Skip to main content
NCBI home page
The Journal of Neuroscience logoLink to The Journal of Neuroscience
. 2025 Sep 10;45(43):e0371252025. doi: 10.1523/JNEUROSCI.0371-25.2025

Smg5 Enhances Oligodendrocyte Differentiation via Nonsense-Mediated mRNA Decay of Hnrnpl Variant Transcripts

Min Jiang 1,2, Conghui Li 1,2, Binghua Xie 2, Tangliang Li 3, Zhong-Min Dai 2,✉, Mengsheng Qiu 1,2,✉
PMCID: PMC12548713  PMID: 40930975

Abstract

Nonsense-mediated mRNA decay (NMD) is a conserved RNA surveillance mechanism that degrades transcripts with premature termination codons (PTCs) and fine-tunes gene expression by targeting RNA transcripts with other NMD inducing features. This study demonstrates that conditional knock-out of Smg5, a key NMD component, in oligodendrocyte lineage cells disrupts the degradation of PTC-containing transcripts, including aberrant variants of the RNA-binding protein Hnrnpl. The loss of SMG5 in both sexes of mice impaired oligodendrocyte differentiation, reduced myelin gene expression, and led to thinner myelin sheaths and compromised motor function in mice. Mechanistically, HNRNPL was shown to regulate the alternative splicing of myelin-associated genes Mag and Nfasc and promote oligodendrocyte differentiation. These findings reveal that SMG5-mediated NMD ensures RNA processing fidelity essential for proper oligodendrocyte development and CNS myelination.

Keywords: alternative splicing, Hnrnpl, Mag, nonsense-mediated mRNA decay, oligodendrocyte differentiation, Smg5

Significance Statement

The deletion of Smg5 in oligodendrocyte lineage cells disrupts terminal differentiation by impairing nonsense-mediated mRNA decay (NMD). This NMD deficiency dysregulates Hnrnpl expression, revealing that Smg5-dependent post-transcriptional control of Hnrnpl is essential for oligodendrocyte maturation. Mechanistically, HNRNPL protein promotes the splicing of Mag pre-mRNA, enabling production of the large MAG, a critical effector of central nervous system myelin sheath formation. Thus, the Smg5–Hnrnpl–Mag axis constitutes a previously unrecognized regulatory pathway indispensable for CNS myelination.

Introduction

In the central nervous system (CNS), mature oligodendrocytes (OLs) elaborate myelin sheaths, a major component of the white matter, that facilitate electrical propagation and provide metabolic and energetic supports for neuronal axons. Mounting evidence suggests that oligodendrocytes are also involved in refining the formation of neural circuits and regulating the learning and behavior of animals (Marques et al., 2016; Stadelmann et al., 2019; Kato and Wake, 2021; Blanchard et al., 2022). Hence, oligodendrocytes possess an essential role in the functioning of CNS.

