Skip to main content
NCBI home page
Journal of Orthopaedic Surgery and Research logoLink to Journal of Orthopaedic Surgery and Research
. 2025 Oct 21;20:902. doi: 10.1186/s13018-025-06310-0

BMSC-derived exosomal lncRNA-ZFAS1 regulates the proliferation and differentiation of osteoblasts via the miR-9/IGF-1 signaling axis

Hui Sun 1,#, Yibin Liu 2,#, Haoran Wang 1, Zhiqiang Ma 1, Fang Xu 1, Xinlian Li 1, Gang Lv 1,✉
PMCID: PMC12539005  PMID: 41121386

Abstract

Background

Osteoblast formation and function are essential for regulating bone disorders such as osteoporosis. Recent studies have confirmed that long non-coding RNAs (lncRNAs) from exosomes (ExOs) are involved in osteoblast proliferation and differentiation. This study investigated the role of bone marrow mesenchymal stem cell (BMSC)-derived exosomal lncRNA-ZFAS1 in regulating osteoblasts.

Methods

Human BMSCs and derived exosomes (BMSC-EXOs) were isolated and characterized. ZFAS1, miR-9, and IGF-1 levels in BMSC-EXOs and osteoblasts were measured by RT-qPCR and Western blot. ZFAS1 localization was determined by fluorescence in situ hybridization (FISH) and nuclear-cytoplasmic fractionation. ZFAS1 interactions with miR-9 and IGF-1 were confirmed via dual-luciferase reporter assay and RNA-binding protein immunoprecipitation (RIP). The effects of the ZFAS1/miR-9 axis on osteoblast proliferation and differentiation were examined using CCK-8, Alizarin Red staining, and ALP staining assays.

Results

BMSC-EXOs exhibited elevated ZFAS1 levels and efficiently delivered this lncRNA to osteoblasts. Through this mechanism, ZFAS1 enhanced osteoblast proliferation and differentiation. Mechanistically, ZFAS1 inhibited miR-9 expression, and downregulation of miR-9 reversed the suppression of osteoblast proliferation and differentiation induced by ZFAS1 silencing. The decrease in miR-9 leads to an increase in IGF-1, thereby promoting the proliferation and differentiation of osteoblasts.

Conclusions

We have shown that ZFAS1 from BMSC-derived EXOs enhances the proliferation and differentiation of osteoblasts by regulating the miR-9/IGF-1 signaling axis. This discovery provides novel insights into mechanisms of osteoblast proliferation and differentiation, and identifies potential therapeutic targets for treating associated diseases.

Keywords: Osteoblasts, Exosome, LncRNA-ZFAS1, MiR-9, IGF-1

Background

Osteoblasts play a crucial role in the formation of the bone marrow microenvironment, which is a key component in maintaining the homeostasis of hematopoietic stem cells [1–3]. Studies that focus on studies focusing on osteoblasts have significant clinical implications. Osteoporosis, a common skeletal disorder in the elderly, is often linked to diminished osteoblast generation and function [4]. There is a pressing clinical need for safe and efficient approaches for enhancing osteoblast formation and function. Bone marrow mesenchymal stem cells (BMSCs), which are derived from bone marrow and are also known as mesenchymal stromal cells (MSCs), are commonly employed in bone-related studies owing to their favorable results [5]. BMSCs can give rise to osteoblast precursor cells (osteoprogenitors). Thus, the interaction between BMSCs and osteoblasts is essential for maintaining bone homeostasis and promoting regeneration [6, 7].

Recent studies have demonstrated that BMSCs not only promote osteoprogenitor cell differentiation into osteoblasts but also enhance osteoblast proliferation via EXOs derived from BMSCs [8, 9]. EXOs are small membrane vesicles with sizes ranging from 20 to 100 nm [10, 11]. EXOs display molecular profiles akin to those of their parent cells and can encapsulate nucleic acids, proteins, lipids, and other cellular constituents [12–14]. BMSC-derived EXOs exhibit distinct attributes that go beyond their overall characteristics, resulting in specialized osteogenic impacts [15]. The complex process of bone formation and repair relies significantly on intercellular communication. Although traditional explanations for such interactions often focus on hormones and cytokines, our understanding of the role of EXOs in bone physiology is still evolving [15]. BMSC-EXOs enhance the proliferation and differentiation of osteoblasts by inhibiting apoptosis, leading to improvements in osteoporosis [16]. In one study, BMSC-EXOs were employed in a critical-size calvarial defect model to evaluate their impact on osteogenesis, angiogenesis, and bone repair. These findings revealed that BMSC-EXOs facilitated bone differentiation, enhanced angiogenic activity, and promoted bone mass formation [17]. However, uncertainties persist regarding the mechanisms underlying the functional roles of BMSC-EXOs in clinical applications, and their impact on bone repair and developmental processes. Thus, comprehensive research on the content and molecular mechanisms regulating the functions of EXOs is essential.

Long non-coding RNAs (lncRNAs) play crucial roles in the regulation of mRNA stability, splicing, and post-transcriptional modification [18]. These functions are accomplished by influencing the structure of chromosomes, altering the recruitment of chromatin modifiers, creating complex formations through direct binding to DNA that disrupts transcription machinery, or binding to complementary transcripts of mRNA [19, 20]. A previous study revealed that XIST modulates the differentiation of osteoblasts in age-related osteoporosis through its interaction with miR-19a-3p [21]. Inflammatory osteoclast-derived EXOs selectively transfer lncRNA LIOCE to osteoblasts, where it interacts with osterix, leading to its stabilization and subsequent promotion of bone formation [22]. Exosomal secretion of lncRNA MALAT1 by BMSC mitigated osteoporosis by modulating the miR-34c/SATB2 axis [22]. Despite previous research focusing on the role of lncRNAs in bone homeostasis and regeneration, whether lncRNAs from BMSC-derived EXOs affect osteoblasts and their underlying mechanisms remain unclear. ZFAS1 is a significantly enriched lncRNA in BMSC-EXOs that can influence the progression of various diseases [23, 24]. However, whether ZFAS1 affects the proliferation and differentiation of osteoblasts has not been sufficiently studied.

