Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2025 Oct 15;11(6):e70656. doi: 10.1002/vms3.70656

Deformed Wing Virus in Iranian Honeybees: Molecular Detection, Phylogenetic Diversity and Regional Insights

Mohammadreza Ghorani 1,✉, Arash Ghalyanchi Langeroudi 2, Mohammadreza Rezapanah 3,4,5, Sina Soleimani 6,✉
PMCID: PMC12523949  PMID: 41091533

ABSTRACT

Deformed wing virus (DWV) is an important pathogen for honeybee colonies, whose infections are linked to those caused by the ectoparasitic mite Varroa destructor. The current study concerns DWV's molecular detection and phylogenetic characterization in Iranian honeybee populations originating from Mazandaran, Hormozgan, Kurdistan and Khorasan Razavi provinces. DWV was detected using RT‐PCR targeting the structural polyprotein gene region, followed by sequencing and phylogenetic analysis. Among the 89 apiary samples tested, 16 (17.97%) were infected with DWV, although it was not detected in Mazandaran Province. The phylogenetic analysis showed three different groups of DWV isolates, some of which had a high similarity to strains from Syria and Yemen. These findings suggest possible relations between virus distribution and regional trade or ecological factors. The current study emphasizes the importance of geographic and molecular surveys in DWV management and insists on a more effective approach to controlling Varroa infections and reducing the incidence of viral diseases that would contribute to the health and productivity of honeybee colonies. Controlling honeybee pathogens such as mites and viruses, especially through biological control methods, will lead to better bee health and ultimately help to produce a variety of higher quality and organic honeybee products.

Keywords: deformed wing virus, honeybee, Iran, phylogenetic analysis, RT‐PCR

Bee Sampling Molecular Detection DWV Infection.

graphic file with name VMS3-11-e70656-g003.jpg

1. Introduction

The primary cause behind the collapse of honeybee (Apis mellifera L.) colonies is often attributed to the presence of deformed wing virus (DWV), which typically emerges following infestation by the ectoparasitic mite Varroa destructor (Anderson and Trueman 2000; Bailey and Ball 1991; Ball and Allen 1988; Gusachenko et al. 2021). Notably, wing deformities manifest in colonies heavily infested with the mite (Ribière et al. 2008; Sumpter and Martin 2004; Tentcheva et al. 2004). DWV was initially identified in Japan during the early 1980s and has since spread wherever varroa mites are present (Allen and Ball 1996; Calderón et al. 2003). Among the approximately 18 viruses affecting honeybees, DWV exhibits notably high prevalence, particularly in conjunction with Varroa destructor, which effectively transmits the virus (Ghorani et al. 2024; Hung et al. 1996; Lanzi et al. 2006; Norton et al. 2020). This efficacy likely stems from DWV's ability to replicate within the mite itself (Ongus et al. 2004; Shen et al. 2005; Tentcheva et al. 2006). DWV, classified within the unassigned genus Iflavirus, shares serological similarities with Egypt's bee virus (Ongus et al. 2004). Its genome consists of a positive, single‐stranded, polyadenylated RNA encompassing 10,144 nucleotides (Tentcheva et al. 2004). A single open reading frame encodes the viral polypeptide precursor, further processed into active proteins post‐translationally. Structural proteins VP2, putative VP4, VP1 and VP3 follow a leader peptide (L protein) at the N‐terminal end, while the C‐terminal part harbours non‐structural proteins, including conserved motifs of RNA helicase, VPg protein, C protease and RNA‐dependent RNA polymerase (RdRp) (Lanzi et al. 2006; Tehel et al. 2019). Early investigations in the 1980s revealed a high presence of an unstable icosahedral virus with a single‐stranded RNA genome in deformed bees (Bailey and Ball 1991). Subsequent studies confirmed a near‐complete association between wing deformities and elevated virus titers, often observed in bees from the same colonies (Chen et al. 2005; Tentcheva et al. 2006; Yue and Genersch 2005). Nonetheless, establishing a direct link between the virus and symptoms proves challenging due to the coexistence of other pathogens and the general nature of symptoms. In the absence of Varroa destructor, DWV may be detected in low concentrations across various life stages and glandular secretions without adverse effects (Chen et al. 2006). Transmission occurs horizontally (faecal‐cannibal‐oral) and vertically (parent‐offspring) among bees (De Miranda and Fries 2008; Yue et al. 2007).