Nonsense-mediated mRNA decay (NMD) is a highly conserved RNA surveillance and regulatory mechanism involved in translation-coupled quality control processes (Frischmeyer and Dietz, 1999; Wilusz et al., 2001; Chang et al., 2007; Hug et al., 2016). Specifically, NMD degrades mRNAs that contain a premature termination codon (PTC) located >50 nucleotides upstream of the last exon–exon junction (Hug et al., 2016). In NMD process, the exon junction complex (EJC) stimulates the phosphorylation of (S/T)Q motifs in UPF1 by the kinase SMG1. UPF1 phosphorylation event facilitates the recruitment and activation of either the SMG6 endonuclease or the SMG5-SMG7 exonuclease, both of which can process mRNAs for degradation (Wang et al., 2001; Kashima et al., 2006; Kuroha et al., 2009). The coupling of mRNA alternative splicing and NMD (AS-NMD) is well known to fine-tune the expression of numerous genes including many RNA splicing factors (Garcia-Moreno and Romao, 2020; Chen et al., 2024). Notably, NMD also targets RNA transcripts containing upstream open reading frames or abnormally long 3′-untranslated region (3′-UTR) to regulate mRNA levels and thus fine-tunes gene expression (Bühler et al., 2006; Hung et al., 2008; Rossbach et al., 2009; Martin et al., 2021). Loss of NMD factors causes early embryonic lethality in mice (Han et al., 2018). Genetic studies show a strong link between NMD-related factors and neurodevelopmental disorders (Tarpey et al., 2007; Laumonnier et al., 2010; Addington et al., 2011; Nguyen et al., 2013; Lin et al., 2024). Myelination is a critical process in nervous system development, with myelin-related genes such as MAG playing essential roles (Li et al., 1994; Fujita et al., 1998; Pan et al., 2005). The transcription factor SOX10 has been identified as one of the key factors in the differentiation of oligodendrocytes and the process of myelinogenesis (Stolt et al., 2002). Interestingly, it has been found that many dominant pathogenic nonsense mutations in SOX10 are alleviated by the NMD pathway (Inoue et al., 2004). However, the role of NMD in oligodendrocyte development and myelinogenesis remains unexplored. Since oligodendrocytes are responsible for myelination in the central nervous system, exploring this relationship could provide insights into myelination mechanisms and the pathophysiology of related disorders, potentially leading to new therapeutic approaches.

In this study, we report that SMG5-mediated NMD regulates the differentiation of oligodendrocytes partially through degrading the PTC-containing transcript of RNA-binding proteins Hnrnpl. Deletion of Smg5 in oligodendrocyte lineage reduced the level of functional HNRNPL protein, leading to aberrant splicing of myelin-associated genes and inhibition of myelin gene expression.

Materials and Methods

Animals

The use of the animals was approved by the Committee of Laboratory Animals, Hangzhou Normal University. Mouse line for Smg5fx/fx was described previously (Chen et al., 2024). Olig1Cre (JAX stock #011105; Lu et al., 2002) was used to knock-out Smg5 in all oligodendrocyte lineage cells, and CnpCre was used to knock-out Smg5 in myelinating oligodendrocyte cells (Lappe-Siefke et al., 2003). Mice of either sex were used for sampling.

RT-PCR and qRT-PCR

Total RNA was extracted using RNAiso Plus (TaKaRa). Reverse transcription was performed using HiScript III Reverse Transcriptase Kit (Vazyme). Briefly, each 5 µg of total RNA was mixed with 2 µl of 5× gDNA wiper Mix in a 10 µl reaction and incubated at 42°C for 2 min to remove genomic DNA contamination. The RNA was then mixed with 2 µl of 10× RT Mix, 2 µl of HiScript III Enzyme Mix, and RNase-free water to a volume of 20 µl. The reverse transcription was conducted by incubation at 50°C for 15 min followed by 85°C for 5 s. The cDNA products were diluted 10-fold with ddH2O prior to qPCR. Quantitative PCR was conducted using ChamQ Universal SYBR qPCR Master Mix (Vazyme) in a 20 µl reaction containing 2 µl of diluted cDNA template and 0.4 µM gene-specific primers. Cycling conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 10 s, and 60°C for 30 s, after that, a melting curve analysis was conducted to verify the amplification specificity. Relative expression levels were calculated using the 2(−ΔΔCt) method using Gapdh as a reference gene. All experiments were performed with three biological replicates, and statistical significance was determined by unpaired t tests with Welch's correction. The primer information of all genes is shown in Data S1.