In this study, we investigated that BMSC-EXOs efficiently deliver lncRNA ZFAS1 to osteoblasts, where it modulates osteoblast proliferation and differentiation by regulating the miR-9/IGF-1 signaling axis, thereby revealing a novel molecular mechanism involving exosomes and non-coding RNAs.

Methods

Cell culture and treatment

The BMSC (AC338194) and hFOB 1.19 (CRL-11372) cell lines of human origin were acquired from the American Type Culture Collection (ATCC, USA). The BMSC and hFOB 1.19 cells were cultured using a medium consisting of Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12, Gibco, USA), supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin solution (Gibco, USA). Cells were maintained at 37 °C with a 5% CO2. The miR-9 inhibitor negative control (NC), miR-9 mimic, NC mimic, sh-ZFAS1, and blank plasmids were purchased from GenePharma. Cells were transfected with plasmids using Lipofectamine 3000 (Thermo Fisher Scientific, USA).

EXOs isolation

An EV isolation kit from QIAGEN was utilized to isolate EXOs following the manufacturer’s instructions. Briefly, BMSCs were subjected to centrifugation at 1900×g at 4 °C for 15 min, and the upper layer containing were harvested. To remove large cell fragments or debris, an initial centrifugation step was carried out at 2000×g and 4 °C for 20 min samples. The resultant supernatants were then further centrifuged at 12,000×g at 4 °C for 45 min to remove smaller cellular debris. Subsequently, these supernatants were transferred to a new tube, ultracentrifuged at 120,000×g, and maintained at − 4 °C for a duration of 120 min in order to pellet the small vesicles. After discarding the supernatants, the obtained pellets were resuspended in PBS (Thermo Fisher Scientific, USA) and filtered through a 0.22 μm filter to eliminate any potential contaminants. Another round of ultracentrifugation under similar conditions (120,000×g and maintained at − 4 °C) was performed before resuspending the pellets once again in PBS, protein concentrations in the isolated EXOs were quantified using a bicinchoninic acid (BCA) assay kit (Beyotime Biotechnology, China).

Transmission electron microscope (TEM)

The isolated EXOs were applied to a formvar-coated copper grid and treated with 2% paraformaldehyde (Sigma, USA) for 10 min. The EXOs were then embedded in a mixture of 0.13% methylcellulose (Sigma, USA) and 0.4% uranyl acetate (Sigma, USA). Transmission electron microscopy (HITACHI, Japan), operated at 80 kV, was used to examine the grid, and images were acquired during this process.

Nanoparticle tracking analysis (NTA)

A Nanoparticle Tracking Analyzer (Zeta View, Germany) was used to analyze the size distribution of EXOs. The EXOs samples were diluted to an appropriate concentration in 1 × PBS to achieve an optimal concentration, with the particle concentration ranged from 50 to 400 particles/μL. The EXOs size was determined according to the manufacturer’s guidelines.

EXOs tracking

Following isolation, the EXOs were co-cultured with hFOB 1.19 for 48 h after being labeled with 1 μM PKH26 (red; Sigma, USA). According to the experimental protocol, the cells were washed twice with PBS and fixed with 4% paraformaldehyde (Sigma, USA). The internalization of EXOs by the cells was visualized using fluorescence microscopy (Zeiss, Germany) after DAPI staining (Sigma-Aldrich, USA).

Real-time quantitative PCR (RT-qPCR) analysis

TRIzol reagent (Invitrogen, USA) was used for total RNA extraction from the BMSC, BMSC-EXOs, and hFOB 1.19 cells. The PrimeScript RT reagent kit (Takara, Japan) was employed for cDNA synthesis. For RT-qPCR analysis, an ABI 7500 Real-Time PCR System and SYBR Green Master Mix (Applied Biosystems, USA) were used according to the manufacturer’s guidelines. Relative RNA expression levels were calculated using the 2-ΔΔCT method and normalized to those of U6 or GAPDH.

The primer sequences used were as follows (5′ → 3′):

Gene Forward primer Reverse primer
ALP ACTCTCCGAGATGGTGGTGGTG CGTGGTCAATTCTGCCTCCTTCC
RUNX2 GTAGATGGACCTCGGGAACC GAGGCGGTCAGAGAACAAAC
BMP2 ACCCGCTGTCTTCTAGCGT TTTCAGGCCGAACATGCTGAG
ATF4 CGAACTCAGCTCCTCAGGTA AAGAAGGTGCTGGGCTCATT
IGF-1 GCACCATCTTCAAGGGCAATTTG AGGAAGGACAAGGAGACCAAGG
GAPDH GAACGGGAAGCTCACTGG GCCTGCTTCACCACCTTC
LncRNA-ZFAS1 CCGGAGTGTGGTACTTCTCC CCAGAGGTCTCCAACGAAGA
miR-9 TCTTTGGTTATCTAGCTGTATGA GAATCGAGCACCAGTTACGC
U6 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT
Open in a new tab

Western blot

RIPA lysis buffer, and protease inhibitors (Roche Diagnostics), was utilized to extract total protein from the sample tissues. Following this, centrifugation at 4 °C for 30 min at 12,000 rpm was conducted to remove insoluble materials from the lysates. Protein concentrations were measured using a Thermo Fisher Scientific BCA Protein Assay Kit. Following this step, the protein samples were separated by SDS-PAGE (Solarbio, China) and transferred onto a PVDF membrane (Solarbio, China). To block the membrane, a solution containing PBS + Tween-20 (PBST) buffer with 5% skim milk was applied. Primary antibodies, including IGF-1 (1:1000; Abcam, Britain), CD9 (1:1000; Abcam, Britain, Britain), CD63 (1:1000; Abcam, Britain), CD81 (1:1000; Abcam, Britain), and GAPDH (1:2000; Abcam, Britain), were incubated overnight at 4 °C. After washing, the membrane was incubated with horseradish peroxidase conjugated secondary antibodies (1:5000; Abcam) for 2 h at room temperature. GAPDH served as the internal loading control for normalization purposes.

