Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Oct 20;112(6):82. doi: 10.1007/s00114-025-02030-x

Gamma-aminobutyric acid attenuates cortisol-induced damage in human colorectal adenocarcinoma cells via Nrf2 signaling

Yijie Liu 1, Yue Wu 1,✉
PMCID: PMC12537613  PMID: 41114738

Abstract

Long-term psychological stress is associated with increased intestinal epithelial permeability. In the human central nervous system, gamma-aminobutyric acid (GABA), a non-protein amino acid found in bacteria, plants, and animals, acts as an inhibitory neurotransmitter that controls the cardiovascular system, reduces blood pressure, enhances mood, and encourages sleep. It is still unclear how GABA controls the function of the colon epithelial barrier under long-term stress. This study explored the potential of GABA to ameliorate cortisol-induced damage in human colorectal adenocarcinoma cells (HT29) and the mechanisms at play. Our results indicate that GABA mitigated cellular damage by neutralizing the negative impacts of Cortisol on HT29 cell viability, permeability, and the expression of barrier-associated proteins. Additionally, GABA maintained the cellular barrier function and antioxidant defense. Overall, our results point to the possibility that GABA may shield HT29 cells from harm caused by cortisol by activating the Nrf2 signaling pathway.

Supplementary information

The online version contains supplementary material available at 10.1007/s00114-025-02030-x.

Keywords: GABA, Chronic psychological stress, HT29 cells, Nrf2 signaling pathway, Antioxidation

Introduction

Changes in bowel habits and discomfort or pain in the abdomen are hallmarks of irritable bowel syndrome (IBS), a prevalent functional gastrointestinal illness (Ford et al. 2020; Thomas et al. 2024; Mandiola et al. 2024; Ying et al. 2024). There is increasing evidence that diarrhea-prone IBS symptoms may result from disruption of the intestinal epithelial barrier function (Shawki and McCole 2016). For instance, in patients with IBS, there is a positive correlation between increased paracellular permeability and gastrointestinal pain (Fortea et al. 2021). Increased stress’ impact on the intestinal barrier has recently been suggested as a possible mechanism behind IBS pathophysiology (Zhang et al. 2024a; Söderholm and Perdue 2001; Konturek et al. 2011). Chronic stress has a substantial impact on gut physiology in animal models as well as IBS patients, leading to altered gastrointestinal motility, hyperalgesia (an increase in visceral pain perception), and impaired intestinal barrier function (Leigh et al. 2023; Zou et al. 2024; Zhang et al. 2024b; Yue et al. 2024; Cui et al. 2024).

Cortisol is widely recognized as one of the key glucocorticoid hormones secreted in response to the hypothalamic–pituitary–adrenal (HPA) axis (Timmermans et al. 2019). It is important for protein, lipid, and carbohydrate metabolism, as well as immune response modulation (Russell and Lightman 2019). Cortisol likewise impacts behavior, mood, neuroendocrine function, pain perception, and temperature control. Approximately 80–90% of the cortisol in the circulation binds to corticosteroid-binding globulin (CBG) under normal physiological circumstances (Bae and Kratzsch 2015). On the other hand, because of its decreased affinity for CBG, the tissues’ 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) transforms circulating cortisone, the inactive version of cortisol, into active cortisol (Chapman et al. 2013). Given the blood’s restricted binding ability under stress, a higher proportion of cortisol circulates in its unbound, inactive form, raising local tissue GC levels. Furthermore, the skin and gut have a peripheral HPA axis, capable of secreting multiple neuropeptides such as corticotropin-releasing hormone (CRH), POMC, oxytocin, and cortisol (Téblick et al. 2019).

In ulcerative colitis (UC) and IBS, oxidative stress is a major pathogenic component that promotes inflammation through a variety of mechanisms (Jena et al. 2012). First, it activates immune cells associated with inflammation, such as macrophages and neutrophils, which in turn cause the production of inflammatory mediators such as cytokines, interleukins, and chemokines (Mohammadpour et al. 2024). Inflammatory reactions are triggered by this. The colonic mucosa is also harmed by oxidative stress, which results in protein, DNA, and cell membrane deterioration. These byproducts of oxidative damage trigger additional inflammatory reactions, which in turn trigger the release of mediators and increased activation of immune cells.

Furthermore, intestinal inflammation is exacerbated by oxidative stress because it triggers the activation of redox-sensitive factors associated with transcription, particularly nuclear factor κB (NF-κB) and activator protein 1 (AP-1) (Li et al. 2014; Jia et al. 2021; Xiao et al. 2024). These factors then encourage the excessive release of inflammatory mediators like COX-2 and TNF-α (tumor necrosis factor-α) (Matos et al. 2024). Therefore, reducing oxidative stress is essential for avoiding intestinal inflammatory chemical production and the ensuing tissue damage.

By controlling the production of antioxidant proteins, nuclear factor erythroid 2-related factor 2 (Nrf2), a basic leucine zipper (bZIP) transcription factor, is essential for preserving cellular redox homeostasis and preventing cell damage (Chu et al. 2024). Under typical circumstances, Nrf2 is attached to Kelch-like ECH-associated protein 1 (Keap1), promoting its ubiquitin-dependent degradation (Cai et al. 2023). Nrf2 avoids Keap1-mediated degradation during oxidative stress, translocates to the nucleus, attaches to antioxidant response elements (ARE), and starts the transcription of genes that depend on ARE, such as quinone oxidoreductase 1 (NQO-1), heme oxygenase 1 (HO-1), glutathione S-transferase (GST), and glutathione peroxidase 4 (GPX4) (Bellezza et al. 2018). Studies show that increased Nrf2 and HO-1 protein levels can lower pro-inflammatory cytokine levels and oxidative stress (Wang et al. 2024a); by lowering pro-inflammatory reactions and mucosal damage, Nrf2 preserves mucosal homeostasis, especially in IBS and UC (Kobayashi et al. 2016). Moreover, NF-κB can be suppressed by inducing the Nrf2/HO-1/NQO-1 pathway (Zhang et al. 2021). By inhibiting AP-1 activation, NF-κB activity suppression lowers the rapid release and buildup of pro-inflammatory mediators (Zheng et al. 2020). Therefore, it makes sense to target the Nrf2/NF-κB/NQO-1/HO-1/AP-1 signaling pathway to lessen intestinal inflammation and tissue damage caused by increased oxidative stress.