Reverse transcriptase polymerase chain reaction (RT‐PCR) emerges as a valuable tool for diagnosing, identifying and characterizing bee virus infections, even at low levels (Barth et al. 2024; Grabensteiner et al. 2001). The current study employed RT‐PCR assays to sensitively detect DWV in clinical samples. In addition, the nucleotide sequences of the structural polyprotein gene region were analyzed and compared with isolates from different Iranian regions, marking the first phylogenetic analysis of DWV in Iran. A phylogenetic tree was constructed to elucidate the molecular relationships among the isolated samples.

2. Materials and Methods

2.1. Study Area and Sample Collection

Samples were taken from a total number of 89 apiaries, consisting of 23 in Mazandaran, 20 in Hormozgan, 23 in Kurdistan and 23 in Khorasan Razavi, between the years 2015 and 2016. Owing to closing up of hives during winter due to weather conditions, which prevents winter sampling, collection was done in spring, summer and autumn seasons to allow a sound evaluation concerning the absence or presence of a range of different viruses (Figure 1). A wide range of provinces, such as northern, southern, western and eastern parts of the country, were covered in this research. Collection of dead bees or bees suffering a loss of flying ability was done on a targeted selection basis to detect positive samples. Samples were collected from apiaries showing signs of the condition that is, having dead bees or bees having lost flying ability. According to the Veterinary Organization's rules and in line with OIE's regulation, samples were collected from 5% of hives within every apiary. Considering that an average apiary has around 100 hives, this meant that five hives within every apiary were sampled. A total of 500 adult bees were collected from every hive. Samples collected from every hive were then pooled. Samples were transported to a research laboratory in sealed containers and kept on ice packs during transportation, and upon arrival, were refrigerated at −20°C until analysis. In addition, it was reported that most sampled apiaries practised migratory beekeeping, which might influence both the occurrence and spread of viral infections.

FIGURE 1.

FIGURE 1

Open in a new tab

Four selected provinces of Iran were sampled.

2.2. RT‐PCR Assay

Viral RNA was extracted using a silica‐based CinnaPure RNA extraction kit (Sinaclone, Iran), according to the manufacturer's guidelines. For cDNA synthesis, we used 1 µL (0.2 µg) of random hexamer primer (SinaClone, Iran) along with 5 µL of the extracted RNA. RT‐PCR was performed using a specific set of primers: forward (5′‐CTTACTCTGCCGTCGCCCA‐3′) and reverse (5′‐CCGTTAGGAACTCATTATCGCG‐3′), designed to amplify a 194 bp fragment (Chen et al. 2004). The final volume of RT‐PCR reaction was 20 µL. Positive control was used from our previous studies. Deionized water was used as a negative control. The RT‐PCR amplification conditions were as follows: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s and a final extension step at 72°C for 10 min. Afterwards, the PCR products were sent to Bioneer, Korea, for sequencing to confirm the results.

2.3. Bioinformatics and Phylogenetic Analysis

The phylogenetic tree was constructed using the Neighbour‐Joining method and MEGA 7.0.21 software. Sequences were first aligned using ClustalW, and the robustness of the phylogenetic tree was assessed with 1000 bootstrap replications (Table 1).

TABLE 1.

Reference data from DWV isolates were used in this study.

Isolate name Country Year Accession number
5end‐6kb‐No4‐DWV United Kingdom 2009 HM162355
JO15 Jordan 2012 KT591942
VDV‐1‐DWV‐No‐9 United Kingdom 2009 HM067438
5end‐6kb‐11‐DWV‐VDV‐1‐DWV United Kingdom 2009 HM162354
SYs14 Syria 2012 KT591886
YE10 Yemen 2012 KT591918
Open in a new tab

3. Results

Of the total 89 samples studied DWV infection was detected in 16 samples (17.97%). A total of 10% of suspected apiaries in Hormozgan Province, 21.73% of suspected apiaries in Kurdistan Province, and 39.13% of suspected apiaries in Khorasan Razavi Province were infected with DWV. Through phylogenetic analysis of structural polyprotein nucleotide sequences, the DWV isolates were classified into three distinct groups. Table 2 presents the degree of identity of partial nucleotide sequences from certain Iranian DWV genes in comparison to those of DWV reference strains.

TABLE 2.

