEM, blaCTXM and blaOXA48 genes. Therefore, research focused on new treatment strategies as well as strategies for reducing MRSA and CRKP pathogenicity is of great importance. Given that hydrogel-based niosomal formulations are being studied as promising tools to increase compounds’ antibacterial activities, the present study focused on Nio-CUR/CEF@SC to reduce the pathogenicity of MRSA and CRKP and increase antibacterial activity against S. aureus and K. pneumoniae.

Distinct surfactant-to-cholesterol ratios were used to generate separate synthetic niosomal formulations. The therapeutic agents can be more successfully entrapped in the two layers of the vesicle through raising the quantity of cholesterol since it enhances the lipophilicity and stability of the two layers while decreasing permeability [49]. However, the drug and cholesterol compete for space between the two niosome layers due to the substantial rise in cholesterol, and the drug stays in the framework without packaging [50]. According to studies, cholesterol inhibits the penetration of solutes contained in the aqueous core of these vesicles, stabilizes bilayers, and stops leaks [51]. According to our research, Aldawsari et al., investigation showed that the 2:1 surfactant to cholesterol ratio is associated with lower size, PDI and larger EE% [52]. Therefore, the F3 formulation was revealed to have a more suitable size, PDI, EE% and Zeta-potential than other formulations. ALG and Gel have a negative charge [53], but for the great positive charge of niosomes, the Nio-CUR/CEF@SC formulation shows great positive Zeta-potential, which indicates good stability of formulation [54]. More homogeneity, stability, and a smaller PDI are indicated by structures with a PDI value less than 0.23, which also suggests higher-quality samples [55]. Also, in consistent with PDI results, SEM study indicates that bulk of particles is small and spherical, with a small number of massive particles. Moreover, the study of TEM images reveals that the morphology of the shell is inside [56]. The drying process used during SEM imaging may be the cause of the size measuring discrepancy between SEM and DLS procedures [23, 57]. The FTIR results also confirm the co-loaded niosomal formulation in scaffolds.

It has been demonstrated that the loading of CUR/CEF into Nio@SC (Nio-CUR/CEF@SC) can result in sustain release rather than explosive release of the CUR or CEF. This study’s-controlled drug release profile indicates a biphasic pattern. Given the niosome bilayer structure, the drug might reside either in the center of the niosome within the two layers or at the surface of the niosome during encapsulation [58–60]. When the drug was added to the scaffold, the scaffolds’ modulus, strain at failure, and compressive strength all enhanced. Because of the liquid medicine it contains, the polymer may become softer as a result of drug leakage and the softening impact of its low molecular weight. By increasing the surface area exposed to compressive stress, this procedure can enhance barreling behavior and, consequently, improve compressive mechanical characteristics. The absence of space and tension resistance can explain the observed drop in modulus and strength upon the addition of unloaded-SC. Furthermore, an increased hydrophilicity would have resulted from the hydroxyl groups from CEF and CUR boosting the polar components at the surface [60]. This enhanced hydrophilicity contributed to improve the swelling behavior and can enhance water absorption [60]. Furthermore, the presence of small amount of niosome in which having bilayer lipid structure, and it interaction with GEL/ALG has also may contributed to considerable reduction of hydrolytic degradation rate in Nio-CUR/CEF@SC.

The analysis of the scaffolds’ mechanical characteristics also showed that the addition of the drug to the niosome enhances its modulus, strain at failure, and compressive strength, as it alters the structure of the shell core and increases the drug loading within it. This is due to the drug softening the structure of the polymer [61]. Additionally, the Nio-CUR/CEF@SC stability was higher at 4 °C than at 25 °C, which might be due to the lower Niosome bilayer mobility at 4 °C [62, 63]. As a negative factor, the time of drug immobility has a direct relationship with nanoparticle size and an inverse relationship with the EE index. A longer drug immobility time results in a larger nanoparticle size due to particle accumulation or fusion, and the pressure resulting from nanoparticle accumulation on the niosome bilayer might result in the diffusion of the layers and a reduction in their EE [64, 65].