Dual-luciferase reporter assay

The 3′-untranslated region (3′-UTR) segment of IGF-1 was subjected to amplification and subsequent cloning into the pmir-Cytomegalovirus vector (pmirCMV; Promega, USA), to generate IGF-1-wild-type (WT) and IGF-1-mutant (MUT) plasmids. Similarly, ZFAS1-WT and ZFAS1-MUT plasmids were constructed using a strategy similar to that used for pmirCMV vectors. These validated plasmids, along with either the miR-9 mimic or NC mimic, were co-transfected into hFOB 1.19 cells. Each experiment was performed in triplicate. After a 48-h incubation period, the cells were collected for luciferase activity analysis using the Dual-CMV Luciferase Assay System (Promega, USA). Relative luciferase activity was calculated as the ratio of firefly luciferase activity to Renilla luciferase activity.

RNA binding protein immunoprecipitation (RIP)

RIP assays were conducted according to the protocol provided by the RIP kit (Saicheng, China). Briefly, hFOB 1.19 cells were lysed in RIP lysis buffer and the resulting cell lysates were incubated with magnetic beads coated with either anti-IGF-1 or anti-IgG antibody overnight at 4 °C. Subsequently, the magnetic beads were washed and treated with proteinase K to digest bound proteins. The purified RNA was analyzed using RT-qPCR.

Alkaline phosphatase (ALP) staining

ALP activity was measured using the azo-coupling method to assess osteogenic differentiation. Increased ALP activity indicates improved osteogenic differentiation. hFOB 1.19 cells were cultured in the induction medium for 7 and 14 days, then fixed with 4% paraformaldehyde (Servicebio, China) prior to further analysis. For ALP staining using a kit (Solarbio, China) following the manufacturer’s instructions. Images were obtained with an inverted phase-contrast microscope (Olympus, Japan).

Alizarin red staining (ARS)

Mineral deposition of hFOB 1.19 cells was evaluated using ARS staining following osteogenic induction. After culturing for 14 and 21 days in the induction medium, hFOB 1.19 cells were fixed with 4% PFA solution and stained with 1% ARS (Procell, China) at 25 °C. Images were captured using an inverted phase-contrast microscope (Olympus, Japan).

Fluorescence in situ hybridization (FISH)

The subcellular localization of ZFAS1 was validated using FISH with the Ribo™ lncRNA FISH Probe Mix (Green, RiboBio, China). hFOB 1.19 cells (3.5 × 10^4 cells/well) were fixed with 4% formaldehyde at 4 °C for 10 min and mounted on slides. The slides were treated with protease K (2 µg/mL; Solarbio, China), glycine, and acetic anhydride before pre-hybridization at 42 °C for 1 h. Hybridization was subsequently carried out overnight at 42 °C using ZFAS1 probes (250 µL, 300 ng/mL). DAPI staining was performed by incubating the slides with DAPI diluted in PBS-0.1% Tween (Solarbio, China) for 6 min at room temperature. Images were captured using an Olympus inverted fluorescence microscope by randomly selecting five fields per slide for analysis.

Fractionation of nuclear/cytoplasmic RNA

Nuclear and cytoplasmic RNA extraction was performed according to the protocols recommended by the PARIS Kit (Thermo Fisher Scientific, USA). Briefly, the hFOB 1.19 cells were suspended in 500 µL of cell fractionation buffer for a duration—5–10 min. Subsequently, centrifugation at 500×g and 4 °C for 5 min was performed to separate the RNA fractions. The resulting supernatant (cytoplasmic fraction) was collected into a sterile enzyme-free tube in a 2 mL sterile enzyme-free tube and subjected to further centrifugation; the pellet (nuclear fraction) was resuspended in 500 µL of cell disruption buffer and subjected to another centrifugation. Following this, both fractions were washed with 500 µL of 2 × lysis/binding solution and centrifuged. Each fraction was then combined with an equal volume (500 µL) of absolute ethanol, transferred to a filter cartridge and rinsed with a wash solution. Finally, nuclear and cytoplasmic RNA were eluted. To assess the ZFAS1 expression levels, RT-qPCR analysis was performed using U6 as an internal control for nuclear RNA expression and GAPDH for cytoplasmic RNA expression.

Cell counting kit-8 (CCK-8) assay

At 48 h after transfection, the proliferation of cells in each group was evaluated individually using the CCK-8 kit provided by Beyotime Biotechnology. The CCK-8 solution was added to each well at a ratio of 1:9 at time points of 0, 24, 48, and 72 h, followed by incubation at 37 °C for 2 h. An enzyme-labeling device was utilized to measure the absorbance at a wavelength of 450 nm to determine the extent of cell proliferation.

Statistical analysis

Data are expressed as mean ± standard deviation (SD). Statistical analysis was performed using SPSS software (version 26.0; SPSS, USA). Unpaired Student’s t-tests or one-way analysis of variance were used to assess variations between two groups or multiple groups. The threshold for statistical significance was set at p < 0.05.

Results

The extracellular vesicles derived from BMSC contained elevated levels of ZFAS1

Human BMSCs were commercially obtained and used as the experimental model. ​Optical microscopy revealed spindle-shaped and polygonal BMSCs (Fig. 1A). Exosomes (EXOs) were then extracted from these cells. Morphology of isolated EXOs was examined by Transmission electron microscopy (TEM), whereas nanoparticle tracking analysis (NTA) was used to determine their size distribution. The findings revealed a predominantly spherical shape in BMSC-EXOs derived from BMSC (Fig. 1B) with sizes ranging from 50 to 250 nm (Fig. 1C). Western blotting confirmed expression of exosomal markers CD9, CD63, and CD81 in BMSC-EXOs (Fig. 1D). RT-qPCR analysis demonstrated significantly higher ZFAS1 levels in BMSC-EXOs compared to parent BMSCs (Fig. 1E), confirming the enrichment of ZFAS1 in exosomes.

Fig. 1.