Gamma-aminobutyric acid (GABA) is a neurotransmitter that inhibits neuronal excitability in the central nervous system, synthesized from glutamic acid and regulated by vitamin B6. It plays a key role in reducing anxiety, stress, and promoting sleep. GABA also influences metabolic processes and has potential health benefits. Nevertheless, it is unclear if GABA can stop the increased permeability in chronic stress cell types in vitro. The current study set out to investigate the theory that GABA inhibits the tight junction proteins of the colon epithelium, as well as the rise in paracellular permeability and the release of inflammatory factors. The HT29 cell line was employed in this investigation as an in vitro tool to examine whether GABA protects against cellular damage caused by cortisol exposure and, if so, to further elucidate the inherent molecular mechanism for its protective function.

Materials and methods

Experimental materials

GABA (purity 98%) was commercially obtained from Bloomage Biotechnology Corp., Ltd., and cortisol was procured from Sigma-Aldrich (St Louis, MI, USA). Nrf2 activator 4-Octyl itaconate (HY-112675) and inhibitor ML385 (HY-100523) were from MedChemExpress (Monmouth Junction, NJ, USA).

Cell lines and their treatment

The human colorectal adenocarcinoma cells (HT29) are purchased from Procell Bio (Wuhan, CH). McCoy’s 5 A medium containing 10% fetal bovine serum (FBS, Gibco) was used for growing and maintaining cell lines; the medium also contained a 1% solution of streptomycin-penicillin (P/S)-amphotericin B (P/S, Gibco) in an incubator with 5% CO2 and at 37 °C. Subcultured cells were utilized for additional tests after they reached 80% confluency. All reagents not specifically stated were from Sigma-Aldrich.

Assessment of cell viability

Using MTT (3-[4,5-dimethylthiazol-2-yl]−2,5-diphenyltetrazolium bromide, VWR Corp., Ohio, USA) reduction tests. After being sown at 2 × 104 cells/well into a 96-well plate, HT29 cells were left to attach for the entire night. The cells were subjected to GABA treatments at solution strengths in the range of 0.025% to 10% for a minimum of 72 h while they were incubated. DMSO was used to solubilize the purple formazan that resulted after removing the culture supernatants. Absorbance was measured at 550 nm employing a microplate spectrophotometer, MULTISKAN-Sky (Thermo Fisher Scientific, USA). Calculations of cell viability were made with respect to the absorbance of the negative control group.

Reactive oxygen species (ROS) production estimation

To measure intracellular ROS, the ROS Assay Kit from Beyotime (S0033) was used. Six-well plates were used to inoculate HT29 cells. The cells were subjected to 100 µM cortisone and GABA treatment. A fluorescent microplate Cytation5 from BioTek (Winooski, VT, USA) was used to detect the cells after they had been digested with trypsin enzyme and treated with 10 µM DCFH-DA for 60 min in the absence of light. The measurement was made at 488 nm excitation and at 525 nm emission to express the fluorescence intensity.

Enzyme-linked immunosorbent assay (ELISA)

After 48 h of incubation, the supernatant was removed and subjected to centrifugation for 5 min at 1000 rpm. The level of TNF-α in the supernatant was then estimated using the TNF-α ELISA Kit (Lianke) in compliance with the protocol. The RIPA buffer (Solarbio) was used to extract all proteins from the cells. The total protein content was quantitatively estimated using a Thermo Fisher Scientific BCA kit. The amount of total protein was a reference for the quantity of TNF-α and IL-6 secreted by each group. An unpaired t-test was utilized to assess all the data, and a statistical difference was defined as p < 0.05.

Measurement of the permeability of FITC‐dextran

Using HT29 cells as a model representing the human intestinal epithelium, the assay was used to assess how treatments affected the integrity of the tight junctions between the cells. At a density of 2 × 105 cells/Transwell, HT29 cells were seeded on 12-mm polyester Transwell filters of 24-wells from Corning (USA) with a pore size of 0.4 µm. For 14 days, cells were cultured in McCoy’s 5 A medium supplemented with 10% FBS and P/S added until they developed differentiation. In order to treat the apical location (upper chamber) of the Transwell cultures at the apical epithelial cells in human colon crypts, 100 µM cortisol was administered (Lian et al. 2021). Fluorescein isothiocyanate (FITC)-dextran (4 kDa; 3 mg/mL) was added to the upper chamber with no change in the medium in order to assess dextran permeability. After 4 h, aliquots were taken out of the lower chambers and examined for fluorescence at 515 nm using excitation at 492 nm.

Quantitative reverse transcription polymerase chain reaction

After plating in a 6-well plate, HT29 cells (2 × 105 cells/well) were cultivated for a full day. After that, the cells were given a PBS wash and left in a medium devoid of supplements for 24 h. The cells were subjected to GABA or cortisol therapy once they had achieved 50–60% confluency. After this treatment, samples of total RNA were isolated from the cells using the TRIzol reagent, and the samples were quantified using a microspectrophotometer (Merinton Instrument, SMA4000, CHN). Next, in accordance with the manufacturer’s recommendations, an equivalent volume of every sample of RNA was used to prepare cDNA (complementary DNA) employing Maxima Reverse Transcriptase (Thermo Scientific, USA). Employing a CFX Real-Time System (Bio-Rad, USA), qPCR was performed in a final volume of 20 µL, comprising Universal SYBR Green Supermix (10 µL) from Bio-Rad (USA), 0.6 µM per primer, and template cDNA (50 ng). The reference gene used to normalize gene expression was β-actin. The following primers were employed (Table 1).