The other aim of the present study was to examine Nio-CUR/CEF@SC antibacterial and anti-biofilm features and the prevention or reduction of pathogenicity or antibiotic-resistant-involved gene expression. Nio-CUR/CEF@SC MIC was 128 folds and 64 folds lower than CUR/CEF combination in MRSA and CRKP strains respectively, indicating the higher efficiency of Nio-CUR/CEF@SC compared to free drugs and in combination forms. The Time-Kill assay and disc diffusion tests also confirmed this data. In this investigation, the antibacterial activity of CUR and CEF was induced by loading these agents in Nio@SC. Natural ingredients provide their alleged therapeutic properties in combination treatment. On the other hand, using nanoparticles as oral therapeutic agents can assist get around some of the disadvantages of targeted chemotherapy and offer advantages like reduced toxicity and the promotion of antibiotic resistance [66]. However, combination therapy also helps to overcome some of the associated barriers. In this regard, CUR and CEF were co-delivered to evaluate its antibacterial potential. Consistent with other studies, the results indicated that co-delivery of CUR/CEF demonstrated antibacterial efficacy against MRSA and CRKP isolates at lower doses than their individual administration [67, 68]. These higher antibacterial effects of synergic form could be due to better penetration of drug in the bacterial cell membrane [69]. Nio-CUR has substantially greater antimicrobial and anti-biofilm activities than free CUR, according to the findings of a study by Khaleghian et al. This is likely because the niosome may fuse with the bacterial cell membrane, facilitating the diffusion of CUR into the bacterial cell and resulting in the targeted release of the drug and enhanced antimicrobial action [13]. Hydrogels are safe nanocarriers and can be employed for prolonged use [70]. Curcumin-loaded hybrid hydrogels were formulated and were assessed to determine their antibacterial action against E. coli and S. aureus. The results showed stronger antibacterial action with controlled release and a high loading efficiency [71]. Another research found that once CUR was encapsulated in gelatin microparticles, its water solubility rose 38.6 times [72]. Although antibacterial activity of pure CUR was negligible at concentrations up to 100 mg/ml, gelatin-encapsulated curcumin at 4 mg/ml reduced the microbial population by 2.08, 1.67, 2.70, and 2.18 log counts (CFU/ml) for L. monocytogenes, S. enterica, S. aureus, and E. coli, respectively [72].

On the other hand, the CV and MBEC tests also indicated the Nio-CUR/CEF@SC had the highest biofilm formation and growth inhibition compared to free drugs and CUR/CEF. A variety of studies have suggested a direct relationship between the reduced efficiency of antibacterial materials and the ability to form biofilms [73]. The anti-biofilm effects of niosomes have been reported in many studies. The effects of biofilm inhibition by streptomycin-containing niosomes, imipenem-containing niosomes, quercetin-containing niosomes were reported in previous studies, which indicated that loading therapeutic agents in niosome have more antibiofilm effects than free ones [64, 74–76]. The CUR-functionalized hyaluronic acid inhibited S. aureus and P. aeruginosa biofilm formation and had a stronger anti-biofilm effect against S. aureus compared to P. aeruginosa [77], which was in line with our study that shows Nio-CUR/CEF@SC had more antibacterial activity against MRSA strains compared to CRKP isolates. According to some research, the electrostatic attachment of positively charged niosomes to negatively charged biofilm surfaces and targeted medication release within the biofilm structure are two processes behind the anti-biofilm activities of niosomes [78].

Recently, several studies have reported that both phytochemicals and nanoparticles could significantly impact bacterial antibiotic resistance and pathogenicity [15, 16]. Hence, the present study examined the impact of Nio-CUR/CEF@SC sub-MIC concentrations on hla, hlb, and pvl genes (virulence genes) in MRSA and blaTEM, blaCTXM and blaOXA48 genes (antibiotic-resistant genes) in CRKP isolates, revealing a considerable decline in the expression of these genes compared to free drugs and CUR/CEF formulation. Reducing the expression of the aforementioned genes could result in the inhibition of transcription through a direct impact and cause a reaction between Nio-CUR/CEF@SC and transcription factors, which will result in the inhibition or reduction of the expression of such genes. Some studies showed that curcumin in MRSA strains could suppress the mecA gene expression, causing a decrease in the PBP2α protein level [15]. The prepared niosome loaded vancomycin in Souri Laki et al., study was also able to significantly reduce the expression of virulence genes including mecA, hla, and hlb in MRSA strains compared to the free form of the vancomycin [36]. Additionally, Real-time PCR analysis of our previous study revealed that Gingerol/vancomycin loaded niosomes significantly reduced the expression of the fimH, blaKPC, mrkD, and Ompk36 genes in CRKP isolates [65]. On the other hand, some studies showed that encapsulation of drugs in alginate or gelatin-based scaffolds could alter the expression of virulence genes [79–81], which is inconsistent with our results.