Percent identity of comparison of partial nucleotide sequences of the structural polyprotein genes of Iranian DWVs with those of DWV reference.

SYs14 YE10 JO15 5end‐6kb‐No4‐DWV 5end‐6kb‐11‐DWV‐VDV‐1‐DWV VDV‐1‐DWV‐No‐9 IR‐DWV‐GMG‐1 IR‐DWV‐GMG‐2 IR‐DWV‐GMG‐3 IR‐DWV‐GMG‐4 IR‐DWV‐GMG‐5 IR‐DWV‐GMG‐6 IR‐DWV‐GMG‐7
SYs14 100 100.000 100.000 100.000 68.262 68.262 33.294 100.000 33.294 33.294 86.052 100.000 33.294
YE10 100.000 100 100.000 100.000 68.262 68.262 33.294 100.000 33.294 33.294 86.052 100.000 33.294
JO15 100.000 100.000 100 100.000 68.262 68.262 33.294 100.000 33.294 33.294 86.052 100.000 33.294
5end‐6kb‐No4‐DWV 100.000 100.000 100.000 100 68.262 68.262 33.294 100.000 33.294 33.294 86.052 100.000 33.294
5end‐6kb‐11‐DWV‐VDV‐1‐DWV 68.262 68.262 68.262 68.262 100 100.000 84.589 68.262 84.589 84.589 86.052 68.262 84.589
VDV‐1‐DWV‐No‐9 68.262 68.262 68.262 68.262 100.000 100 84.589 68.262 84.589 84.589 86.052 68.262 84.589
IR‐DWV‐GMG‐1 33.294 33.294 33.294 33.294 84.589 84.589 100 33.294 100.000 100.000 63.890 33.294 100.000
IR‐DWV‐GMG‐2 100.000 100.000 100.000 100.000 68.262 68.262 33.294 100 33.294 33.294 86.052 100.000 33.294
IR‐DWV‐GMG‐3 33.294 33.294 33.294 33.294 84.589 84.589 100.000 33.294 100 100.000 63.890 33.294 100.000
IR‐DWV‐GMG‐4 33.294 33.294 33.294 33.294 84.589 84.589 100.000 33.294 100.000 100 63.890 33.294 100.000
IR‐DWV‐GMG‐5 86.052 86.052 86.052 86.052 86.052 86.052 63.890 86.052 63.890 63.890 100 86.052 63.890
IR‐DWV‐GMG‐6 100.000 100.000 100.000 100.000 68.262 68.262 33.294 100.000 33.294 33.294 86.052 100 33.294
IR‐DWV‐GMG‐7 33.294 33.294 33.294 33.294 84.589 84.589 100.000 33.294 100.000 100.000 63.890 33.294 100
Open in a new tab

The phylogenetic analysis revealed three distinct groups among Iranian DWV isolates (Figure 2):

  • Group 1: IR‐DWV‐GMG‐2 and IR‐DWV‐GMG‐6, showing similarities to SYs14 (accession number: KT591886) from Syria and YE10 (accession number: KT591918) from Yemen.

  • Group 2: IR‐DWV‐GMG‐5 formed a separate group.

  • Group 3: IR‐DWV‐GMG‐1, IR‐DWV‐GMG‐3, IR‐DWV‐GMG‐4 and IR‐DWV‐GMG‐7 clustered together, exhibiting 100% similarity and forming a distinct group.

FIGURE 2.

FIGURE 2

Open in a new tab

The phylogenetic tree depicts the genetic relationships among Iranian DWV samples (IR‐DWV‐GMG‐1 to IR‐DWV‐GMG‐7) based on the structural polyprotein gene, in comparison to reference strains.

4. Discussion

Phylogenetic analysis of nucleotide sequences from various strains of the same virus can greatly improve the efficiency of identifying the diversity and origins of newly emerging viruses. This method also proves valuable for monitoring the spread of specific genotypes (Bakonyi et al. 2002; Grabensteiner et al. 2001). Factors such as the number of replication cycles, replication accuracy and phenotypic effects of mutations are pivotal in the genetic separation of viruses. Phylogenetic algorithms assist in assessing the number and distribution of mutations, allowing for the inference of probable genetic relationships among the investigated strains. A greater sequence diversity offers more information and increases confidence in the analysis.