Table 1.

Primers (and their sequences) used for RT-PCR

Primer target Sequence forward Sequence reverse
Bax CGGGTTGTCGCCCTTTTCTA GTCCAATGTCCAGCCCATG
Bcl2 CGACGACTTCTCCCGCCGCTACCGC CCGCATGCTGGGGCCGTACAGTTCC
Caspase3 TGGAACAAATGGACCTGTTGACC AGGACTCAAATTCTGTTGCCACC
ZO1 CTCAAGTTCCTGAAGCCGGT CGACGAGGAGTCGGATGATT
Claudin1 CCATCTTTGTGGCCACCGTT CCATTCGCATCTTCTGTGCC
Occludin GAGAGATGCACGTTCGACCA CGGGAGGAGAGGTCCATTTG
Nrf2 TAGATGACCATGAGTCGCTTGC GCCAAACTTGCTCCATGTCC
HO1 TCTATCGTGCTCGCATGAAC CTGTCTGTGAGGGACTCTGG
NQO1 TACGACAACGGTCCTTTCCAG ACAGAAACGCAGGATGCCACT
β-actin CTCTTCCAGCCTTCCTTCCT GGGCAGTGATCTCTTTCTGC
Open in a new tab

Detection and determination of protein concentration

In T25 cell culture flasks, HT29 cells (1 × 106 cells/flask) were added and cultured for a duration of 24 h. Every medium was eliminated, and the medium devoid of supplements was added. After that, the cells were cultivated for 30 min with either a vehicle or 1 mg/mL of GABA. The cells were then separated and lysed employing a solution for protein extraction in order to perform the radio immunoprecipitation test (RIPA, Thermo Fisher, USA). Proteins in the lysates were resolved by SDS-PAGE and transferred to a Whatman nitrocellulose membrane (Dassel, Germany) after being centrifuged at 13,000 × g at 4 °C. After 2 h of incubation in tris-buffer saline (harboring 0.05% Tween 20 and 5% BSA), the membranes were left for 8 to 10 h at 4 °C to be treated with primary antibodies. Next, an ECL reagent was used to identify the secondary antibody that had been coupled with horseradish peroxidase after it had reacted for 2 h at RT. Using ImageJ, the discovered band was densitometrically estimated. (raw images of the western blot analysis are included in Supplementary File-WB original images).

The antibodies employed in the experiment were as follows:

Anti-Claudin1 antibody (AF0127), anti-occludin antibody (DF7504) (Affinity, California, USA), anti-laminin B antibody (12,987–1-AP) (Proteintech, Chicago, USA); anti-NQO1 antibody (ab80588), anti-Nrf2 antibody (ab62352), anti-ZO1 antibody (ab276131), goat anti-rabbit IgG H&L (HRP) (ab6721), and anti-β-actin antibody (ab8227) were procured from Abcam (Cambridge, UK).

Statistical analysis

The Student t-test was applied to acquire the p-values. Statistical significance was deemed at p < 0.05, with p-values denoted as *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05. The values are calculated from a minimum of three replicates and expressed as mean ± standard deviation (SD).

Results

GABA effect on the viability of human colorectal adenocarcinoma cells

The MTT assay was conducted to evaluate how GABA affected the HT29 cell’s ability to survive. Our findings revealed that GABA, at concentrations as high as 1% (m/v, 10 mg/mL), had no effect on the survival of cells (Fig. 1). However, cell activity was affected under high GABA treatment at 10% (m/v, 100 mg/mL). The latter was chosen to add a 0.1% concentration of GABA for the relevant tests.

Fig. 1.

Fig. 1

Open in a new tab

Effect of GABA on human colorectal adenocarcinoma cell viability. The cells were exposed to various dosages of GABA (0.025%, 0.05%, 0.10%, 0.20%, 0.50%, 1%, 2%, 5%, and 10%, m/v) or the control (culture media) for a duration of 72 h. The MTT test was used to measure cell viability. The following expressions suggest statistically significant values: ns indicates p > 0.05; * indicates p < 0.05; and *** indicates p < 0.001

GABA alleviated cortisol-induced apoptosis

Apoptotic gene expression was seen and detected using RT-qPCR. As illustrated in Fig. 2, cortisol significantly suppressed the Bcl2 gene and elevated the levels of the Caspase3 and Bax genes in comparison to the control group (p < 0.01). In contrast to the cortisol group, our results indicate that GABA increased the expression of the Bcl2 gene (p < 0.05) and decreased the transcript expression of Caspase3 (p < 0.001) and Bax (p < 0.001) in the GABA + cortisol group (Fig. 2A–C).

Fig. 2.

Fig. 2

Open in a new tab

Effect of GABA on cortisol-induced apoptosis. Treatment of the cells was either vehicle (labeled as “CN”) or cortisol (100 µM) with or without GABA (0.1%, 1 mg/mL) for 12 h. Quantitative RT-PCR was used to produce and evaluate total RNA samples. A–C Bax, Bcl2, and Caspase3 relative expression. Data are shown as mean ± standard error of the mean (SEM; n = 3); * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001

Reduction in cortisol-induced ROS production upon GABA treatment

Following treatment of the HT29 cells with cortisol and GABA, the cortisol group showed a higher buildup of ROS than the control group (p < 0.001). However, following GABA (0.1%) therapy, there was no discernible change in ROS generation relative to the control group. Furthermore, the intracellular ROS concentration decreased in the GABA + cortisol treatment group as compared to the cortisol group (Fig. 3, p < 0.01).

Fig. 3.

Fig. 3

Open in a new tab

Effect of GABA on the levels of ROS within the cells. Fluorescence was estimated using a fluorescent microplate reader. Data are presented as mean ± SEM (n = 3). Treatment of the cells was either vehicle (labeled as “CN”) or cortisol (100 µM) with or without GABA (0.1%, 1 mg/mL) for 12 h; * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001

GABA decreased cortisol-induced inflammatory factor secretion

Following cortisol and GABA administration of HT29 cells, the cortisol group secreted more IL6 and TNF-α than the control group (p < 0.01). However, when comparing the GABA (0.1%) treatment group to the control group, no obvious distinction was noted in inflammatory factor production. Furthermore, cellular inflammatory factor release was lower in the GABA + cortisol group than in the cortisol group alone (Fig. 4, p < 0.01).

Fig. 4.

Fig. 4

Open in a new tab

The impact of GABA on inflammatory factor secretion levels. ELISA revealed that the GABA and cortisol co-treated groups secreted less TNF-α and IL-6. The values are given as mean ± SD. The unpaired t-test was employed to estimate p-values. *Importance of the treated group relative to the control group; * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001

GABA could attenuate damagen to the cellular tight]unction damage mediated by cortisol

For gut health, the intestinal physical barrier is essential. The tightness of the intestinal junctions determines its integrity. The gut’s integrity is compromised when it is harmed by microorganisms, toxic substances, and internal stressors. We found that the RNA expressions of ZO-1, occludin, and claudin1 were considerably reduced by cortisol (p < 0.01). The suppression of ZO-1 (p < 0.01), CLDN (p < 0.05), and OCLD (p < 0.01) mRNA expressions caused by cortisol was reversed by GABA pretreatment (Fig. 5E–G). Tight junction protein (ZO1, CLDN, OCLD) level was enhanced in the GABA + cortisol group (Fig. 5A–D, p < 0.05), which is consistent with the western blotting and RT-qPCR results as compared to the cortisol group.

Fig. 5.

Fig. 5

Open in a new tab

The impact of GABA on the levels of intestinal tight junction proteins. A–D ZO1, occludin, and claudin1 protein expression presented through western blotting. E–G Expressions of ZO1, occludin, and claudin1 mRNAs in HT29 cells. The data are presented in terms of the mean ± SEM (n = 3). CN: control group; COR: 100 µM cortisol group; COR + GABA: 1 mg/mL GABA + 100 µM cortisol group; * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001

Effects of GABA on HT29 cells paracellular permeability

FITC-dextran leakiness was assessed in differentiated HT29 cell monolayers following cortisol administration with or without GABA. Figure 6 illustrates how the intensity of 4 kDa FITC-dextran in the chamber at lower levels of the Transwell cell cultures was significantly enhanced in the differentiated HT29 monolayers compared to the controls (p < 0.001; n = 4). GABA therapy considerably decreased this increase compared to the control group (p < 0.01; Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

The impact of GABA on paracellular permeability in HT29 cells. Measurements of paracellular permeability in differentiated HT29 monolayers with and without GABA and cortisol. FITC-dextran (4 kDa) permeability assay in 14-day-grown HT29 cells following a 24-h treatment with 100 µM cortisol, both with and without GABA (1 mg/mL). CN: control * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001

GABA mitigated cortisol-induced cellular damage, potentially by activating the Nrf2 signaling pathway in HT29 cells

One plausible mechanism underlying GABA’s antioxidant activity is the activation of the Nrf2 signaling pathway. As shown in Fig. 7A–C, GABA pretreatment mitigated cortisol-mediated suppression of Nrf2 and its key target genes, HO-1 and NQO1. Compared with the cortisol group, GABA supplementation significantly enhanced the transcript levels of NQO1 (p < 0.01), HO-1 (p < 0.05), and Nrf2 (p < 0.05). Western blot analysis further confirmed the upregulation of NQO1 and Nrf2 proteins, which was consistent with the RT-qPCR results. Notably, the GABA + cortisol group exhibited higher levels of cytoplasmic Nrf2 and NQO1 expression (Fig. 7D–G, p < 0.01), while nuclear Nrf2 expression was decreased. These findings suggest that GABA may counteract oxidative stress induced by chronic stress through Nrf2-mediated mechanisms.

Fig. 7.

Fig. 7

Open in a new tab

The impact of GABA on the Nrf2 signaling pathway in HT29 cells exposed to cortisol. A–C A comparison of expressions of Nrf2, NQO1, and HO-1. D Determination of the expression of Nrf2 nuclear protein through western blotting. E Nrf2 cyto-protein and NQO1 levels. Data are presented as mean ± SEM (n = 3). CN: control group; COR: 100 µM cortisol group; COR + GABA: 1 mg/mL GABA + 100 µM cortisol group. *p < 0.05; **p < 0.01; ***p < 0.001

To further validate the role of Nrf2 in GABA’s protective effects, we employed a Nrf2 activator (4-Octyl itaconate, 4-OCT) and inhibitor (ML385). As illustrated in Fig. 8, GABA (0.1%) treatment mimicked the effects of the Nrf2 activator, whereas pretreatment with the Nrf2 inhibitor ML385 (10 µM) abolished cortisol-induced changes in Nrf2 expression and associated barrier protein expression (Fig. 8A–D). Western blot analysis confirmed that both GABA and 4-OCT enhanced cytoplasmic Nrf2 phosphorylation and nuclear Nrf2 accumulation, while ML385 blocked these responses (Fig. 8A–J). Collectively, these results demonstrate that GABA-mediated antioxidant protection is dependent on Nrf2 pathway activation, as pharmacological modulation of Nrf2 activity either abrogated or mimicked GABA’s effects on oxidative stress markers.

Fig. 8.

Fig. 8

Open in a new tab

Validation of GABA regulation of the Nrf2 pathway in cortisol-treated HT29 cells. The expression of ZO1 (A, B), Claudin1 (A, C), Occludin (A, D), cyto-Nrf2 (E, F), NQO1 (F, G), HO-1 (F, H), and nuc-Nrf2 (I, J) was assessed by western blot. Results were mean ± SD for three individual experiments. *p < 0.05, **p < 0.01. Data are presented as mean ± SEM (n = 3). NC: control group; COR: 100 µM cortisol group; COR + GABA: 1 mg/mL GABA + 100 µM cortisol group; Nrf2in + COR:10 µM ML385 + 100 µM cortisol group; Nrf2act + COR:10 µM 4-OCT + 100 µM cortisol group; GABA + NrF2in + COR: 1 mg/mL GABA + 10 µM ML385 + 100 µM cortisol group. *p < 0.05; **p < 0.01; ***p < 0.001

Discussion

The gastrointestinal tract is a critical organ system that extends from the mouth to the anus, playing a key part in digestion and absorption of nutrients, as well as the elimination of waste. The gut is lined with a specialized epithelium that forms a physical barrier, preventing the passage of harmful substances into the bloodstream while allowing the absorption of essential nutrients. This barrier is maintained by proteins in the tight junction, such as claudins, occludin, and zonula occludens, which are dynamically regulated by various signaling pathways in response to the gut microenvironment (González-Mariscal et al. 2003).

These days, more and more people are being diagnosed with leaky gut, a pathological increase in intestinal barrier permeability. There are several factors that can cause this illness; however, most of them are external. The detrimental effects of intestinal barrier disruption include immune response, the development of chronic inflammation, microorganism translocation deep into intestinal tissue, and dysbiosis (Macura et al. 2024; Vincenzo et al. 2024; Covello et al. 2024). These occurrences may ultimately result in a vicious cycle that encourages barrier deterioration and inflammation. When barriers are breached in mucosal tissues, activated immune cells might go to other organs and affect how well they operate. In addition to systemic inflammatory conditions like rheumatoid arthritis (Qi et al. 2024), hepatitis, ankylosing spondylitis, and lupus erythematosus, as well as neurodegenerative or mental disorders and metabolic conditions like obesity or diabetes, a compromised intestinal barrier can also lead to the development of localized diseases like inflammatory bowel disease, irritable bowel disease, or celiac disease (Wang et al. 2024b).

There is growing recognition that psychological stress has a substantial effect on intestinal health. In turn, stress can impact the intestinal epithelial barrier by changing the gut microbiota’s constitution and activity. Because of this stress-induced dysbiosis, the intestinal barrier may be weakened, resulting in “leaky gut,” a disorder where the intestinal lining becomes more porous, allowing toxins and food particles that have not been fully digested to enter the bloodstream (Verma et al. 2024). Obesity, metabolic problems, and inflammatory bowel diseases (IBD) are among the chronic diseases that have been connected to these intestinal barrier abnormalities. One important mediator of stress’ effects on the stomach is the gut-brain axis, a term used to define the association between the brain and the gut (Warren et al. 2024). Signals of stress from the brain can impact the microbiota in the gut and the intestinal epithelium, potentially leading to changes in barrier function. This axis is bidirectional, meaning that the gut can also signal back to the brain, influencing cognitive and emotional processes.

Chronic stress has a major impact on physical as well as mental health, making it an important component in modern life. Cortisol, an adrenal gland-secreted glucocorticoid hormone, is essential to the stress response (Sic et al. 2024). While the release of cortisol is adaptive when experiencing severe stress, chronic exposure to high amounts can have negative consequences. Cortisol production, which affects the immunological response, metabolism, and neurobiology, is regulated by the HPA axis. From the paraventricular nucleus, CRH is sent to the hypophyseal portal system by the hypothalamus upon recognition of a stressor. Adrenocorticotropic hormone (ACTH) is subsequently released by the anterior pituitary gland in response to stimulation from CRH (Szczepanska-Sadowska et al. 2024). The adrenal cortex receives ACTH from the bloodstream, where it binds to melanocortin receptors and induces cortisol production and release. Besides contributing to neurodegenerative conditions, such as cognitive deficits and an increased vulnerability to psychiatric diseases, enhanced levels of cortisol are linked to the onset and worsening of metabolic disorders such as IBD.

In addition to cortisol, chronic stress releases hormones like adrenaline and norepinephrine, which, while essential for acute responses, can cause long-term cardiovascular issues and worsen stress-related conditions when constantly elevated (Perrelli et al. 2024). Stress also has a significant impact on neurotransmitters such as GABA, serotonin, and dopamine. By changing motivation, stress resilience, and mood regulation, disturbances in these systems can exacerbate mood disorders such as anxiety and depression (Megha et al. 2021). Systemic inflammation results from prolonged stress, which raises the release of proinflammatory cytokines like TNF-α and IL-6. This inflammation highlights the connection between stress, immune function, and overall health by exacerbating metabolic issues and accelerating neurodegenerative processes (Megha et al. 2021; Kuo et al. 2015).

GABA is a neurotransmitter that inhibits neuronal excitability in the central nervous system. It is known to have a variety of physiologic effects, including lowering stress, anxiety, inflammation, and encouraging sleep. GABA offers possible health advantages and affects metabolic functions as well. As anticipated, GABA mitigated the reductions in cell damage brought on by cortisol in this investigation.

Inducing apoptosis by entering cells, cortisol sets off a chain of events that are harmful to the body’s health (Geer et al. 2014). Apoptosis depends on the activities of Caspase3, Bax, and Bcl2 (Hussar et al. 2022). In the present investigation, cortisol administration markedly suppressed Bcl2 expression while increasing that of the Caspase3 and Bax genes. This suggests that the intestine apoptotic mechanism is overloaded by cortisol-induced increased cell apoptosis, which results in intestinal damage. This shows that GABA can prevent intestinal damage by preventing intestinal cell apoptosis brought on by cortisol. It also implies that one method GABA facilitates the development of the intestine and protects the intestinal tract from continuous stress-induced damage potentially through the apoptotic pathway.

The overproduction of ROS by mitochondria is typically the cause of apoptosis. The natural redox equilibrium of cells can be destroyed by excessive ROS formation, which can also worsen oxidative response; degrade cell proteins, lipids, and nucleic acids; promote apoptosis; and have an impact on body health (Hussar et al. 2022). Furthermore, oxidative stress is typically brought on by excessive ROS generation, and this leads to cell malfunction or even death (Daiber et al. 2020). The results of this investigation indicate that GABA pretreatment considerably decreased the formation of intracellular ROS produced by cortisol.

One of the primary causes of intestinal disorders is the breakdown of the intestinal barrier. Numerous intestinal and systemic illnesses might result from upsetting the delicate equilibrium between selective permeability and barrier function. The tight junction, the primary constituent of the physical barrier of the intestine, is a closed channel made up of several proteins. It controls the intestinal barrier’s paracellular permeability and stops dangerous chemicals and foreign infections from entering the bloodstream. To maintain the tight junction structure’s stability, these relative proteins use mechanical stress to dynamically carry out the construction of tight junctions employing membrane lipids (González-Mariscal et al. 2003). In this investigation, we discovered that cortisol enhanced the release of TNF-α and IL6 while significantly lowering the levels of occludin, ZO-1, and claudin1. The permeability of intestinal monolayer cells was enhanced by cortisol. Prior research has also demonstrated that long-term stress reduces the expression of tight junction proteins, which compromises intestinal integrity and impacts intestinal permeability. These results corroborate our study’s conclusion that GABA preserves the intestinal barrier’s integrity by promoting the expression of tight junction proteins of the intestine and halting damage to the barrier caused by cortisol.

This suggests that by increasing intestinal antioxidant capacity, GABA can promote intestinal health and guard against cortisol damage. Furthermore, Nrf2 is an essential transcription factor that controls redox equilibrium. Numerous natural antioxidants have been shown to restore Nrf2 expression and its downstream targets, hence reducing oxidative stress caused by mycotoxins. GABA dramatically raised the levels of NQO1, Nrf2, and HO-1 in this investigation. Additionally, GABA ameliorated the suppression of NQO1, Nrf2, and HO-1 production brought on by cortisol. According to this research, GABA may improve antioxidant capacity and promote intestinal development by reducing intestinal damage caused by cortisol, possibly through the Nrf2 signaling pathway. GABA’s potential as a protective functional food for the intestine is significant; it could serve as a dietary supplement to bolster intestinal health. Future applications may include developing GABA-enriched foods that promote a healthy gut barrier and prevent leakage, which is crucial for overall digestive and immune system support. Additionally, GABA’s role in mitigating stress-induced intestinal damage suggests its use in stress-reduction therapies and products aimed at maintaining homeostasis in the gut ecosystem.

Conclusions

In conclusion, in this study, GABA mitigated the reduction in cellular damage brought on by cortisol (100 µM) and reduced the generation of ROS and cellular apoptosis brought on by cortisol (Fig. 9). Additionally, GABA could also mitigate a decrease in cellular barrier function brought on by cortisol and enhanced antioxidant qualities and triggered the Nrf2 signaling pathway, both of which were inhibited by cortisol. The upregulated expression of Nrf2, HO-1, and NQO1 genes supported these conclusions. Thus, GABA may further shield the gut from harm brought on by chronic stress and support intestinal growth and well-being. The study findings provide ideas on potential future advancements in the use of GABA as a functional health food and bowel care agent.

Fig. 9.

Fig. 9

Open in a new tab

The schematic diagram depicts the mechanistic interplay of stress-induced gut-brain communication and the protective role of GABA in modulating the Nrf2 signaling pathway in cortisol-exposed HT29 cells

Supplementary information

Below is the link to the electronic supplementary material.

Supplementary File 1 (PNG 2.43 MB) (2.4MB, png)
High Resolution Image (TIF 29.9 MB) (29.9MB, tif)
Supplementary File 2 (PNG 3.12 MB) (3.1MB, png)
High Resolution Image (TIF 41.4 MB) (40.3MB, tif)
Supplementary File 3 (PNG 2.93 MB) (2.9MB, png)
High Resolution Image (TIF 34.7 MB) (34.7MB, tif)
Supplementary File 4 (PNG 3.40 MB) (3.4MB, png)
High Resolution Image (TIF 40.2 MB) (41.4MB, tif)

Acknowledgements

The authors are appreciative of Bloomage Biotechnology Corp., Ltd.'s financial support. We thank the American Type Culture Collection for providing the cell lines and bacterial strain.

Author contributions

Conceptualization, Y.J.L. and Y.W.; methodology, Y.J.L. and Y.W.; investigation, Y.J.L.; resources, Y.W.; writing—original draft preparation, Y.J.L.; writing—review and editing, Y.J.L. and Y.W.; visualization, Y.J.L. and Y.W.; supervision, Y.W.; project administration, Y.J.L.; funding acquisition, Y.J.L. and Y.W. All authors have read and agreed to the published version of the manuscript.

Funding

These studies were a sponsored research collaboration with Bloomage Biotechnology Corporation Limited, which provided research support for the GABA samples.

Data availability

The study’s supporting data are not publicly available because they contain information that might compromise Bloomage Biotechnology Corp., Ltd.’s privacy. However, the corresponding author can provide the data upon request.

Declarations

Ethical approval

Ethical Approval is not applicable for this article.

Informed consent

There are no human subjects in this article and informed consent is not applicable.

Human and animal rights

This article does not contain any studies with human or animal subjects.

Competing interest

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Bae YJ, Kratzsch J (2015) Corticosteroid-binding globulin: modulating mechanisms of bioavailability of cortisol and its clinical implications. Best Pract Res Clin Endocrinol Metab 29(5):761–772 [DOI] [PubMed] [Google Scholar]
  2. Bellezza I et al (2018) Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim Biophys Acta 1865(5):721–733 [Google Scholar]
  3. Cai C, Ma H, Peng J (2023) USP25 regulates KEAP1-NRF2 anti-oxidation axis and its inactivation protects acetaminophen-induced liver injury in male mice. Nat Commun 14(1):3648 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chapman K, Holmes M, Seckl J (2013) 11β-hydroxysteroid dehydrogenases: intracellular gate-keepers of tissue glucocorticoid action. Physiol Rev 93(3):1139–1206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chu Z (2025) Targeting Nrf2 by bioactive peptides alleviate inflammation: expanding the role of gut microbiota and metabolites. Crit Rev Food Sci Nutr. 10.1080/10408398.2024.2367570 [DOI] [PubMed] [Google Scholar]
  6. Covello C, Becherucci G, Di Vincenzo F (2024) Parenteral nutrition, inflammatory bowel disease, and gut barrier: an intricate plot. Nutrients 16(14):2288 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cui X, Wei W, Hu Y, Zhang Z (2025) Dietary inflammation and vascular calcification: a comprehensive review of the associations, underlying mechanisms, and prevention strategies. Crit Rev Food Sci Nutr. 10.1080/10408398.2024.2408447 [DOI] [PubMed] [Google Scholar]
  8. Daiber A, Kröller-Schön S, Oelze M, Hahad OL et al (2020) Oxidative stress and inflammation contribute to traffic noise-induced vascular and cerebral dysfunction via uncoupling of nitric oxide synthases. Redox Biol 34:101506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Di Vincenzo F, Del Gaudio A, Petito V (2024) Gut microbiota, intestinal permeability, and systemic inflammation: a narrative review. Intern Emerg Med 19(2):275–293 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ford AC, Sperber AD, Corsetti M (2020) Irritable bowel syndrome. Lancet 396(10263):1675–1688 [DOI] [PubMed] [Google Scholar]
  11. Fortea M, Albert-Bayo M, Abril-Gil M et al (2021) Present and future therapeutic approaches to barrier dysfunction. Front Nutr 8:718093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Geer EB, Islam J, Buettner C (2014) Mechanisms of glucocorticoid-induced insulin resistance: focus on adipose tissue function and lipid metabolism. Endocrinol Metab Clin North Am 43:75–102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. González-Mariscal L, Betanzos A, Nava P, Jaramillo BE (2003) Tight junction proteins. Prog Biophys Mol Biol 81(1):1–44 [DOI] [PubMed] [Google Scholar]
  14. Hussar P (2022) Apoptosis regulators Bcl-2 and caspase-3. Encyclopedia 2:1624–1636 [Google Scholar]
  15. Jena G, Trivedi PP, Sandala B (2012) Oxidative stress in ulcerative colitis: an old concept but a new concern. Free Radic Res 46(11):1339–1345 [DOI] [PubMed] [Google Scholar]
  16. Jia XB, Zhang Q, Xu L et al (2021) Lotus leaf flavonoids induce apoptosis of human lung cancer A549 cells through the ROS/p38 MAPK pathway. Biol Res 54(1):7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kobayashi E, Suzuki T, Funayama R et al (2016) Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription. Nat Commun 7:11624 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Konturek PC, Brzozowski T, Konturek SJ (2011) Stress and the gut: pathophysiology, clinical consequences, diagnostic approach and treatment options [J]. Journal of Physiology and Pharmacology : an Official Journal of the Polish Physiological Society 62(6):591–599 [PubMed] [Google Scholar]
  19. Kuo T, McQueen A, Chen TC, Wang JC (2015) Regulation of glucose homeostasis by glucocorticoids. Adv Exp Med Biol 872:99–126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Leigh SJ, Uhlig F, Wilmes L (2023) The impact of acute and chronic stress on gastrointestinal physiology and function: a microbiota-gut-brain axis perspective. J Physiol 601(20):4491–4538 [DOI] [PubMed] [Google Scholar]
  21. Li L, Dong H, Song E, Xu X (2014) Nrf2/ARE pathway activation, HO-1 and NQO1 induction by polychlorinated biphenyl quinone is associated with reactive oxygen species and PI3K/AKT signaling. Chem Biol Interact 209:56–67 [DOI] [PubMed] [Google Scholar]
  22. Lian P, Braber S, Varasteh S et al (2021) Hypoxia and heat stress affect epithelial integrity in a Caco-2/HT-29 co-culture. Sci Rep 11:13186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Macura B, Kiecka A, Szczepanik M (2024) Intestinal permeability disturbances: causes, diseases and therapy. Clin Exp Med 24(1):232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mandiola PC, Leiva C, Moya-Salazar MJ et al (2024) Healthy habits, physical activity, stress, and food consumption trends in Chilean adults with irritable bowel syndrome during the COVID-19 pandemic. Int J Environ Res Public Health 21(5):533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Matos MS, Ávila-Gálvez MÁ, González-Sarrías A et al (2024) Unveiling the anti-inflammatory potential of 11β,13-dihydrolactucin for application in inflammatory bowel disease management. Food Funct 15(18):9254–9271 [DOI] [PubMed] [Google Scholar]