Luciferase assay

The PrimeSTAR GXL (TaKaRa) DNA Polymerase was employed to PCR amplify the Mag genomic sequence containing exons 11–13 from the mouse genomic DNA using the following primers: psiCheck2-mag-F: 5-′taatacgactcactataggctagcat; gaagaatgtcacggagagctccagcttc-3′ and psiCheck2-mag-R: 5′-ggtcgtacaccttggaagccatg; gtggctagccccttgactcggatttctgcatactca-3′. Mag-Ren-luc vector was generated by cloning the PCR product into the NheI site of psiCheck2 (Promega), which results in the in-frame translation of Renilla luciferase following Mag with the skipping of exon 12. The CA-repeat sequence of mag intron of Renilla luciferase was deleted using improved overlap extension PCR (IOEP; Guo et al., 2019) using the following primers: psiCheck2-mag-ΔCACA-F: 5-′gtgagagggccccctgtggctcccacttagct; tgggaaggacagg-3′ and psiCheck2-mag-ΔCACA-R: 5-′gggagccacagggggccctctcacctca; tacttatcaggtgcccc-3′.

Antibodies and reagents

Information for antibodies used is as follows: anti-SOX10 (Oasis Biofarm, OB-PGP001), anti-MBP (Affinity Biosciences, BF8010), anti-Ki67 (Abcam, ab15580), CopGFP (Oasis Biofarm, OB-PRT011), and ISL1 (Oasis Biofarm, OB-MMS016).

Immunofluorescence staining and analysis of images

Animals were subjected to transcardial perfusion with 4% cold paraformaldehyde (PFA) following deep anesthesia. Subsequently, the tissues were excised and underwent overnight postfixation in 4% PFA. Cryoprotection was achieved through immersion in a 30% sucrose solution, after which the tissues were embedded in an optimal cutting temperature compound (OCT) medium (Sakura Finetek) and sectioned to a thickness of 14 µm. Sections were initially washed with phosphate-buffered saline (PBS) and subjected to antigen retrieval in a citrate buffer at temperatures ranging from 85–98°C for 25 min. Following this, the sections were rinsed thrice with PBS, incubated with a blocking solution containing 10% goat serum and 0.1% Triton X-100 for 1 h, and immediately proceed to an overnight incubation at 4°C with the primary antibodies in the blocking solution. Afterward, the sections were washed three times with PBS, incubated with secondary antibodies for 2 h at room temperature, and subsequently washed and mounted using Mowiol mounting medium (MMM) with 4′,6-diamidino-2-phenylindole (DAPI) for fluorescence visualization. Fluorescent images were captured using either a ZEISS or Leica epifluorescence microscope.

In situ RNA hybridization

Following the anesthesia of mice, perfusion was initially conducted with 1× PBS, and subsequently with 4% PFA dissolved in 1× PBS. Brain and spinal cord tissues were then retrieved and subjected to overnight postfixation in 4% PFA. Subsequently, these tissues were cryoprotected in a 30% sucrose solution (v/v) within 1× PBS at 4°C for an entire night. Thereafter, the tissues were embedded in an optimal cutting temperature compound (OCT) medium (Sakura Finetek) and sectioned on a cryostat to achieve a Fronen sections with the thickness of 16–18 µm that were subjected for in situ hybridization (ISH). ISH of sections was performed using digoxigenin-labeled riboprobes, according to the method described by Schaeren and Wiemers (Schaeren-Wiemers and Gerfin-Moser, 1993).

TrueGold staining

Brain sections were sequentially obtained from the brains of WT and Smg5-CKO mice. The tissue was fixed in 4% PFA and cut into 14–18 µm slices using a freezing microtome. Subsequently, the slices were brought to room temperature and baked at 37°C for 30 min. Myelin staining was performed using TrueGold Myelin Staining Kit (Oasis Biofarm) according to manufacturer's instruction. Briefly, tissue sections were hydrated and incubated in a 0.3% TrueGold solution at 45°C in the dark for 20–30 min. Following this, the sections were washed in distilled water and fixed in 1% sodium thiosulfate at 45°C for 3 min. After rinsing with water, the sections were dehydrated through an alcohol gradient and coverslipped with a mounting medium.

Grip strength

The grip strength test is widely used to assess the muscle strength of both forelimbs and hindlimbs, providing an essential measure of neuromuscular function. In the forelimb grip strength assessment, the base of the mouse's tail is gently grasped, and the animal is lifted above a grid platform, such that only the forepaws can grip the grid or T-bar. While maintaining the mouse's body in a horizontal position, a steady backward pulling force is applied until the animal releases its grip on the grid or bar. Typically, the mouse will continue to hold onto the surface until the increasing force surpasses its grip strength. The protocol for assessing grip strength in both the forelimbs and hindlimbs is similar, with the body positioned parallel to the grid to enable simultaneous measurement of both sets of limbs. Upon release of the grip, the grip strength meter records the maximum force exerted, which is displayed as the peak tension (in grams). The average value from three consecutive trials, taken at 15 min intervals, is used as the final evaluation of the mouse's grip strength.

Rotarod

The rotarod is a widely utilized method to assess motor coordination and balance in rodents (Dunham and Miya, 1957; Hu et al., 2024). Training phase: Animals were trained daily on a rotating rod set to a constant speed of 4 rotation per minute (rpm). Initially, mice may fall off the rod, but they were immediately placed back on to continue their attempts to maintain balance. Each training session lasted for 3 min, and animals underwent training three times daily, with a minimum 30 min interval between sessions. Testing phase: In the testing phase, each mouse underwent four trials per day, with the total testing period spanning 2 d. A minimum 30 min recovery interval was allowed between trials. In each trial, four mice were placed carefully on the rod rotating at 4 rpm for 2 min to allow them to acclimate. Following the acclimation period, the timer was started, and the rod accelerated over the course of 300 s from 4 to 40 rpm. The latency to fall from the rod is recorded for each animal as a measure of motor performance.

Hargreaves test

The Hargreaves test is used to evaluate the thermal pain threshold of rodent hindpaws by assessing the latency of withdrawal responses to heat stimuli (Hargreaves et al., 1988). Baseline paw withdrawal latencies were obtained by averaging three consecutive measurements taken at 15 min intervals for both the left and right hindpaws. The heat stimulus was calibrated so that the baseline withdrawal latencies in wild-type mice ranged from 8 to 11 s, with a cutoff time set at 20 s to prevent tissue damage. The voltage of the heat source with baseline values was used for comparison to assess any changes in thermal sensitivity. The testing process was blinded to the group allocation to minimize bias.

RNA-seq and bioinformatic analysis

Spinal cord tissues at postnatal day (P7) were dissected from WT and Olig1Cre;Smg5-CKO mice, immersed in RNAstore solution (CWBIO), and stored in 80°C before RNA isolation. Total RNA was purified using RNAiso Plus (TaKaRa). For construction of sequencing libraries, 1 µg of total RNA was used with VAHTS mRNA-seq V2 Library Prep kit for Illumina (Vazyme Biotech). We performed the 2× 150 bp paired-end sequencing (PE150) on an Illumina NovaSeq 6000 (LC-Bio Technologies). Full-length cDNA Nanopore sequencing was performed by Wuhan Benagen Technology. The RNA-seq raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Chen et al., 2021; Genomics, Proteomics & Bioinformatics 2021) in National Genomics Data Center (Members and Partners, 2024; Nucleic Acids Res 2024), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: CRA021825 and CRA021848) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa.

Plasmid construction

The target gene sequences were cloned into BamHⅠ and NotⅠ site of pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences; hereinafter referred to as PCDH) for transfection and overexpression. The PCDH vector was modified to containing 3× FLAG or 3× MYC and used for cloning of genes of interest for Co-IP assay. The shRNA sequences were cloned into BamHⅠ and EcoRⅠ site of pGreenPuro (CMV) vector (System Biosciences) for lentivirus packaging and subsequent gene knockdown. All constructs were generated either by classical restriction-ligation or seamless cloning (Beyotime, D7010M). Primer sequences are provided in Data S2.

Cell experiments

Lentiviral Packaging and Cell Infection: HEK293T cells (3 × 106 cells per well) were seeded in 6-well plates, and transfection was performed at 70–80% cell confluency. For each well, Solution A was prepared by mixing 20 µl 1× Fect transfection reagent (Oasis Biofarm, BR-TF001) with 105 µl DMEM. Solution B contained plasmids (total 1 µg/well; target plasmid:psPAX2:pMD2.G ratio 4:3:1) in DMEM, adjusted to 125 µl. Solutions A and B were combined, incubated (25–30 min, RT), and added dropwise. Medium was replaced with fresh DMEM 8 h posttransfection. Viral supernatant was harvested at 24, 48, and 72 h posttransfection, centrifuged (4°C, 3,000 × g, 5 min), filtered (0.45 µm pore size), and concentrated by ultracentrifugation (4°C, 18,000 × g, 120 min). The pellet was resuspended in 100–200 µl 1× PBS. CG4 cells at 50–60% confluency were infected and selected with puromycin (0.5–2 µg/ml) at 72 h postinfection. Stably transfected cells were isolated after 3–7 d and maintained with puromycin. Transduced CG4 cells were plated (1 × 104 cells per well) in 6-well plates. At 50–60% confluency, cells were washed twice with 1× PBS. Cell differentiation was induced by replacing proliferation medium with CG4 differentiation medium supplemented with 30 ng/ml T3. The medium was refreshed every 2–3 d for 3–5 d. pMD2.G and psPAX2 were gifts from Didier Trono [Addgene plasmid #12259 (http://n2t.net/addgene:12259) and #12260 (http://n2t.net/addgene:12260)].

Co-IP assay

For Co-IP, HEK293T cells were lysed in buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% NP-40) supplemented with protease inhibitors (Beyotime, P1005). Lysates were incubated with 15 µl anti-FLAG magnetic beads (Sigma, M8823) in 1 ml lysis buffer overnight at 4°C with rotation. Bound proteins were eluted in 200 µl lysis buffer containing 7.5 µg 3× FLAG peptide (APExBIO, A6002) at 25°C for 45 min with rotation. Eluates were mixed with 5× loading buffer, denatured at 95°C for 5 min, and analyzed by immunoblotting.

Statistical analysis

All analyses were performed using GraphPad Prism 9.0.0. Data are expressed as mean ± SEM. Significance levels: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Unpaired two-tailed Student's t tests (data confirmed normal by Shapiro–Wilk test, α = 0.05) were used for two-group comparisons. Two-way ANOVA (factors: developmental time, genotype) was used for multigroup comparisons of mouse body weight/developmental time. Two-way ANOVA with Tukey's post hoc test was used for rotarod test. Pearson's correlation with linear regression was used for spinal cord G-ratio analysis.

Results

Smg5 mutation does not affect the generation of oligodendrocyte precursor cells and motor neurons

We analyzed the single-cell RNA sequencing (scRNA-seq) data of mice from Allen Brain Map Cell Types Database (Tasic et al., 2016; de Vries et al., 2020; Yao et al., 2021; Zhang et al., 2023): Whole Cortex & Hippocampus-10x Genomics (2020; Yao et al., 2021) with 10x-SMART-seq taxonomy (2021) with the aim of investigating the expression levels of Smg family genes in oligodendrocytes. Cell clusters of oligodendrocyte lineage can be identified by their expression of stage-specific molecular markers. While Sox10 is a pan-oligodendroglial marker that is expressed from immature OPCs to differentiated oligodendrocytes, Pdgfra specifically marks oligodendrocyte precursor cells (OPCs), and Mag labels mature oligodendrocytes (OLs). It can be inferred that SMG5 is expressed in oligodendrocytes, containing SMG6 and SMG7 (Supplementary Fig. S1). To investigate the in vivo role of Smg5 in oligodendrocyte differentiation and myelination, we crossed Olig1cre; Smg5fx/+ mice with Smg5fx/fx mice to obtain mice with conditional Smg5 deletion in oligodendroglial lineage cells (Olig1cre;Smg5fx/fx, referred to as Smg5-CKO). Smg5-CKO mice exhibited conspicuous developmental defects, including weight loss and a significant reduction of body size, beginning at ∼P7 (Fig. 1A,B).