Regional differences like migratory beekeeping, ecological factors, varying levels of hive hygiene and parasite and bacterial infestation were among the factors that varied the level of DWV infection (Bakonyi et al. 2002; Tentcheva et al. 2004; Chen et al. 2006).

Our study aimed to evaluate the molecular presence of DWV and conducted the first phylogenetic analysis as part of Iran's honeybee viral infections assessment program. This initiative was prompted by the observed unusual loss in adult bee populations and significant honeybee mortality.

In our previous research, we identified three honeybee viruses in Iran (Ghorani, Madadgar et al. 2017) and characterized acute bee paralysis virus (ABPV) and chronic bee paralysis virus (CBPV) through molecular methods, constructing phylogenetic trees (Ghorani et al. 2024; Ghorani, Langeroudi et al. 2017; Meki et al. 2021). Using RT‐PCR assays and specific primers, we amplified the structural polyprotein gene fragment of DWV, observing clear and distinct bands of the expected molecular sizes (194 bp) absent in negative controls. Our focus on the structural polyprotein gene, known for its low variability, rendered it an excellent candidate for phylogenetic analysis.

Molecular characterization of DWV in suspected bee colonies revealed notable differences in virus distribution across different geographic regions of Iran. The highest DWV infection rate was recorded in Khorasan Razavi, whereas Mazandaran apiaries showed no evidence of DWV.

According to the information provided in Table 2, IR‐DWV‐GMG‐2 and IR‐DWV‐GMG‐6 exhibit the highest similarities to SYs14 from Syria, YE10 from Yemen, JO15 from Jordan and 5end‐6kb‐No4‐DWV from the United Kingdom, with 100% similarity. This observed similarity could be attributed to economic relations between Iran and neighbouring countries like Syria, Yemen and Jordan. Consequently, monitoring viruses can be facilitated by controlling the country's borders.

IR‐DWV‐GMG‐5, classified within Group 2, does not demonstrate 100% similarity to other DWVs and forms a distinct group.

Group 3 comprises IR‐DWV‐GMG‐1, IR‐DWV‐GMG‐3, IR‐DWV‐GMG‐4 and IR‐DWV‐GMG‐7, which exhibit 100% similarity. These isolates form a distinct group within the phylogenetic analysis.

5. Conclusion

This study is one of the few molecular detections and characterizations of DWV in suspected bee colonies, revealing significant differences in virus distribution across various geographic zones of Iran. Enhancing the health of honeybees by managing pathogens, particularly mites and viruses, will result in the production of high‐quality honey and premium, organic bee products. Further research endeavours should be undertaken to comprehend other aspects of this virus, particularly its pathogenesis.

Author Contributions

Mohammadreza Ghorani: methodology, conceptualization, data curation, formal analysis, investigation, writing – original draft. Arash Ghalyanchi Langeroudi: formal analysis, supervision, validation. Mohammadreza Rezapanah: writing – review and editing, supervision. Sina Soleimani: writing – review and editing, supervision.

Ethics Statement

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Peer Review

The peer review history for this article is available at https://www.webofscience.com/api/gateway/wos/peer‐review/10.1002/vms3.70656.

Acknowledgements

The authors have nothing to report.

Ghorani, M. , Ghalyanchi Langeroudi A., Rezapanah M., and Soleimani S.. 2025. “Deformed Wing Virus in Iranian Honeybees: Molecular Detection, Phylogenetic Diversity and Regional Insights.” Veterinary Medicine and Science 11, no. 6: e70656. 10.1002/vms3.70656

Funding: The authors received no specific funding for this work.

Contributor Information

Mohammadreza Ghorani, Email: mo_gh66@yahoo.com.

Sina Soleimani, Email: sina.soleimani@gmail.com.

Data Availability Statement

Data are available on request from the authors.