  26. Megha KB, Joseph X, Akhil V, Mohanan PV (2021) Cascade of immune mechanism and consequences of inflammatory disorders. Phytomedicine 91:153712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mohammadpour S, Torshizi Esfahani A, Sarpash S (2024) Hippo signaling pathway in colorectal cancer: modulation by various signals and therapeutic potential. Anal Cell Pathol. 10.1155/2024/5767535 [Google Scholar]
  28. Perrelli M, Goparaju P, Postolache TT (2024) Stress and the CRH system, norepinephrine, depression, and type 2 diabetes. Biomedicines 12(6):1187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Qi P, Chen X, Tian J et al (2024) The gut homeostasis-immune system axis: novel insights into rheumatoid arthritis pathogenesis and treatment. Front Immunol 15:1482214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Russell G, Lightman S (2019) The human stress response. Nat Rev Endocrinol 15:525–534 [DOI] [PubMed] [Google Scholar]
  31. Shawki A, McCole DF (2016) Mechanisms of intestinal epithelial barrier dysfunction by adherent-invasive Escherichia coli. Cell Mol Gastroenterol Hepatol 3(1):41–50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sic A, Cvetkovic K, Manchanda E, Knezevic NN (2024) Neurobiological implications of chronic stress and metabolic dysregulation in inflammatory bowel diseases [J]. Diseases 12(9):220 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Söderholm JD, Perdue MH (2001) Stress and gastrointestinal tract. Part II. Stress and intestinal barrier function. Am J Physiol Gastrointest Liver Physiol 280(1):G7–G13 [DOI] [PubMed] [Google Scholar]
  34. Szczepanska-Sadowska E, Czarzasta K, Bogacki-Rychlik W, Kowara M (2024) The interaction of vasopressin with hormones of the hypothalamo-pituitary-adrenal axis: the significance for therapeutic strategies in cardiovascular and metabolic diseases. Int J Mol Sci 25(13):7394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Téblick A, Peeters B, Langouche L et al (2019) Adrenal function and dysfunction in critically ill patients. Nat Rev Endocrinol 15:417–427 [DOI] [PubMed] [Google Scholar]
  36. Thomas NS, Gillespie NA, Kendler KS, Oldehinkel AJ (2024) Comorbidity and sex differences in functional disorders and internalizing disorders. Gen Hosp Psychiatry 90:91–98 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Timmermans S, Souffriau J, Libert C (2019) A general introduction to glucocorticoid biology. Front Immunol 10:1545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Verma A, Inslicht SS, Bhargava A (2024) Gut-brain axis: role of microbiome, metabolomics, hormones, and stress in mental health disorders. Cells 13(17):1436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Wang Y, Fu X, Zeng L et al (2024a) Activation of Nrf2/HO-1 signaling pathway exacerbates cholestatic liver injury. Commun Biol 7:621 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wang H, Cai Y, Wu W, Zhang M (2024) Exploring the role of gut microbiome in autoimmune diseases: a comprehensive review. Autoimmun Rev 23(12):103654 [DOI] [PubMed] [Google Scholar]
  41. Warren A, Nyavor Y, Beguelin A (2024) Dangers of the chronic stress response in the context of the microbiota-gut-immune-brain axis and mental health: a narrative review. Front Immunol 15:1365871 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Xiao Y, Gao X, Yuan J (2024) Substituting ethoxyquin with tea polyphenols and propyl gallate enhanced feed oxidative stability, broiler hepatic antioxidant capacity and gut health. Poult Sci. 10.1016/j.psj.2024.104368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ying J, Ye D, Luo P, Liu B et al (2024) Lifestyle and genetic predisposition are associated with incident irritable bowel syndrome: a population-based prospective cohort study [J]. Clin Nutr 43(6):1544–1550 [DOI] [PubMed] [Google Scholar]
  44. Yue Y, Ke Y, Zheng J, Wang et al (2024) Microbiota-derived tryptophan metabolism and AMPK/mTOR pathway mediate antidepressant-like effect of Shugan Hewei Decoction . Front Pharmacol 15: 1466336.
  45. Zhang Q, Liu J, Duan H, Li R et al (2021) Activation of Nrf2/HO-1 signaling: an important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J Adv Res 34:43–63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang Y, Li X, Lu S et al (2024a) Stress triggers gut dysbiosis via CRH-CRHR1-mitochondria pathway. NPJ Biofilms Microbiomes 10:93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang L, Wang HL, Zhang YF, et al (2024) Stress triggers irritable bowel syndrome with diarrhea through a spermidine-mediated decline in type I interferon. Cell Metab
  48. Zheng D, Liwinski T, Elinav E (2020) Inflammasome activation and regulation: toward a better understanding of complex mechanisms. Cell Discov 6:36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zou Z, Xiao N, Chen Z et al (2024) Yeast extract peptides alleviate depression in chronic restraint stress rats by alleviating hippocampal neuronal apoptosis and dysbiosis of the gut microbiota. Mol Nutr Food Res 21:e2300467 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File 1 (PNG 2.43 MB) (2.4MB, png)
High Resolution Image (TIF 29.9 MB) (29.9MB, tif)
Supplementary File 2 (PNG 3.12 MB) (3.1MB, png)
High Resolution Image (TIF 41.4 MB) (40.3MB, tif)
Supplementary File 3 (PNG 2.93 MB) (2.9MB, png)
High Resolution Image (TIF 34.7 MB) (34.7MB, tif)
Supplementary File 4 (PNG 3.40 MB) (3.4MB, png)
High Resolution Image (TIF 40.2 MB) (41.4MB, tif)

Data Availability Statement

The study’s supporting data are not publicly available because they contain information that might compromise Bloomage Biotechnology Corp., Ltd.’s privacy. However, the corresponding author can provide the data upon request.

Articles from Die Naturwissenschaften are provided here courtesy of Springer

RESOURCES