The present study examined the toxicity of various Nio-CUR/CEF@SC formulations to HFF cells through the standard method of MTT, indicating a higher cell viability rate in groups treated with Nio-CUR/CEF@SC than in groups treated with free CEF or combination drugs. However, there was no difference between cytotoxicity of Nio-CUR/CEF@SC and free CUR, suggesting that encapsulating antibiotic in the Nio@SC is an ideal strategy for minimizing undesirable drug side effects in topical administration route. It is important that when the concentration of Nio-CUR/CEF@SC increases, it can have toxicity for cells, and therefore, it can be concluded that lower concentrations should be used for cytotoxicity studies. In line with our findings, it has been reported that despite the demonstrated cytotoxic effects of CUR on cancer cells, it seems that this matter has no effect on normal cells and is not toxic to normal cells [82]. In addition, assessing the viability of the MCF-10 A cells as healthy cells treated with paclitaxel-loaded niosomes ALG/GEL SC revealed low cytotoxicity face of healthy cells rather than free paclitaxel [61].

Conclusion

3D printing offers a practical approach for fabricating biopolymeric scaffolds. These engineered scaffolds can serve as substrates for the production of drug-loaded nanocarriers functionalized with biopolymers. In this study, we utilized 3D printing to fabricate Nio-CUR/CEF@SC nanoparticles as an effective drug delivery system for the in vitro treatment of MRSA and CRKP isolates. The engineered nanocarriers demonstrated excellent biocompatibility with HFF cells. Nio-CUR/CEF@SC exhibited strong antibacterial and anti-biofilm effects through controlled drug release and enhanced penetration into bacterial cells. Compared to previous studies utilizing single-agent delivery or non-structured carriers, our results reveal that co-delivery of CUR and CEF via a 3D-printed niosomal scaffold provides superior, synergistic effects, offering more efficient bacterial eradication and biofilm inhibition. These advances align with and extend recent research reporting enhanced antimicrobial activity and gene modulation with nanocarrier-based or combination therapies. Notably, the intelligent design of our scaffold allowed for sustained drug release, increased stability, and reduced cytotoxicity, which are important limitations in some conventional approaches. However, several limitations of this study must be acknowledged. First, all findings are based solely on in vitro assays; no in vivo investigations were performed, and thus these results should not be interpreted as proof of clinical efficacy without further validation. Second, cytotoxicity evaluation was limited to a single normal human cell line (HFF), and broader biocompatibility assessment across additional cell types is needed. Third, the stability analysis indicated a notable decrease in scaffold integrity and encapsulation efficiency at 25 °C after one month, potentially limiting the formulation’s shelf-life under certain storage conditions. Overall, our work suggests that 3D-printed, nanocarrier-loaded scaffolds hold significant promise for combating antimicrobial resistance in clinical settings. Future research should focus on in vivo validation, scale-up processes, and exploration of this platform for other resistant pathogens and therapeutic agents.

Authors’ contributions

A.S. performed the laboratory experiments and collected the data, F.A. designed the study, M.Q. wrote the manuscript; M.Q. and H.A. drew the graphs and performed the analysis. All authors reviewed the manuscript.

Funding

This research received no specific grant.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

The present study was approved by the Institutional Review Board (IRB) of the Islamic Azad University, Tehran, Iran, under the ethical code IR.IAU.TNB.REC.1403.138. All procedures involving human participants were conducted in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments. Written informed consent was obtained from all participants or their legal guardians, as applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.