References

  1. Allen, M. F. , and Ball B. V.. 1996. “The Incidence and World Distribution of Honey Bee Viruses.” Bee World 77, no. 3: 141–162. [Google Scholar]
  2. Anderson, D. L. , and Trueman J. W.. 2000. “ Varroa jacobsoni (Acari: Varroidae) Is More Than One Species.” Experimental & Applied Acarology 24: 165–189. [DOI] [PubMed] [Google Scholar]
  3. Bailey, L. , and Ball B. V.. 1991. Honey Bee Pathology. 2nd ed. Academic Press. [Google Scholar]
  4. Bakonyi, T. , Grabensteiner E., Kolodziejek J., et al. 2002. “Phylogenetic Analysis of Acute Bee Paralysis Virus Strains.” Applied and Environmental Microbiology 68, no. 12: 6446–6450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ball, B. V. , and Allen M. F.. 1988. “The Prevalence of Pathogens in Honey Bee (Apis mellifera) Colonies Infested With the Parasitic Mite Varroa jacobsoni .” Annals of Applied Biology 113, no. 2: 237–244. [Google Scholar]
  6. Barth, S. , Affeldt S., Blaurock C., et al. 2024. “Characterization of a Molecular Clone of Deformed Wing Virus B.” Viruses 16, no. 6: 980. 10.3390/v16060980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Barzali, M. , and Rezapanah M.. 2022. Legal Bases and Structures of the Organic System in I. R. Iran: Food and Agricultural Products. Academic Publication of Rashdin. [Google Scholar]
  8. Calderón, R. A. , van Veen J., Arce H. G., and Esquivel M. E.. 2003. “Presence of Deformed Wing Virus and Kashmir Bee Virus in Africanized Honey Bee Colonies in Costa Rica Infested With Varroa destructor .” Bee World 84, no. 3: 112–116. [Google Scholar]
  9. Chen, Y. P. , Higgins J. A., and Feldlaufer M. F.. 2005. “Quantitative Real‐Time Reverse Transcription‐PCR Analysis of Deformed Wing Virus Infection in the Honeybee (Apis mellifera L.).” Applied and Environmental Microbiology 71, no. 1: 436–441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen, Y. P. , Pettis J. S., Collins A., and Feldlaufer M. F.. 2006. “Prevalence and Transmission of Honeybee Viruses.” Applied and Environmental Microbiology 72, no. 1: 606–611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen, Y. P. , Zhao Y., Hammond J., Hsu H.‐T., Evans J., and Feldlaufer M. F.. 2004. “Multiple Virus Infections in the Honey Bee and Genome Divergence of Honey Bee Viruses.” Journal of Invertebrate Pathology 87, no. 2–3: 84–93. [DOI] [PubMed] [Google Scholar]
  12. De Miranda, J. , and Fries I.. 2008. “Venereal and Vertical Transmission of Deformed Wing Virus in Honeybees (Apis mellifera L.).” Journal of Invertebrate Pathology 98, no. 2: 184–189. [DOI] [PubMed] [Google Scholar]
  13. Ghorani, M. , Ghalyanchi Langeroudi A., Rezapanah M., and Hajipour N.. 2024. “Molecular Characterization and Phylogenetic Analysis of Acute Bee Paralysis Virus Collected From Some Important Beekeeping Provinces of Iran.” Journal of Apicultural Research 63, no. 2: 228–232. [Google Scholar]
  14. Ghorani, M. , Langeroudi A. G., Madadgar O., et al. 2017. “Molecular Identification and Phylogenetic Analysis of Chronic Bee Paralysis Virus in Iran.” Veterinary Research Forum 8: 287–292. [PMC free article] [PubMed] [Google Scholar]
  15. Ghorani, M. , Madadgar O., Langeroudi A. G., et al. 2017. “The First Comprehensive Molecular Detection of Six Honey Bee Viruses in Iran in 2015–2016.” Archives of Virology 162: 2287–2291. [DOI] [PubMed] [Google Scholar]
  16. Grabensteiner, E. , Ritter W., Carter M. J., et al. 2001. “Sacbrood Virus of the Honeybee (Apis mellifera): Rapid Identification and Phylogenetic Analysis Using Reverse Transcription‐PCR.” Clinical Diagnostic Laboratory Immunology 8, no. 1: 93–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gusachenko, O. N. , Woodford L., Balbirnie‐Cumming K., and Evans D. J.. 2021. “First Come, First Served: Superinfection Exclusion in Deformed Wing Virus Is Dependent Upon Sequence Identity and Not the Order of Virus Acquisition.” ISME Journal 15, no. 12: 3704–3713. 10.1038/s41396-021-01043-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hung, A. C. F. , Shimanuki H., and Knox D. A.. 1996. “The Role of Viruses in Bee Parasitic Mite Syndrome.” American Bee Journal 136: 731–732. [Google Scholar]