Fig. 1

Open in a new tab

The BMSC-EXOs contained high levels of ZFAS1. (A) Morphology of commercially available BMSCs observed under an optical microscope. (B) TEM characterization of the morphology of BMSC-derived EXOs. (C) NTA analysis of EXO size distribution. (D) Western blot analysis of CD9, CD63, and CD81 expression in EXOs and other BMSC components. (E) RT-qPCR was conducted to measure the levels of ZFAS1 in BMSC and EXOs. *p < 0.05, **p < 0.01, ***p < 0.001. BMSC: Mesenchymal Stem Cells; EXOs: Exosomes; TEM: Transmission Electron Microscopy; NTA: Nanoparticle Tracking Analysis; RT-qPCR: Real‐time quantitative PCR

The lncRNA ZFAS1 derived from BMSC EXOs was delivered into osteoblasts

To investigate if the increased ZFAS1 levels in osteoblasts after EXO treatment were due to exosomal delivery rather than endogenous upregulation, tracer experiments were conducted. Fluorescence microscopy confirmed cellular uptake of PKH26-labeled BMSC-EXOs by hFOB1.19 osteoblasts (Fig. 2A). Consistently, RT-qPCR revealed significantly higher ZFAS1 levels in EXOs-treated cells compared to untreated controls (Fig. 2B). Importantly, when BMSCs were transfected with a fluorescently labeled ZFAS1 probe, the extracted exosomes delivered the labeled ZFAS1 into recipient hFOB1.19 cells (Fig. 2C). These results confirmed that BMSC-derived exosomes directly ZFAS1 into osteoblasts.

Fig. 2.

Fig. 2

Open in a new tab

The lncRNA ZFAS1 transferred from BMSC derived EXOs into osteoblasts. (A) EXOs labeled with PKH26 fluorescence were co-cultured with hFOB 1.19 cells, and the cellular uptake was visualized using immunofluorescence microscopy. (B) RT-qPCR was performed to detect the expression of ZFAS1 in hFOB 1.19 cells following treatment with or without EXOs. (C) The ZFAS1 probe was visualized using fluorescence in the hFOB 1.19 cells. *p < 0.05, **p < 0.01, ***p < 0.001. lncRNAs: long non-coding RNAs; BMSC (mesenchymal stem cells); EXOs (exosomes); RT-qPCR: Real-time quantitative PCR

BMSC-derived exosomal ZFAS1 promoted the proliferation and differentiation of osteoblasts

To examine the role of exosomal ZFAS1 in regulating osteoblasts, hFOB 1.19 cells transduced with sh-NC or sh-ZFAS1 were co-cultured with BMSC-EXOs. Successful ZFAS1 knockdown and rescue by BMSC-EXOs were confirmed (Fig. 3A). CCK-8 assay revealed that ZFAS1 knockdown significantly suppressed hFOB 1.19 proliferation, while BMSC-EXOs co-culture partially restored this effect (Fig. 3B). Since ALP expression and mineralized nodule formation (Alizarin Red staining) serve as markers of osteoblast differentiation and maturation [25, 26], we found BMSC-EXOs partially restored mineralized nodule formation impaired by ZFAS1 knockdown (Fig. 3C), and increased ALP activity in ZFAS1-knockdown cells (Fig. 3D). Given that RUNX2, ATF4, and BMP2 have been reported to regulate osteoblast differentiation [27, 28], their mRNA levels were analyzed by RT-qPCR. ZFAS1 knockdown significantly reversed the BMSC-EXO-induced increase in mRNA levels of ALP, RUNX2, BMP2, and ATF4. (Fig. 3E). These data demonstrated that BMSC-derived exosomal ZFAS1 drives osteoblast the proliferation and differentiation.

Fig. 3.

Fig. 3

Open in a new tab

Exosomes derived from BMSCs carrying ZFAS1 promoted osteoblast proliferation and differentiation. Experimental hFOB 1.19 cells were divided into Control, EXOs, sh-ZFAS1, EXOs + sh-ZFAS1 groups. A RT-qPCR was performed to detect the expression of ZFAS1 in cells from each group. B The CCK-8 assay was conducted to evaluate the proliferation of cells in each group. C Alizarin Red staining assessed mineralization in each group. D ALP staining evaluated alkaline phosphatase activity in each group. E RT-qPCR was performed to assess the expression levels of ALP, RUNX2, BMP2, and ATF4 in cells from each group. *p < 0.05, **p < 0.01, ***p < 0.001. EXOs: exosomes; BMSC: mesenchymal stem cell; RT-qPCR: Real‐time quantitative PCR; CCK-8: Cell Counting Kit-8; ALP: Alkaline phosphatase

ZFAS1 targeted and inhibited miR-9 in osteoblasts

To better understand the mechanism by which BMSC-EXOs promote osteoblast proliferation and differentiation, we explored the downstream signaling molecules. To confirm whether ZFAS1 regulates osteoblast differentiation at the translational level, we performed FISH (Fig. 4A) and nuclear-cytoplasmic fractionation experiments (Fig. 4B). The findings suggested that ZFAS1 was predominantly cytoplasmic, with higher abundance in the cytoplasm than in the nucleus (Fig. 4B). To investigate the downstream molecular mechanisms, we performed bioinformatics analysis revealed that ZFAS1 has binding sites for miR-9 (Fig. 4C). To validate direct binding, CMV-derived luciferase reporters harboring WT or mutant ZFAS1 (with disrupted miR-9 site) were co-transfected with miR-9 mimic or scrambled NC. Dual-luciferase assays confirmed direct binding between miR-9 and ZFAS1 (Fig. 4D). Finally, RT-qPCR revealed that BMSC-EXO treatment downregulated miR-9 levels, while ZFAS1 knockdown effectively reversed this exosome-mediated suppression (Fig. 4E). These results indicated that ZFAS1 targeted and inhibited miR-9 expression in osteoblasts.

Fig. 4.

Fig. 4

Open in a new tab

ZFAS1 targeted and inhibited miR-9 in hFOB 1.19. A FISH was used to visualize ZFAS1 expression in the nuclear and cytoplasmic compartments of the cells. B Nuclear-cytoplasmic fractionation combined with RT-qPCR was conducted to quantify ZFAS1 levels in nuclear and cytoplasmic fractions. C Bioinformatics analysis was performed to predict the target miRNA of ZFAS1 and its potential binding site. (D) The dual-luciferase reporter assay was employed to validate the interaction between ZFAS1 and miR-9. E RT-qPCR was performed to detect the expression of miR-9 in hFOB 1.19 cells from each group. *p < 0.05, **p < 0.01, ***p < 0.001. FISH: Fluorescence in situ hybridization; RT-qPCR: Realtime quantitative PCR