Figure 1.

Figure 1.

Open in a new tab

OPCs and motor neurons were generated normally in Smg5 knock-out mice. A, Representative images of a Smg5-CKO mouse (right) and control littermate at P21. B, Body weight time curves (n = 6). C, Transverse sections of spinal cord from E12.5 to P0 of control and Smg5-CKO mice are subjected to SOX10 immunofluorescence. D, Quantitative analysis was performed to determine the number of SOX10+ cells per section in the spinal cord at E12.5–P0. Error bars indicate SEM. ns, not significant. E, Normal distribution of Pdgfra+ OPCs in Smg5-CKO mice as revealed by ISH. The number of motor neurons is also normal in E12.5 mutants. F, G, Quantitative analysis of Pdgfra+ OPCs (F) and ISL1+ motoneurons (G) per section for panel E. Error bar indicates SEM. ns, not significant.

Gene expression analyses revealed that expression of OPC marker gene Pdgfra was not significantly altered in Smg5-CKO mice at all embryonic stages examined (Fig. 1C–F). SOX10 expression was normal in the spinal cord of Smg5-CKO at embryonic day (E) 16.5 and earlier stages, but significantly attenuated at P0, suggesting the aberrant differentiation of OPCs. Since Olig1-Cre is also expressed in neural stem cells that give rise to motor neurons in the spinal cord, we additionally examined the development of motor neurons and discovered the normal expression of motoneuron marker ISL1 in Smg5-CKO mice (Fig. 1E).

Smg5-CKO mice exhibit aberrant oligodendrocyte differentiation

To verify the important role of SMG5 in oligodendrocyte differentiation, we performed RNA ISH in spinal tissues using Mbp and Plp1 as the molecular markers for differentiated OLs. Consistent with our postulation, the levels of Mbp and Plp1 expression were substantially reduced in the spinal cord of postnatal Smg5-CKO mice (Fig. 2A,B). Similarly, expression of these two myelin genes in the corpus callosum was also attenuated in Smg5-CKO at P15 and in adulthood (Fig. 2C,D). Western blot analysis confirmed diminished MBP expression in P15 cortical tissue from Smg5-CKO mice (Fig. 2E). TrueGold Myelin Staining revealed a thinner corpus callosum in the Smg5-CKO mice (Fig. 2Fa,b) and a significantly decreased density of myelinated fiber tracts in P64 corpus callosum (Fig. 2Fc,d). Transmission electron microscopy revealed a reduced number of mature myelinated axons in Smg5-CKO mice at P64 (Fig. 2G–H). Additionally, the myelin sheaths became significantly thinner in Smg5-CKO mice, as indicated by a higher G-ratio (Fig. 2I). These results demonstrated that Smg5-CKO impaired oligodendrocyte differentiation and myelin formation.

Figure 2.

Figure 2.

Open in a new tab

Conditional knock-out of the Smg5 led to aberrant oligodendrocyte differentiation and compromised myelin formation. A, The number of Plp1-positive cells, representing differentiated OLs, is significantly reduced in the spinal cord of Smg5-CKO mice from P0 to P15. B–E, ISH revealed a reduced expression of the mature OL markers Plp1 in the corpus callosum of Smg5-CKO mice at P15. Quantification of the number of Plp1+ cells (n = 3) in spinal cord (B) and corpus callosum (D) from control and Smg5-CKO mice at indicated stages. E, Similar findings were observed in the Western blot analysis of MBP expression. Results are showed as mean ± SEM. F, Impaired oligodendrocyte differentiation and myelin formation in adult Smg5-CKO mice. ISH of Plp1 and TrueGold Myelin Staining within corpus callosum at P64. G, I, Transmission electron microscopy of P64 spinal cord showed thinner myelin sheaths (G) and a reduction in the proportion of mature myelinated axons (H) in Smg5-CKO mice. G-ratio analysis (I) showed a significant increase in Smg5-CKO mice; G-ratios were calculated from pooled data from three animals for both control and Smg5-CKO mice.