  19. Lanzi, G. , De Miranda J. R., Boniotti M. B., et al. 2006. “Molecular and Biological Characterization of Deformed Wing Virus of Honeybees (Apis mellifera L.).” Journal of Virology 80, no. 10: 4998–5009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Meki, I. K. , Huditz H.‐I., Strunov A., et al. 2021. “Characterization and Tissue Tropism of Newly Identified Iflavirus and Negeviruses in Glossina morsitans morsitans Tsetse Flies.” Viruses 13, no. 12: 2472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Norton, A. M. , Remnant E. J., Buchmann G., and Beekman M.. 2020. “Accumulation and Competition Amongst Deformed Wing Virus Genotypes in Naïve Australian Honeybees Provides Insight Into the Increasing Global Prevalence of Genotype B.” Frontiers in Microbiology 11: 620. 10.3389/fmicb.2020.00620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ongus, J. R. , Peters D., Bonmatin J.‐M., Bengsch E., Vlak J. M., and van Oers M. M.. 2004. “Complete Sequence of a Picorna‐Like Virus of the Genus Iflavirus Replicating in the Mite Varroa destructor .” Journal of General Virology 85, no. pt. 12: 3747–3755. [DOI] [PubMed] [Google Scholar]
  23. Iran Veterinary Organization. 2013. Action Plan to Surveillance and Control of Poultry and Honeybee Disease. Iran Veterinary Organization. [Google Scholar]
  24. Rezapanah, M. , Kharrazi‐Pakdel A., Kamali K., and Huber J.. 2002. “Survey on Natural Occurrence of Cydia pomonella Granulovirus in Apple Orchards of Iran.” Journal of Applied Entomology and Phytopathology 69: 49–56. [Google Scholar]
  25. Rezapanah, M. , Shojai‐Estabragh S., Huber J., and Jehle J.. 2008. “Molecular and Biological Characterization of New Isolates of Cydia pomonella Granulovirus From Iran.” Journal of Pest Science 81: 187–191. [Google Scholar]
  26. Ribière, M. , Ball B., and Aubert M.. 2008. “Natural History and Geographical Distribution of Honey Bee Viruses.” In Virology and the Honey Bee, edited by van der Zeijst A. J. G., Mautner M. S. F., de Miranda A. J., and van der Putten M. B. M., 15–84. EU Publication. [Google Scholar]
  27. Shen, M. , Yang X., Cox‐Foster D., and Cui L.. 2005. “The Role of Varroa Mites in Infections of Kashmir Bee Virus (KBV) and Deformed Wing Virus (DWV) in Honey Bees.” Virology 342, no. 1: 141–149. [DOI] [PubMed] [Google Scholar]
  28. Sumpter, D. J. , and Martin S. J.. 2004. “The Dynamics of Virus Epidemics in Varroa‐infested Honey Bee Colonies.” Journal of Animal Ecology 73, no. 1: 51–63. [Google Scholar]
  29. Tehel, A. , Vu Q., Bigot D., et al. 2019. “The Two Prevalent Genotypes of an Emerging Infectious Disease, Deformed Wing Virus, Cause Equally Low Pupal Mortality and Equally High Wing Deformities in Host Honey Bees.” Viruses 11, no. 2: 114. 10.3390/v11020114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tentcheva, D. , Gauthier L., Bagny L., et al. 2006. “Comparative Analysis of Deformed Wing Virus (DWV) RNA in Apis mellifera and Varroa destructor .” Apidologie 37, no. 1: 41–50. [Google Scholar]
  31. Tentcheva, D. , Gauthier L., Zappulla N., et al. 2004. “Prevalence and Seasonal Variations of Six Bee Viruses in Apis mellifera L. and Varroa destructor Mite Populations in France.” Applied and Environmental Microbiology 70, no. 12: 7185–7191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yue, C. , and Genersch E.. 2005. “RT‐PCR Analysis of Deformed Wing Virus in Honeybees (Apis mellifera) and Mites (Varroa destructor).” Journal of General Virology 86, no. 12: 3419–3424. [DOI] [PubMed] [Google Scholar]
  33. Yue, C. , Schröder M., Gisder S., and Genersch E.. 2007. “Vertical‐Transmission Routes for Deformed Wing Virus of Honeybees (Apis mellifera).” Journal of General Virology 88, no. 8: 2329–2336. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are available on request from the authors.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES