Impact of ViP3Aa 86 expressing transgenic maize on the health of Wistar rats: a toxicological study

Abstract

In the agriculture sector, insects and pests are major constraints to increased global food production. With the advancement in genetic engineering, transgenic crops expressing insecticidal proteins are increasingly prevalent in agriculture having the advantages of being eco-friendly over the non-conventional, synthetic insecticides and pesticides, yet concerns persist regarding their safety, particularly on non-target organisms which necessitate to address thorough investigation before widespread commercialization. The current study was aimed to evaluate the toxicity of Vip3Aa86-expressing transgenic maize in Wistar rats. The presence of Vip3Aa86 gene in maize plants was confirmed through PCR and protein quantification was done through ELISA. Comprehensive histopathological examination, blood chemistry, serum chemistry, urine chemistry and molecular analysis of apoptosis and immunity-related genes were done to evaluate any adverse effects on rats. Results indicated no significant differences in growth, organ weights, hematology, serum, urine chemistry, and gene expression analysis between rats fed with transgenic maize diets and control except for a few variations. PCR amplification of DNA isolated from rats’ blood and vital organs did not show transgene amplification in any group. These findings conclude that the consumption of transgenic maize expressing the Vip3Aa86 gene does not pose immediate hazards to rat health under the conditions tested, supporting its regularity approval for commercial use.

Graphical Abstract

Graphical Abstract.

Introduction

Food shortage is one of the biggest problems in the world leading to malnutrition and various diseases associated with an imbalanced diet. As the population is continuously increasing, and it is estimated that the population will be 9.1 billion in 2050, and currently 800 million people are suffering from malnutrition and mostly belong to Sub-Saharan Africa and South Asia.¹ So, food insecurity is currently a real challenge that will be adverse with the further increase in population and different measures should be taken to meet the current food demand to ensure the availability of adequate food.^2,3 advance sustainable agricultural practices that enhance crop productivity while conserving natural resources.⁴ Agricultural biotechnology serves as a potent adjunct to traditional breeding techniques in addressing the global need for high-quality food. Contemporary plant biotechnological tools provide access to extensive gene pools, enabling the incorporation of desirable traits into economically significant crops. Genetically modified (GM) crops present a solution for developing high-yielding, nutritionally enriched, and biotic and abiotic stress-resistant crop varieties.^5,6 maize is an important crop with a significant nutritional value, which can be used as food and forage.⁷ Annually, maize has been extensively utilized in Asia, Sub-Saharan Africa and Latin America.⁸ According to an estimate, 20% of food is based on maize and maize-based products. In contrast to other crops, maize is a multi-purpose crop that could be utilized as food for humans and as forage for livestock; therefore, maize can play a pivotal role in enhancing food security. However, maize is at risk of insect infestation, resulting in a 10–30% yield decline, particularly due to Chilo partellus (maize stem borer).⁹

Since most of the yield losses in maize occur due to insect pest attacks, the insecticidal cry genes from Bacillus thuringiensis encode Cry proteins that possess toxicity against a variety of insects belonging to the Lepidoptera, Coleoptera, and Hymenoptera orders and nematodes.^10–12 Among most insecticidal proteins, the Vip3Aa86 protein was found to be most toxic against lepidopterans and chewing insects that are potential threats against maize.⁹ Therefore, transgenic crops producing Cry proteins have emerged as a possible solution to limit insect damage and have been commercially grown on a large scale worldwide. Several crops including maize, rice, cotton, sugarcane, tomato, potato, eggplants, alfalfa and tobacco have been engineered with insecticidal cry genes and some of them have been commercialized.¹³ Therefore, to cope with insect infestation a transgenic variety of maize harboring Vip3Aa86 gene was developed through agrobacterium-mediated transformation.⁹

Despite the promising benefits of genetically modified (GM) crops, concerns about their safety persist.¹⁴ These concerns encompass potential immunotoxicity, alterations in gene expression, reproductive toxicity, and other unintended effects. Therefore, ensuring the biosafety of new biotechnological advancements prior to their commercialization should be a primary focus for regulatory authorities.¹⁵  Rattus norvegicus (Wistar rat) serves as a prevalent animal model for evaluating the potential health impacts of GM crops on humans, due to their 95% genetic homology with humans and their ability to simulate human diseases.¹⁶ Ninety-day feeding trials are endorsed by scientific regulatory and monitoring bodies to assess the potential toxicity of GM crops on human health and most of these studies have reported no adverse effects on animal health.^17–19 However, some studies have raised concerns regarding the biosafety of genetically modified food and reported fluctuation in some parameters compared to control group.^20,21 Moreover, research on the impact of GM feed on the expression levels of genes related to fertility is scarce. This is crucial, given that dietary supplements, irrespective of GM content, can alter gene expression in animals and significantly affect fertility and overall fitness even before breeding.^17–19

In this study, we have analyzed the toxicological analysis of the transgenic maize variety developed by.⁹ A 90-day feeding study on rats was conducted to investigate the potential hazard of transgenic maize expressing the Vip3Aa86 gene. Rats were selected as model organisms due to their short life span, easy handling, and 95% genetic makeup similarity with humans.

Materials and methods

Bioethics

The study was conducted by following the OECD Good Laboratory Practice (GLP) guidelines in the Entre of Excellence in Molecular Biology, University of the Punjab, Lahore and approved by the Institutional Ethical Committee (Reference number 09/23).

Test and control substance

Genetically modified maize seeds expressing Vip3Aa86 protein were used as a test substance while non-GM maize seeds were used as a control. DNA was extracted from both transgenic and non-transgenic seeds by using the CTAB method to confirm the presence of the transgene through PCR by using gene-specific primers.²² The sequence of gene-specific primers is given in Table 1. Vip3Aa86 protein quantification was done through ELISA by using a commercially available kit using non-transgenic seeds as a reference control (Agdia, Catalog No. PSP 83500).

Table 1.

Primer sequence (5′-3′), annealing temperature, and amplicon size.

Target	Primer	Sequence	Annealing temperature	Amplicon size
VIP3Aa	Forward	GCTGCTCAACGACATCTCTG	57 °C	839 bp
	Reverse	GTTGCTGAAGGTGTTGGAG

Animal and housing

A total of 40 Wistar rats (20 males and 20 females), 6–8 weeks old rats were obtained from the animal house of CEMB. The rats were acclimatized to the environment for one week before the start of the experiment and were randomly divided into four groups (n = 10/group, 5 males and 5 females). The temperature of the animal house was maintained between 24–26 °C with approximately 40–60% moisture and 12 h of dark and light cycles.

Diet composition

Prior to diet formation, maize seeds were sterilized by using 5% sodium hypochlorite and the diet formulated according to the CEMB-optimized protocol.¹⁸ Group one (G1) was fed with the non-transgenic diet, while group two (G2), group three (G3), and group four (G4) were fed with a transgenic diet having 0.15 μg/g, 0.30 μg/g, and 0.45 μg/g of Vip3Aa86 protein concentration respectively quantified by using ELISA. The composition of the diet is given in supplementary table 1.

Nutritional and compositional analysis

The seeds of transgenic and control maize were subjected to analyze the nutritional value in all groups. The concentration of crude protein, dry matter, essential and non-essential amino acids were determined by following the guidelines of AOAC International.^17,23

Weight gain analysis

The weights of the rats in all groups were recorded after every 15-day interval to analyze trends in weight gain and loss.

First filial (F1) generation of rats: Offspring of parental generation

The rat’s first filial (F1) generation was produced by mating rats from each group as G1 male with G1 female, G2 male with G2 female, and so on. Mated four groups of rats by pairing males and females within each group (G1 male with G1 female, G2 male with G2 female, and so on), resulting in the offspring of the P generation. Both of the generations (F1 and P) containing 6–8 weeks old rats were subjected to risk assessment studies after 90 days of feeding transgenic maize to evaluate potential risks associated with specific traits or genetic manipulations.

Clinical pathology

After 90 days of feeding trials, both generations of rats were anesthetized with carbon dioxide and sacrificed via exsanguination to assess any potential effects of GM feed on rats. The liver, heart, kidney, intestine, lungs, and gonads of both control and experimental groups were weighted to analyze relative organ weight and subjected to assess pathology. Organs stored in a 10% neutral formalin buffer solution were cut into small pieces of 5 μm and stained with hematoxylin and eosin.²⁴ Histopathological examination was carried out by analyzing tissue under the compound microscope at 10X resolution.

Hematology

Both generations were undergone into hematology analysis which includes hemoglobin analysis, total leukocyte count, mean corpuscular hemoglobin concentration, mean corpuscular volume, hematocrit, red blood cells, platelets, differential leucocyte count, and mean corpuscular hemoglobin. For this purpose, rats were fasted overnight and blood was collected in anticoagulant (EDTA) tubes.

Serum chemistry

Blood collected directly from the heart after sacrificing rats in a serum separator tube was used to assess the functioning of vital organs, liver, and kidney. A renal function test (RFT) and liver function test (LFT) were performed to analyze the proper functioning of vital organs. LFT analysis includes analysis of aspartate aminotransferase (AST), bilirubin, alanine transaminase (ALT), and alkaline phosphatase (APL), while RFT analysis includes blood urea and creatinine.

Urine chemistry

Prior to sacrifice, Rats were placed overnight in metabolic cages for urine collection. Colour, specific gravity, pH, glucose, and protein were analyzed.

Detection of transgene in rats

Genomic DNA was extracted from the liver, kidney, intestine, heart, and blood by using an organic extraction method to detect transgene in rats.^25,26 The detection of a transgene in genomic DNA was done through PCR using Vip3Aa86 gene-specific primers.

Gene expression analysis

The effect of transgenic maize on the relative expression of different apoptotic and inflammatory genes (Table 2) in the liver was analyzed through real-time quantitative PCR in both parental and first filial generations. Primer synthesis for real-time PCR was done by using primer 3 (https://primer3.ut.ee/) while the validation of primers was done through an oligo analyzer (https://sg.idtdna.com/calc/analyzer). Total RNA extraction was performed by using the TRIzol method (Rio et al., 2010). cDNA was synthesized using a RevertAid First Strand cDNA synthesis kit (Thermo Scientific, catalog number K1622).¹⁸ Quantitative real-time PCR was run in three technical and three biological repeats using applied biosystem StepOne™ 48 well real-time PCR thermocycler. For data normalization, GAPDH was used as a reference gene. 2^{− ΔΔCT} method was used to calculate the relative change in gene expression²⁷ (Table 2). Represents the primer sequence (R = reverse primer and F = forward primer), annealing temperature, amplicon size, and accession number of the sequence of genes that were analyzed. Reaction mixture for real-time quantitative PCR is given in the supplementary table 2. The qPCR profile comprising an initial denaturation at 95 °C for 5 min; 40 amplification cycles of 95 °C for 30 s, a 30 s at annealing temp, and 72 °C for 30 s; followed by a melt curve (95 °C for 15 s, 60 °C for 60 s, 95 °C for 15 s).

Table 2.

Gene	Primer sequence (5′-3)	Annealing temp. (°C)	Amplicon size (bp)	Accession number
GAPDH	F: CGGCAAGTTCAACGGCACAGT R: ACGCCAGTAGACTCCACGACAT	60	144	NM_017008.4
Bcl-2	F: TCCTTCCAGCCTGAGAGCAACC R: CGACGGTAGCGACGAGAGAAGT	61	173	U34964.1
APAF1	F: TGTCCGCTGCTCTGCCTTCT R: CGTGGGTAGCCGTTCCTTCTTC	63	146	AF320222.1
AKT1	F: AGGAGGTCATCGTTGCCAAGGA R: CGCTCACGAGACAGGTGGAAGA	60	181	NM_033230.3
CYCS	F: GCCAGGCTGCTGGATTCTCTT R: GGTCTGCCCTTTCTCCCTTCTT	60	159	NM_012839.2
IL-6	F: GACTTCCAGCCAGTTGCCTTCT R: TGGTCTGTTGTGGGTGGTATCC	61	111	NM_012589.2

Statistical analysis

A one-way analysis of variance (ANOVA) was performed followed by a Dunnett multiple comparison test at a 95% confidence interval based on biological triplicates by using GraphPad Prism8.0.

Results

Conformation of the target gene and protein quantification in maize seeds

The presence of the transgene in maize seeds was confirmed through PCR. The results showed the amplification of the Vip3Aa86 gene (839 bp), which confirms the presence of Vip3Aa86 in test samples. In contrast, no amplification occurred in the non-transgenic and negative control. Protein quantification was done through ELISA which confirmed the presence of Vip3Aa86 transgenic protein in the transgenic diet, while in the control diet, no transgenic protein was detected (Supplementary Fig. 1).

Nutritional and compositional analysis

Results suggested that there was no significant difference observed in the nutritional value of transgenic and non-transgenic diet among all groups (Table 3).

Table 3.

Nutritional and compositional analysis of diet.

Ingredients (%)	G1	G2	G3	G4	P value
Dry matter	88.3	87.9	87.9	88.2	0.1404
Crude protein	9.15	8.99	9.07	9.10	0.3154
Ether extract	3.7	3.5	3.5	3.66	0.1307
Ash	1.26	1.24	1.20	1.19	0.8948
Valine	0.04	0.03	0.03	0.04	0.5464
Lysine	0.27	0.24	0.27	0.25	0.9543
Histidine	0.26	0.25	0.24	0.26	0.9872
Arginine	0.61	0.63	0.60	0.58	0.9155
Threonine	0.43	0.45	0.46	0.42	0.9172
Methionine	0.20	0.20	0.17	0.19	0.6495
Iso-leucine	1.09	1.1	1.07	1.09	0.8330
Phenylalanine	0.42	0.44	0.43	0.39	0.6981
Tryptophan	0.06	0.05	0.06	0.04	0.2705
Leucine	0.12	0.10	0.09	0.10	0.3493
Glutamic acid	1.7	1.8	1.8	1.7	0.1794
Glycine	0.11	0.10	0.09	0.10	0.9967
Serine	0.03	0.03	0.04	0.03	0.7436
Proline	1.01	1.03	1.03	1.01	0.0720
Tyrosine	0.25	0.23	0.24	0.25	0.9759
Alanine	0.65	0.67	0.64	0.68	0.8634

Data represents the mean and the P value represents the significant level among groups.

Clinical observation

All 24 rats remained healthy and behaved normally during the study. No mortality, allergenicity, or change in behavior and activity was observed in any of the groups of either sex.

Body weight

Body weight was recorded after every 15-day interval. There were no significant differences in weight gain or weight loss among the parental (P) and first filial generation (F1) groups for either sex. The weight of all groups increased linearly for both males and females (Fig. 1).

Fig. 1.

Weight gain in rats during 90-day feeding trails. Weight was recorded to analyze the weight gain or loss throughout the experimentation A): Weight gain in male rats of parental generation for 90-day feeding trials B): Weight gain in female rats of parental generation for 90-day feeding trials C): Weight gain in male rats of first filial (F1) generation for 90-day feeding trials D): Weight gain in female rats of first filial (F1) generation for 90-day feeding trials.

Organ weight

Organ weight was recorded at the time of sacrifice, suggesting no significant difference in organ weight was observed in either males or females among all groups in both generations (Supplementary Tables 3–6).

Pathological assays

Hematology

All the parameters of blood count were generally within the normal range in both male and female rats, with some minor variations observed in HCT for male rats and lymphocytes and granulocytes for female rats (Tables 4-7).

Table 4.

Hematology of the parental generation of male rats.

Hematology	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
TLC (×103/μL)	13.96 ± 1.55	12.53 ± 2.35	0.7779	12.06 ± 2.80	0.6196	13.93 ± 2.06	0.9999
RBC (M/mm3)	6.96 ± 0.65	5.04 ± 1.01	0.1157	6.44 ± 0.65	0.8102	7.37 ± 0.33	0.8880
MCV (fL)	58.95 ± 4.17	59.1 ± 4.38	0.9999	60.35 ± 3.04	0.9632	60.8 ± 3.25	0.9241
MCH (pg)	18.1 ± 1.55	17.9 ± 1.97	0.9987	17.85 ± 1.20	0.9976	19.75 ± 2.05	0.6865
HCT (%)	46.85 ± 2.33	36.1 ± 1.55	0.0079	45.85 ± 1.90	0.8885	48.7 ± 0.70	0.6217
Platelet (×103/μL)	138.5 ± 0.70	95.5 ± 6.36	0.0089	142 ± 1.41	0.9255	144 ± 12.72	0.7911
Granulocytes (%)	55.5 ± 0.70	80.5 ± 12.02	0.0842	75.5 ± 6.36	0.1534	71.5 ± 9.19	0.2549
Lymphocytes (%)	37.5 ± 0.70	30.5 ± 3.53	0.2411	27 ± 4.24	0.0877	30 ± 4.24	0.2075
MID (%)	7.25 ± 1.06	5.5 ± 0.70	0.1702	7.5 ± 0.70	0.9728	6.75 ± 0.35	0.8452
MCHC (g/dL)	24.95 ± 2.19	22.6 ± 0.70	0.5209	25.7 ± 2.54	0.9552	24.65 ± 1.48	0.9966
Hemoglobin (g/dL)	17.8 ± 0.28	12.1 ± 0.28	0.0033	25.7 ± 2.54	0.1188	24.65 ± 1.48	0.9978

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 7.

Hematology of the first filial generation of female rats.

Hematology	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
TLC (×103/μL)	7.62 ± 0.49	7.73 ± 0.67	0.9977	8.57 ± 1.72	0.5284	3.95 ± 0.44	0.0048
RBC (M/mm3)	5.56 ± 0.06	4.90 ± 1.26	0.4785	5.80 ± 0.08	0.9396	5.70 ± 0.100	0.9858
MCV (fL)	72.83 ± 0.30	74.7 ± 1.30	0.2242	73.4 ± 1.24	0.8957	72.03 ± 1.65	0.7708
MCH (pg)	25.33 ± 0.76	25.83 ± 0.20	0.6566	24.93 ± 0.57	0.7779	25.23 ± 0.77	0.9943
HCT (%)	40.43 ± 0.60	41.76 ± 0.75	0.2957	42.33 ± 0.45	0.1084	41.26 ± 1.66	0.6222
Platelet (×103/μL)	635 ± 22.91	620 ± 70.53	0.9698	700 ± 71.02	0.3511	622.33 ± 18.71	0.9811
Granulocytes (%)	11.66 ± 0.90	18.2 ± 1.31	0.0104	13.7 ± 3.47	0.3787	14.36 ± 2.17	0.2302
Lymphocytes (%)	84.03 ± 4.41	79.03 ± 1.67	0.2496	83.33 ± 3.81	0.9886	82.46 ± 3.21	0.8984
MID (%)	1.9 ± 0.1	3.16 ± 0.23	0.0078	1.93 ± 0.65	0.9990	1.73 ± 0.25	0.9016
MCHC (g/dL)	34.26 ± 0.64	34.33 ± 1.15	0.9999	33.3 ± 0.60	0.6617	35.16 ± 1.95	0.7037
Hemoglobin (g/dL)	13.96 ± 0.55	14.73 ± 0.20	0.0414	14.43 ± 0.05	0.2325	14.5 ± 0.2	0.1602

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 5.

Hematology of the parental generation of female rats.

Hematology	G1	G2		G3		G4
	Mean ± SD	Mean ± SD		Mean ± SD		Mean ± SD
TLC (×103/μL)	13.5 ± 1.41	15 ± 2.12	0.6530	15.55 ± 0.91	0.4596	16.35 ± 1.20	0.2618
RBC (M/mm3)	6.03 ± 0.74	6.71 ± 0.14	0.5262	6.56 ± 0.77	0.6750	5.87 ± 0.17	0.9829
MCV (fL)	58.65 ± 2.19	56.9 ± 2.82	0.8630	49 ± 3.53	0.0564	52.85 ± 2.33	0.2189
MCH (pg)	18.2 ± 1.41	17.9 ± 1.13	0.9817	14.7 ± 0.84	0.0623	15.9 ± 0.56	0.1928
HCT (%)	41.2 ± 2.82	45.5 ± 1.41	0.6109	45.8 ± 6.64	0.9542	37.95 ± 2.89	0.7613
Platelet (×103/μL)	128.5 ± 12.02	132 ± 19.79	0.9914	123 ± 8.48	0.9695	101 ± 19.79	0.3178
Granulocytes (%)	74 ± 5.65	54 ± 2.82	0.0235	53.5 ± 3.53	0.0216	58.5 ± 4.94	0.0539
Lymphocytes (%)	19.66 ± 4.50	37.33 ± 2.51	0.0043	32 ± 7.21	0.0295	31.66 ± 2.88	0.0335
MID (%)	6.33 ± 0.57	7.33 ± 0.57	0.2664	8 ± 1	0.0495	7.33 ± 0.57	0.2664
MCHC (g/dL)	24.5 ± 0.56	24.5 ± 0.42	0.9999	21.9 ± 2.82	0.3307	23.85 ± 0.91	0.9477
Hemoglobin (g/dL)	14.4 ± 1.69	16.75 ± 1.20	0.3858	15.2 ± 1.83	0.9095	13.15 ± 1.20	0.7586

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 6.

Hematology of the first filial generation of male rats.

Hematology	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
TLC (×103/μL)	7.78 ± 0.39	4.35 ± 0.13	0.0002	4.33 ± 1.04	0.0002	3.79 ± 0.09	0.0001
RBC (M/mm3)	6.07 ± 0.67	5.67 ± 0.96	0.6716	5.89 ± 0.59	0.9797	5.32 ± 0.67	0.5546
MCV (fL)	73.36 ± 1.38	73.56 ± 3.10	0.9991	73.8 ± 3.00	0.9910	69.43 ± 0.92	0.1627
MCH (pg)	25.8 ± 1.50	24.1 ± 0.85	0.5104	26.4 ± 2.62	0.9478	24.66 ± 1.33	0.7603
HCT (%)	45.2 ± 5.75	40.46 ± 5.16	0.4832	42.76 ± 2.65	0.8527	36.60 ± 4.11	0.1179
Platelet (×103/μL)	527.66 ± 17.21	740.33 ± 19.79	0.1303	756.33 ± 152.51	0.1018	769.33 ± 73.92	0.0831
Granulocytes (%)	13.1 ± 0.85	14.6 ± 1.57	0.6001	16.33 ± 1.13	0.1169	12.06 ± 2.70	0.8051
Lymphocytes (%)	84.73 ± 2.41	84 ± 2.64	0.9767	81.93 ± 2.21	0.5068	85.93 ± 3.68	0.9125
MID (%)	2.06 ± 0.15	2.3 ± 0.45	0.6532	2.6 ± 0.2	0.1268	2.13 ± 0.25	0.9839
MCHC (g/dL)	34.96 ± 2.65	34.03 ± 0.95	0.8844	35.73 ± 2.28	0.9294	35.6 ± 1.4	0.9575
Hemoglobin (g/dL)	15.4 ± 0.87	15.6 ± 0.52	0.9924	13.46 ± 1.74	0.1586	13 ± 1	0.0752

Data represents the mean with standard deviation and P value represents significant level among groups.

Serum chemistry

Liver function test

The liver function test suggested that no abnormality was found in any group. All parameters of the liver function test were within the normal range, and no statistical difference was found among all males of the parental generation except bilirubin. However, in females of parental generation, all parameters show no significant difference except ALT and AST (Tables 8-11).

Table 8.

LFT of the parental generation of male rats.

LFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Bilirubin (mg/dL)	0.35 ± 0.07	0.35 ± 0.07	0.9999	0.45 ± 0.07	0.4452	0.65 ± 0.07	0.0299
ALT (U/L)	44 ± 11.31	35.5 ± 9.19	0.6749	54 ± 5.65	0.5791	43.5 ± 7.77	0.9999
AST (U/L)	70 ± 10	75 ± 5	0.8822	70 ± 10	0.9999	70.33 ± 14.22	0.5541
ALP (U/L)	108.5 ± 30.40	116.5 ± 26.16	0.9762	119 ± 28.28	0.0703	188 ± 11.31	0.0756

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 11.

LFT of the first filial generation of female rats.

LFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Bilirubin (mg/dL)	0.63 ± 0.05	0.56 ± 0.05	0.6007	0.46 ± 0.11	0.0680	0.56 ± 0.05	0.6007
ALT (U/L)	152.33 ± 30.43	116 ± 27.78	0.1827	136.33 ± 15.82	0.7184	134.66 ± 5.50	0.6609
AST (U/L)	85 ± 5	82 ± 10.58	0.9842	75 ± 21.79	0.6866	83 ± 8.88	0.9951
ALP (U/L)	135 ± 5	161 ± 45.31	0.4635	153.33 ± 15.27	0.6952	139.66 ± 8.96	0.9905

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 9.

LFT of the parental generation of female rats.

LFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Bilirubin (mg/dL)	0.6 ± 0.14	0.55 ± 0.07	0.9405	0.8 ± 0.14	0.3014	0.45 ± 0.07	0.4790
ALT (U/L)	52 ± 4.24	36 ± 1.41	0.0405	66 ± 2.82	0.0615	59.5 ± 6.36	0.2941
AST (U/L)	77.66 ± 9.29	35 ± 5.19	0.0005	68.33 ± 11.37	0.3966	64 ± 3.60	0.1597
ALP (U/L)	244 ± 4.24	149 ± 31.11	0.0119	198.5 ± 12.02	0.1235	195 ± 7.07	0.1011

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 10.

LFT of the first filial generation of male rats.

LFT	G1	G2	P value	G3	P value	G4	P value
Bilirubin (mg/dL)	0.45 ± 0.07	0.35 ± 0.07	0.4452	0.45 ± 0.07	0.9999	0.55 ± 0.07	0.4452
ALT (U/L)	100.66 ± 10.96	87 ± 7	0.3996	98 ± 6.55	0.9844	114.66 ± 18.44	0.3825
AST (U/L)	60 ± 4.35	66 ± 6.55	0.4441	69.33 ± 6.02	0.1627	93.66 ± 4.72	0.0002
ALP (U/L)	222.67 ± 9.60	45.33 ± 9.50	0.1137	55.33 ± 6.50	<0.0001	55.66 ± 4.93	<0.0001

Data represents the mean with standard deviation and P value represents significant level among groups.

Renal function test

A renal function test was performed to find abnormality in kidney functioning. However, results showed that all renal function parameters were within the normal range and showed no statistically significant difference among all groups in both males and females of parental generation (Tables 12-15).

Table 12.

RFT of the parental generation of male rats.

RFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Urea (mg/dL)	28.5 ± 3.53	26.5 ± 3.53	0.9558	26.5 ± 0.07	0.9458	188 ± 11.31	0.8552
Creatinine (mg/dL)	1.145 ± 0.06	1.145 ± 0.20	0.9999	0.85 ± 0.07	0.4490	0.95 ± 0.35	0.7000

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 15.

RFT of the first fi generation of female rats.

RFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Urea (mg/dL)	60.66 ± 6.65	42.66 ± 2.51	0.0045	49 ± 4	0.0428	55 ± 5	0.3867
Creatinine (mg/dL)	0.66 ± 0.05	0.56 ± 0.057	0.1535	0.63 ± 0.05	0.8223	0.633 ± 0.05	0.8223

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 13.

RFT of the parental generation of female rats.

RFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Urea (mg/dL)	22.33 ± 3.51	29.33 ± 4.50	0.2457	28 ± 6.55	0.3867	28 ± 4	0.3867
Creatinine (mg/dL)	0.633 ± 0.11	1.33 ± 0.25	0.1202	1.16 ± 0.25	0.0388	1.13 ± 0.20	0.0515

Data represents the mean with standard deviation and P value represents significant level among groups.

Table 14.

RFT of the first filial generation of male rats.

RFT	G1	G2		G3		G4
	Mean ± SD	Mean ± SD	P value	Mean ± SD	P value	Mean ± SD	P value
Urea (mg/dL)	48.33 ± 9.60	45.33 ± 9.50	0.9359	55.33 ± 6.50	0.5903	55.66 ± 4.93	0.5588
Creatinine (mg/dL)	0.56 ± 0.057	0.56 ± 0.057	0.9999	0.6 ± 0.1	0.8894	0.633 ± 0.05	0.5485

Data represents the mean with standard deviation and P value represents significant level among groups.

Urine chemistry

Urine analysis indicates that there was no sign of abnormality in urine chemistry. No protein and glucose were detected in any group of both generations of all rats. All parameters of urine chemistry were within the normal range, and no significant difference was observed in both generations in either males or females among all groups (Supplementary Table 6 and 7).

Histopathology

A thorough analysis of slides suggests no significant difference in structural changes at the cellular level, and no structural abnormality was detected due to transgenic diet among all groups of both generations (Supplementary Figs 2–13).

Detection of transgene in rat

PCR was used to detect the presence of the transgene in different rat organs. Results suggested there was no amplification of transgene in both the parental and the first filial generation of rats, while there was amplification (839 bp) in the positive control (Fig. 2).

Fig. 2.

Detection of transgene in rats through PCR. DNA was extracted from different organs of rats to detect the horizontal gene transfer through PCR A): Detection of the transgene in the parental generation of rats B): Detection of the transgene in the first filial (F1) generation of rats. Lane 1:1 kb plus ladder, lane 2: Positive control (839 bp amplification), lane 3: rat’s liver, lane 4: rat’s kidney, lane 5: rat’s hearts, lane 6: rat’s blood.

Relative gene expression

The effect of transgenic maize on the relative expression of different apoptotic and inflammatory genes in the liver such as AKT-1, APAF1, Bcl-2, Cycs, and IL-6 was analyzed in both parental and first filial generations. There was no significant difference observed in both generations except for a few variations like the expression of AKT-1 was upregulated 2.16-fold in the 4th group of males compared to control rats in the P generation, while its expression was 0.42-fold downregulated in the 2nd group of males in the F1 generation. (Figs 3-7).

Fig. 3.

Relative gene expression of AKT1 in rat’s liver. RNA was extracted from rat’s liver to analyze the gene expression of AKTI through RT-qPCR. A): Relative gene expression of AKT1 in male rats in the parental generation. B): Relative gene expression of AKT1 in female rats in the parental generation. C): Relative gene expression of AKT1 in male rats in the first filial (F1) generation D): Relative gene expression of AKT1 in female rats in the first filial (F1) generation.

Fig. 7.

Relative gene expression of IL-6 in rat’s liver. RNA was extracted from rat’s liver to analyze the gene expression of IL-6 through RT-qPCR A): Relative gene expression of IL-6 in male rats in the parental generation B): Relative gene expression of IL-6 in female rats in the parental generation C): Relative gene expression of IL-6 in male rats in the first filial (F1) generation D): Relative gene expression of IL-6 in female rats in the first filial (F1) generation.

Fig. 4.

Relative gene expression of APAF1 in rat’s liver. RNA was extracted from rat’s liver to analyze the gene expression of APAF1 through RT-qPCR A): Relative gene expression of APAF1 in male rats in the parental generation B): Relative gene expression of APAF1 in female rats in the parental generation C): Relative gene expression of APAF1 in male rats in the first filial (F1) generation D): Relative gene expression of APAF1 in female rats in the first filial (F1) generation.

Fig. 5.

Relative gene expression of BCL-2 in rat’s liver. RNA was extracted from rat’s liver to analyze the gene expression of BCL-2 through RT-qPCR A): Relative gene expression of BCL-2 in male rats in the parental generation B): Relative gene expression of BCL-2 in female rats in the parental generation C): Relative gene expression of BCL-2 in male rats in the first filial (F1) generation D): Relative gene expression of BCL-2 in female rats in the first filial (F1) generation.

Fig. 6.

Relative gene expression of Cycs in rat’s liver. RNA was extracted from rat’s liver to analyze the gene expression of Cycs through RT-qPCR A): Relative gene expression of Cycs in male rats in the parental generation B): Relative gene expression of Cycs in female rats in the parental generation C): Relative gene expression of Cycs in male rats in the first filial (F1) generation D): Relative gene expression of Cycs in female rats in the first filial (F1) generation.

Discussion

Maize is an essential crop in Pakistan that contributes about 2.4% of the total GDP of Pakistan.²⁸ Stem borer is the major insect pest of maize which harms the plant and reduces its yield. Bt toxin holds the potential to provide resistance against these damaging pests. GM crops have better been adopted to be used against significant challenges, especially insect infestation.²⁹ Insect-resistant maize could prevent 10–30% of yield loss solely due to insect infestation.⁹

Despite the potential and advantages of GM crops, there are serious concerns about the adaptation of GM crops on account of their associated risks.³⁰ To address these risks, the European Union introduced a legal framework. According to EU regulation No. 503/2013, it is mandatory to conduct 90 days feeding study to assess the safety of GMOs.³¹ The Cartagena Protocol on Biosafety was also adopted under the Convention on biological diversity to address the possible problems of using GMOs.³²

The current study assesses the risk associated with transgenic maize expressing the Vip3Aa86 gene. Vip3Aa86 is an insecticidal protein produced by B. thuringiensis during its vegetative growth.³³ Many feeding studies have been reported to analyze the risk assessment of Vip3Aa86 transgenic plants, and no adverse effects have been reported.^34–37 Confirmation of transgene Vip3Aa86 was done by using PCR from the seeds of transgenic maize and protein quantification was done through ELISA as reported by previous studies.^17–19 During this study, rats were fed with transgenic maize, and no difference in weight gain was observed among the control and experimental groups because there was no difference in the nutritional value of both transgenic and non-transgenic maize. The results are in accordance with previous studies.^34,36,38 Hematological analysis was performed as it is considered a vital parameter to assess the toxicity of the test substance. No difference in hematology parameters except HCT (46.85% in the control group while 36.1%, 45.8%, 48.7% in G2, G3, and G4 respectively) was observed in male rats of the parental (P) generation along with granulocytes and lymphocytes in female rats while RBC showed a significant difference among groups that could be due to individual’s variability. TLC and hemoglobin were also statistically different in male rats of the first filial (F1) generation but values of all these parameters were within the normal range. These findings are in accordance with the previous studies.^39,40 All the parameters of liver function, renal function test, and urine chemistry were analyzed to assess the normal functioning of the body’s vital organs. AST, ALT, and ALP are used as a biomarker to identify the structural and functional integrity of the liver. Creatinine is a chemical waste filtered out by the kidney, and its higher level indicates a problem in the functionality of the kidney, while urine analysis can be used to diagnose urinary tract infections and kidney diseases. In the current study, there was no statistically significant difference in urine chemistry, LFT, and RFT was observed in both generations, except for a few variations observed in ALP of the F1 generation of male rats of only the 3rd (469.67 U/L) and 4th (440 U/L) groups that could be due to individual variability. These results are consistent with previous research studies.^34,36,38,39

Further, the histopathology of different tissues was also examined to inspect any abnormality but no structural anomaly or weight differences were detected in any organ tissue of both generations as reported by previous studies.^41–43 In the current study, the detection of horizontal gene transfer of Vip3Aa86 in rats was also done, indicating no horizontal gene transfer as documented by previous studies.^19,40

In this study, gene expression of different genes in the liver was also analyzed to assess the toxicity of transgenic maize, as the liver is one of the most sensitive organs involved in detoxifying different toxins.⁴⁴ We analyzed the expression of AKT-1 and Bcl-2 genes as they are involved in cell survival by inhibiting apoptosis. Its expression could be used as a marker to diagnose injury in the liver, as apoptosis is the natural phenomenon of cell death. If apoptosis is inhibited, it leads to uncontrolled growth of cells.^45,46 The current study showed no statistical differences in gene expression among all groups in both generations, with few variations in the females P generation and males in the F1 generation such as the expression of AKT-1 was upregulated 2.16-fold in the 4th group of males compared to control rats in the P generation, while its expression was 0.42-fold downregulated in the 2nd group of males in the F1 generation. Previous studies also reported that the AKT-1 gene is used as a biomarker in different liver diseases and as a cell survival signal.⁴⁷ In contrast, there was a significant difference in the expression of the Bcl-2 gene in both the P and F1 generations with few exceptions, and irregular gene expression patterns among all groups could be due to individual variability, not due to the toxicity of transgenic maize, and this needs to be further studied.

Expression analysis of the APAF1 gene was also analyzed that encodes a protein involved in initiating apoptosis when a cell goes under stress can be used as a marker to identify cell stress.⁴⁸ The expression significantly differed in males and females in the P generation. However, the pattern of expression in males was irregular as expression was downregulated in the 2nd group (0.68-fold), upregulated in the 3rd group (1.6-fold), and again downregulated in the 4th group (0.67-fold) as compared to the control group. The expression of APAF1 was also statistically different in the F1 generation in both males and females. The expression in females of the P generation was upregulated, but that may not be solely due to the transgenic diet, as previous studies have reported that with age, the expression of the APAF1 gene increases.⁴⁹

The expression level of Cycs was also analyzed. The Cycs gene is involved in the electron transport chain for the production of ATP, and it can be used as a marker to identify mitochondrial Dysfunction.⁵⁰ Results showed no statistical differences in males of the P generation and females of the F1 generation but statistically significant differences in the females of the P generation and males of the F1 generation. Results suggested that gene expression was not much downregulated among all the groups. Hence, we can conclude that transgenic maize does not lead to mitochondrial dysfunction.

IL-6 was also analyzed because it is an inflammatory cytokine that can be used to assess the presence of any toxins in the tissue.⁵¹ Results suggested a significant difference was observed in both males and females of the P generation, while the females of the F1 generation showed no significant difference in females. The expression was downregulated in experimental groups compared to the control group in males of the F1 generation, while the expression of IL-6 was upregulated 9.95-fold compared to the control group in male rats of the parental generation. Due to the irregular pattern in the expression of IL-6 in different groups, we cannot conclude that it is due to the toxin present in transgenic maize. It could be due to some internal factors or stress. A previous study has also reported elevated levels of IL-6 in weaning mice, and our results showed coherence with the previous study.⁵² Although our study indicates few variations among transcriptome levels of different genes among different groups, but these changes were irrespective of the consumption of transgenic maize due to an irregular pattern of up or downregulation of particular genes and these variations could be due to individual’s physiology. This study is novel in investigating the effect of transgenic maize on the expression of apoptosis and immunity-related genes.

Conclusion

The present study attempted to evaluate the risk associated with transgene Vip3Aa86 on Wistar rats. The results taken up to P and F1 generation were assessed through various parameters such as hematology, LFT, RFT, histopathology, and relative gene expression of different genes showed no adverse effects found in rats by feeding transgenic maize. This study will support the successful development and commercialization of GM crops in Pakistan.

Author contribution

HMZ: Execution, data interpretation and article writing. AI: Assist during experimentation. SA: Execution and create the concept. NA: Assist during experimentation. AL: Assist during experimentation. AY: Assist during experimentation. AMF: Assist during experimentation. SN: Assist during experimentation. TRS: Assist during experimentation. AQR: Reviewed the article for final improvement. AAS: Reviewed the article for final improvement.

Funding

It is to inform that no funding body is involved in this research titled “Impact of ViP3Aa 86 Expressing Transgenic Maize on the Health of Wistar Rats: A Toxicological Study”.

Conflicts of interest: There is no conflict of interest among authors.