ZFAS1/miR-9 regulated the proliferation and differentiation of osteoblasts

To elucidate the regulatory role of the ZFAS1/miR-9 axis in the proliferation and differentiation of osteoblasts, we conducted functional rescue experiments. Firstly, inhibition of miR-9 in ZFAS1-knockdown cells did not significantly change the expression level of ZFAS1 (Fig. 5A). In contrast, silencing of ZFAS1 significantly increased the expression of miR-9, which was effectively reversed by the miR-9 inhibitor (Fig. 5B). CCK-8 assay was used to evaluate cell proliferation, showing that miR-9 inhibition enhanced the proliferation of osteoblasts, while knockdown of ZFAS1 impeded osteoblast proliferation (Fig. 5C). The results of Alizarin Red staining (Fig. 5D), and ALP staining (Fig. 5E) indicated that the inhibition of miR-9 promoted the differentiation of osteoblasts, whereas a decrease in ZFAS1 inhibited the differentiation of osteoblasts. We further confirmed that the increase in ZFAS1 could enhance the differentiation of hFOB 1.19, by assessing markers including ALP, RUNX2, BMP2, and ATF4 using RT-qPCR (Fig. 5F). Crucially, the inhibitory effects of shZFAS1 on the proliferation and differentiation of osteoblasts were rescued by the miR-9 inhibitor (Fig. 5C-F). These results suggests that ZFAS1 regulates the osteogenic process by by inhibiting miR-9.

Fig. 5.

Fig. 5

Open in a new tab

ZFAS1/miR-9 regulated the proliferation and differentiation of osteoblasts. hFOB 1.19 were treated with control, sh-ZFAS1, miR-9 inhibitor, miR-9 inhibitor + sh-ZFAS1. A RT-qPCR was performed to detect the expression of ZFAS1 in each group of cells. B RT-qPCR was conducted to assess the expression of miR-9 in cells from each group. C The proliferation of cells in each experimental group was evaluated using the CCK-8 assay. D Alizarin Red staining was used to assess mineralization in each group. E ALP staining was used to evaluate ALP activity in each group. F RT-qPCR was performed to assess the expression levels of ALP, RUNX2, BMP2, and ATF4 in cells from each group. *p < 0.05, **p < 0.01, ***p < 0.001. RT-qPCR: Real-time quantitative PCR; CCK-8: Cell Counting Kit-8; ALP: Alkaline phosphatase

ZFAS1 competitively bound miR-9 to regulate the expression of IGF-1

To further investigate the target proteins of the ZFAS1/miR-9 interaction, we used bioinformatic analysis to predict the downstream target proteins of miR-9. The results indicated that miR-9 has binding sites for IGF-1 (Fig. 6A). The RIP assay results demonstrated that miR-9 was efficiently enriched by anti-IGF-1 antibody (Fig. 6B). To verify the binding site, we constructed dual-luciferase reporter plasmids containing the wild-type IGF-1 with the miR-9 target sequence and a mutant of the binding site, which were then co-transfected with miR-9 mimics. The experiment confirmed that miR-9 directly binds to the 3′UTR region of IGF-1 (Fig. 6C). Furthermore, RT-qPCR (Fig. 6D) and Western blot analysis (Fig. 6E) showed that the inhibition of miR-9 could increase IGF-1 levels, whereas inhibiting ZFAS1 decreased IGF-1 levels, and this reduction was reversed by the miR-9 inhibitor. Collectively, these findings confirm that ZFAS1 positively regulates IGF-1 expression by competing for binding to miR-9.

Fig. 6.

Fig. 6

Open in a new tab

ZFAS1 competitively adsorbed miR-9 to regulate the expression of IGF-1. hFOB 1.19 were treated by control, sh-ZFAS1, miR-9 inhibitor, miR-9 inhibitor + sh-ZFAS1. A Bioinformatics analysis was conducted to identify the target protein of miR-9 and the potential binding site. B RIP was performed to validate the interact relationship between miR-9 and IGF-1. C Dual-luciferase reporter assays were conducted to validate the regulative relationship between miR-9 and IGF-1. D RT-qPCR was performed to detect the expression of IGF-1 in each group. E Western blot analysis was conducted to assess the expression of IGF-1 in all groups. *p < 0.05, **p < 0.01, ***p < 0.001. RT-qPCR: Real‐time quantitative PCR

Discussion

Our study clarifies the molecular mechanism by which BMSC-EXOs affect the proliferation and differentiation of osteoblasts by delivering LncRNA-ZFAS1 and regulating the miR-9/IGF-1 axis. ZFAS1 upregulates the expression of IGF-1 by inhibiting the activity of miR-9, ultimately promoting the proliferation and differentiation of osteoblasts. Our results indicate that ZFAS1 is a key molecule mediating the communication between BMSCs and osteoblasts; elucidating its mechanism of action may provide potential therapeutic targets for diseases associated with osteoblast dysfunction.

Extracellular Vesicles (EVs) are membranous vesicles actively secreted by cells into the extracellular environment, and are ubiquitously found in various body fluids such as blood and urine [29]. As key carriers of intercellular communication, EVs carry biologically active molecules including proteins, lipids, and nucleic acids (e.g., DNA, RNA), and are involved in various physiological and pathological processes such as immune regulation, tissue repair, and disease occurrence [30, 31]. Research has demonstrated that EVs have application potential in multiple fields: their immunomodulatory and antiviral properties have been used to replace whole-cell therapy for COVID-19, thus avoiding risks like cell implantation retention, host rejection, and tumorigenicity [32]; the integration of EVs into cell-conditioned medium (CCM) can promote the proliferation of fibroblasts and the migration of stem cells through the synergy of high-concentration exosomes with growth factors and anti-inflammatory factors, thereby achieving efficient tissue repair and regeneration [33]. In addition, exosomes derived from bone marrow mesenchymal stem cells (BMSC-EVs) can promote the differentiation of osteoprogenitor cells, and the long-chain non-coding RNAs (lncRNAs) they carry have been confirmed to stimulate the proliferation of osteoblasts [8, 9], which further indicates the important role of EVs in various diseases. However, the understanding of EVs, especially their regulatory mechanisms in the bone microenvironment, remains limited. In this study, exosomes (BMSC-EVs) were extracted and purified from BMSCs, and it was found that lncRNA ZFAS1 is a key factor mediating the regulation of osteoblast proliferation and differentiation by BMSC-EVs.

Non-coding RNAs play crucial regulatory roles in the pathological processes of musculoskeletal diseases [34]. During tendon injury repair, specific miRNAs affect collagen metabolism by regulating the expression of TGF-β1 [34, 35]. For instance, miR-29b significantly inhibits the formation of postoperative adhesions, while miR-210 accelerates the healing process of Achilles tendons [34, 35]. In osteoarticular degenerative diseases, an imbalance in miRNAs directly exacerbates the degradation of cartilage matrix [36]. Abnormal expression of miR-140 is closely associated with articular cartilage destruction, and targeted delivery can delay the progression of osteoarthritis [37, 38]. In the field of osteoporosis research, circular RNAs (circRNAs) have been shown to regulate the Wnt signaling pathway via a competitive endogenous RNA mechanism [39]. Specifically, circ_0006859 affects osteogenic differentiation capacity by sponging miR-483, and its stable expression property makes it a potential diagnostic marker [39]. Although non-coding RNAs have demonstrated significant value in disease staging diagnosis and targeted therapy, the main challenges for clinical translation are their in vivo delivery efficiency and stability [34, 35, 37–39].

ZFAS1 is a significantly enriched lncRNA in BMSC-EXOs that can influence the progression of various diseases [23, 24]. ZFAS1 promotes small nucleolar RNA-mediated 2′-O-methylation by recruiting NOP58 in colorectal cancer [40]. ZFAS1 inhibits SERCA2a, leading to excessive intracellular Ca2+ accumulation and impaired cardiac contractile function in a murine myocardial infarction model [41]. In allergic rhinitis, ZFAS1 mitigated NLRP3 inflammasome-mediated pyroptosis by modulating the miR-96-5p/Smad7 signaling pathway [42]. While many studies have explored ZFAS1’s biological roles in various disease models, most focus on its involvement in tumor drug resistance and metastasis. ZFAS1 is linked to Ca2+ levels [41, 43, 44], and Ca2+ deposition and biomineralization serve as critical indicators of osteoblast differentiation [45, 46]. It remains unclear whether ZFAS1 participates in regulating bone homeostasis and its downstream mechanisms. Despite reports that ZFAS1 suppresses osteoporosis differentiation [47], our findings indicate that exosomal ZFAS1 promotes osteoblast proliferation and differentiation. We employed FISH and nuclear-cytoplasmic fractionation assays to validate the cytoplasmic localization of ZFAS1, suggesting its potential role as a molecular sponge that regulates RNA translation.

miR-9 is a critical miRNA involved in the progression of various diseases. HSV-1 epigenetic silencing and latency are facilitated by miR-9 in neurons through repression of Oct-1 and Onecut family genes [48]. miR-9 facilitates the degradation of tau via autophagy [49]. miR-9 has also been implicated in cancer [50]. IGF-1 is a target gene of miR-9 [51]. IGF-1 is an important protein that can influence various physiological and pathological processes, including neurodevelopment and Alzheimer’s disease [52, 53]. However, whether miR-9/IGF-1 is involved in the regulation of bone homeostasis remains unknown. In this study, we demonstrated that ZFAS1 can directly bind to and inhibit the expression of miR-9, thereby increasing the expression of IGF-1, which in turn promotes the proliferation and differentiation of osteoblasts. Using prediction and dual-luciferase reporter assays, we confirmed that miR-9 was a downstream RNA regulated by ZFAS1. Through further mechanistic investigation, we utilized dual-luciferase reporter and RIP assays to confirm our prediction that ZFAS1 competitively binds to miR-9 to modulate the expression levels of IGF-1. These findings indicated that exosomal ZFAS1 derived from BMSC plays a regulatory role in the proliferation and differentiation of osteoblasts by influencing the miR-9/IGF-1 signaling pathway.

However, this study has several limitations. Further research is needed to gain a deeper understanding of the mechanism by which BMSCs influence osteoblast proliferation and differentiation. We focused solely on cell models, and analyzing animal models and clinical samples would further validate our results. The downstream mechanisms by which the ZFAS1/miR-9/IGF-1 axis affects calcium deposition and ALP activity in osteoblasts remain to be fully elucidated. BMSC-EXOs contain many other substances, and whether these other components have regulatory effects remains to be investigated.

Conclusion

In conclusion, our research demonstrated that ZFAS1 in BMSC-derived EXOs promotes osteoblast proliferation and differentiation by competitively binding to miR-9 to regulate the expression level of IGF-1 (Fig. 7). This study established a theoretical framework for the control of the bone microenvironment and regeneration through the utilization of BMSC-EXOs.

Fig. 7.

Fig. 7

Open in a new tab

A schematic diagram illustrates how ZFAS1 in BMSC-derived EXOs enhances osteoblast proliferation and differentiation through modulating the miR-9/IGF-1 pathway

Acknowledgements

Not applicable.

Abbreviations

lncRNAs

Long non-coding RNAs

BMSC

Bone marrow mesenchymal stem cell

EXOs

Exosomes

RT-qPCR

Reverse transcription-quantitative polymerase chain reaction

FISH

Fluorescence in situ hybridization

RIP

RNA-binding protein immunoprecipitation

TEM

Transmission electron microscope

NTA

Nanoparticle tracking analysis

PVDF

Polyvinylidene difluoride

ALP

Alkaline phosphatase

ARS

Alizarin red staining

FISH

Fluorescence in situ hybridization

CCK-8

Cell counting kit-8

SD

Standard deviation

Author contributions

Each author has contributed significantly to various aspects of the reported work, including conception, study design, execution, data collection, analysis, interpretation, or a combination thereof. All participated in drafting, revising, or critically reviewing the manuscript and approved the final version for publication. Additionally, the authors collectively approved the submission to this journal and are committed to ensuring accountability for all aspects of the work, including addressing any questions regarding its accuracy or integrity.

Funding

Authors received no specific funding for this work.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Hui Sun and Yibin Liu contributed equally to this work.

References

  • 1.Calvi LM, Adams GB, Weibrecht KW, Weber JM, Olson DP, Knight MC, et al. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature. 2003;425:841–6. [DOI] [PubMed] [Google Scholar]
  • 2.Zhang J, Niu C, Ye L, Huang H, He X, Tong WG, et al. Identification of the haematopoietic stem cell niche and control of the niche size. Nature. 2003;425:836–41. [DOI] [PubMed] [Google Scholar]
  • 3.Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. Slam family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell. 2005;121:1109–21. [DOI] [PubMed] [Google Scholar]
  • 4.Tanaka Y. Clinical immunity in bone and joints. J Bone Miner Metab. 2019;37:2–8. [DOI] [PubMed] [Google Scholar]
  • 5.Lai RC, Yeo RW, Lim SK. Mesenchymal stem cell exosomes. Semin Cell Dev Biol. 2015;40:82–8. [DOI] [PubMed] [Google Scholar]
  • 6.Gronthos S, Simmons PJ. The growth factor requirements of STRO-1-positive human bone marrow stromal precursors under serum-deprived conditions in vitro. Blood. 1995;85:929–40. [PubMed] [Google Scholar]
  • 7.Xian CJ, Foster BK. Repair of injured articular and growth plate cartilage using mesenchymal stem cells and chondrogenic gene therapy. Curr Stem Cell Res Ther. 2006;1:213–29. [DOI] [PubMed] [Google Scholar]
  • 8.Zhuang J, Hang R, Sun R, Ding Y, Yao X, Hang R, et al. Multifunctional exosomes derived from bone marrow stem cells for fulfilled osseointegration. Front Chem. 2022;10:984131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gholami Farashah MS, Javadi M, Mohammadi A, Soleimani Rad J, Shakouri SK, Roshangar L. Bone marrow mesenchymal stem cell’s exosomes as key nanoparticles in osteogenesis and bone regeneration: specific capacity based on cell type. Mol Biol Rep. 2022;49:12203–18. [DOI] [PubMed] [Google Scholar]
  • 10.Théry C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and function. Nat Rev Immunol. 2002;2:569–79. [DOI] [PubMed] [Google Scholar]
  • 11.Connor DE, Paulus JA, Dabestani PJ, Thankam FK, Dilisio MF, Gross RM, et al. Therapeutic potential of exosomes in rotator cuff tendon healing. J Bone Miner Metab. 2019;37:759–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kowal J, Arras G, Colombo M, Jouve M, Morath JP, Primdal-Bengtson B, et al. Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes. Proc Natl Acad Sci U S A. 2016;113:E968–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Samanta S, Rajasingh S, Drosos N, Zhou Z, Dawn B, Rajasingh J. Exosomes: new molecular targets of diseases. Acta Pharmacol Sin. 2018;39:501–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kalluri R. The biology and function of exosomes in cancer. J Clin Investig. 2016;126:1208–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Masaoutis C, Theocharis S. The role of exosomes in bone remodeling: implications for bone physiology and disease. Dis Markers. 2019;2019:9417914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Xie Y, Hu JH, Wu H, Huang ZZ, Yan HW, Shi ZY. Bone marrow stem cells derived exosomes improve osteoporosis by promoting osteoblast proliferation and inhibiting cell apoptosis. Eur Rev Med Pharmacol Sci. 2019;23:1214–20. [DOI] [PubMed] [Google Scholar]
  • 17.Huber J, Griffin MF, Longaker MT, Quarto N. Exosomes: a tool for bone tissue engineering. Tissue Eng Part B Rev. 2022;28:101–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.He Y, Chen Y. The potential role of lncRNAs in osteoporosis. J Bone Miner Metab. 2021;39:341–52. [DOI] [PubMed] [Google Scholar]
  • 19.Ransohoff JD, Wei Y, Khavari PA. The functions and unique features of long intergenic non-coding RNA. Nat Rev Mol Cell Biol. 2018;19:143–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol. 2023;24:430–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen S, Li Y, Zhi S, Ding Z, Huang Y, Wang W, et al. LncRNA Xist regulates osteoblast differentiation by sponging miR-19a-3p in aging-induced osteoporosis. Aging Dis. 2020;11:1058–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang X, Yang J, Lei P, Wen T. LncRNA MALAT1 shuttled by bone marrow-derived mesenchymal stem cells-secreted exosomes alleviates osteoporosis through mediating microRNA-34c/SATB2 axis. Aging. 2019;11:8777–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gao C, Xu YJ, Meng ZX, Gu S, Zhang L, Zheng L. BMSC-derived exosomes carrying lncRNA-ZFAS1 alleviate pulmonary ischemia/reperfusion injury by UPF1-mediated mRNA decay of FOXD1. Mol Neurobiol. 2023;60:2379–96. [DOI] [PubMed] [Google Scholar]
  • 24.Liu Q, Ma H, Sun X, Liu B, Xiao Y, Pan S, et al. The regulatory ZFAS1/miR-150/ST6GAL1 crosstalk modulates sialylation of EGFR via PI3K/Akt pathway in T-cell acute lymphoblastic leukemia. J Exp Clin Cancer Res. 2019;38:199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Li B, Boast S, de los Santos K, Schieren I, Quiroz M, Teitelbaum SL, et al. Mice deficient in Abl are osteoporotic and have defects in osteoblast maturation. Nat Genet. 2000;24:304–8. [DOI] [PubMed] [Google Scholar]
  • 26.Gough JE, Jones JR, Hench LL. Nodule formation and mineralisation of human primary osteoblasts cultured on a porous bioactive glass scaffold. Biomaterials. 2004;25:2039–46. [DOI] [PubMed] [Google Scholar]
  • 27.Dobreva G, Chahrour M, Dautzenberg M, Chirivella L, Kanzler B, Fariñas I, et al. SATB2 is a multifunctional determinant of craniofacial patterning and osteoblast differentiation. Cell. 2006;125:971–86. [DOI] [PubMed] [Google Scholar]
  • 28.Yoshida Y, Tanaka S, Umemori H, Minowa O, Usui M, Ikematsu N, et al. Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell. 2000;103:1085–97. [DOI] [PubMed] [Google Scholar]
  • 29.Marar C, Starich B, Wirtz D. Extracellular vesicles in immunomodulation and tumor progression. Nat Immunol. 2021;22:560–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Keshtkar S, Azarpira N, Ghahremani MH. Mesenchymal stem cell-derived extracellular vesicles: novel frontiers in regenerative medicine. Stem Cell Res Ther. 2018;9:63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Xia Y, Zhang J, Liu G, Wolfram J. Immunogenicity of Extracellular Vesicles. Adv Mater. 2024;36:e2403199. [DOI] [PubMed] [Google Scholar]
  • 32.Gupta A, Shivaji K, Kadam S, Gupta M, Rodriguez HC, Potty AG, et al. Immunomodulatory extracellular vesicles: an alternative to cell therapy for COVID-19. Expert Opin Biol Ther. 2021;21(12):1551–60. [DOI] [PubMed] [Google Scholar]
  • 33.Gupta A, Cady C, Fauser AM, Rodriguez HC, Mistovich RJ, Potty AGR, et al. Cell-free stem cell-derived extract formulation for regenerative medicine applications. Int J Mol Sci. 2020. 10.3390/ijms21249364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Giordano L, Porta GD, Peretti GM, Maffulli N. Therapeutic potential of microrna in tendon injuries. Br Med Bull. 2020;133:79–94. [DOI] [PubMed] [Google Scholar]
  • 35.Gargano G, Oliviero A, Oliva F, Maffulli N. Small interfering RNAs in tendon homeostasis. Br Med Bull. 2021;138:58–67. [DOI] [PubMed] [Google Scholar]
  • 36.Gargano G, Asparago G, Spiezia F, Oliva F, Maffulli N. Small interfering RNAs in the management of human osteoporosis. Br Med Bull. 2023;148:58–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Oliviero A, Della Porta G, Peretti GM, Maffulli N. Microrna in osteoarthritis: physiopathology, diagnosis and therapeutic challenge. Br Med Bull. 2019;130:137–47. [DOI] [PubMed] [Google Scholar]
  • 38.Gargano G, Oliva F, Oliviero A, Maffulli N. Small interfering RNAs in the management of human rheumatoid arthritis. Br Med Bull. 2022;142:34–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gargano G, Pagano SM, Maffulli N. Circular rnas in the management of human osteoporosis. Br Med Bull. 2025. 10.1093/bmb/ldae024. [DOI] [PubMed] [Google Scholar]
  • 40.Wu H, Qin W, Lu S, Wang X, Zhang J, Sun T, et al. Long noncoding RNA ZFAS1 promoting small nucleolar RNA-mediated 2’-o-methylation via NOP58 recruitment in colorectal cancer. Mol Cancer. 2020;19:95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zhang Y, Jiao L, Sun L, Li Y, Gao Y, Xu C, et al. LncRNA ZFAS1 as a SERCA2a inhibitor to cause intracellular Ca(2+) overload and contractile dysfunction in a mouse model of myocardial infarction. Circ Res. 2018;122:1354–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Zhan J, Qi Y, Fu Y, Zheng J, Wu J, Wei X, et al. LncRNA ZFAS1 alleviated NLRP3 inflammasome-mediated pyroptosis through regulating miR-96-5p/Smad7 signaling in allergic rhinitis. Int Arch Allergy Immunol. 2024;185:704–17. [DOI] [PubMed] [Google Scholar]
  • 43.Vervliet T, Robinson EL, Roderick HL. Lnc’ing Ca(2+), SERCA and cardiac disease. Cell Calcium. 2018;72:132–4. [DOI] [PubMed] [Google Scholar]
  • 44.Jiao L, Li M, Shao Y, Zhang Y, Gong M, Yang X, et al. LncRNA-ZFAS1 induces mitochondria-mediated apoptosis by causing cytosolic Ca(2+) overload in myocardial infarction mice model. Cell Death Dis. 2019;10:942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Liu C, Liu W, Qi B, Fan L, Liu S, Yang Q, et al. Bone homeostasis modulating orthopedic adhesive for the closed-loop management of osteoporotic fractures. Small. 2023;19:e2302704. [DOI] [PubMed] [Google Scholar]
  • 46.Li J, Liu C, Li Y, Zheng Q, Xu Y, Liu B, et al. Tmco1-mediated Ca(2+) leak underlies osteoblast functions via CaMKII signaling. Nat Commun. 2019;10:1589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wu J, Lin T, Gao Y, Li X, Yang C, Zhang K, et al. Long noncoding RNA ZFAS1 suppresses osteogenic differentiation of bone marrow-derived mesenchymal stem cells by upregulating miR-499-EPHA5 axis. Mol Cell Endocrinol. 2022;539:111490. [DOI] [PubMed] [Google Scholar]
  • 48.Deng Y, Lin Y, Chen S, Xiang Y, Chen H, Qi S, et al. Neuronal miR-9 promotes HSV-1 epigenetic silencing and latency by repressing Oct-1 and Onecut family genes. Nat Commun. 2024;15:1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Subramanian M, Hyeon SJ, Das T, Suh YS, Kim YK, Lee JS, et al. UBE4B, a microRNA-9 target gene, promotes autophagy-mediated Tau degradation. Nat Commun. 2021;12:3291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Orso F, Quirico L, Dettori D, Coppo R, Virga F, Ferreira LC, et al. Role of miRNAs in tumor and endothelial cell interactions during tumor progression. Semin Cancer Biol. 2020;60:214–24. [DOI] [PubMed] [Google Scholar]
  • 51.Yang L, Li X, Zhang S, Song J, Zhu T. Baicalein inhibits proliferation and collagen synthesis of mice fibroblast cell line NIH/3T3 by regulation of miR-9/insulin-like growth factor-1 axis. Artif Cells Nanomed Biotechnol. 2019;47:3202–11. [DOI] [PubMed] [Google Scholar]
  • 52.Potenzieri A, Uccella S, Preiti D, Pisoni M, Rosati S, Lavarello C, et al. Early IGF-1 receptor inhibition in mice mimics preterm human brain disorders and reveals a therapeutic target. Sci Adv. 2024;10:eadk8123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Pinheiro FI, Araújo-Filho I, do Rego ACM, de Azevedo EP, Cobucci RN, Guzen FP. Hepatopancreatic metabolic disorders and their implications in the development of Alzheimer’s disease and vascular dementia. Ageing Res Rev. 2024;96:102250. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Journal of Orthopaedic Surgery and Research are provided here courtesy of BMC

RESOURCES