To further verify the role of SMG5 in OL differentiation and myelination, we generated the CnpCre/+;Smg5fx/fx conditional mutant mouse line to specifically ablate Smg5 in differentiating OPCs. Analysis of myelin gene expression confirmed a significant decrease of Plp1 expression in this mutant line at P0 and P7 (Supplementary Fig. S2), reinforcing the concept that SMG5 is crucial for the terminal differentiation and subsequent myelin formation of OLs.

To investigate if Smg5-CKO results in abnormal cell apoptosis of oligodendrocytes, TUNEL was used to measure the cell apoptosis of oligodendrocytes. The results showed a similar fraction of apoptotic SOX10+ cells in both control and Smg5-CKO mice (Supplementary Fig. S3), ruling out elevated cell death as a cause for the reduced number of mature oligodendrocytes.

Smg5-CKO displayed impaired motor function and delayed impulse conduction

Given the crucial role of axonal myelination in animal behavior and brain functioning, we next assessed the motor coordination and endurance of Smg5-CKO mice using the rotarod test. Smg5-CKO mice spent significantly less time on the rotating rod compared with controls, indicating their impaired motor skills and endurance (Fig. 3A; p < 0.001). The Hargreaves test, which measures heat pain reflex, revealed a significantly delayed paw withdrawal response in Smg5-CKO mice, suggesting a slower sensory conduction (Fig. 3B; p < 0.001). To evaluate the impact of Smg5 on neuromuscular functions, we conducted the grip strength test developed specifically for rodent studies (Meyer et al., 1979; Võikar et al., 2001; Han et al., 2020). This test is primarily utilized to assess the muscle strength of both forelimbs and hindlimbs, acting as an indicator of neuromuscular function. The grip strength of Smg5-CKO mice was significantly compromised for either the forelimbs (two paws) or the combination of fore- and hindlimbs (four paws; Fig. 3C,D).

Figure 3.

Figure 3.

Open in a new tab

Smg5-CKO caused aberrant motor function and pain sensitization and response. A, Rotarod test of control mice (n = 10) and Smg5-CKO mice (n = 10). B, Hargreaves testing of control mice (n = 8) and Smg5-CKO mice (n = 8). ****p < 0.0001. C, D, Grip strength test. Forelimb (2 paws) and fore-/hindlimb (4 paws) grip force measurements of control mice (n = 8) and Smg5-CKO mice (n = 8). Bars represent the mean (±SE) grip strength measurement (in grams of force) averaged across eight trials.

Smg5-mediated NMD regulates RNA processing and myelin gene expression

To explore the molecular mechanisms underlying the abnormal development of oligodendrocytes in the absence of Smg5, we performed RNA-seq analysis in the spinal tissues of P7 control and Smg5-CKO pups. It was found that 488 genes were significantly upregulated and 188 downregulated (Supplementary Fig. S4A). Approximately half of the top 40 genes with altered expression are related to OL differentiation and myelination (Supplementary Fig. S4B). In line with the findings from RNA ISH, the expression of OPC markers such as Pdgfra, Cspg4 (NG2), and Sox6 did not exhibit significant changes (Supplementary Fig. S4C). To improve the accuracy of sequencing at the transcript level, we utilized single-molecule real-time DNA sequencing technology, which enabled us to successfully identify 1,724 transcripts with apparent differential expression (Data S3). GO annotation analyses showed that 390 biological process terms, 95 cellular component terms, and 542 molecular function terms were significantly enriched (p < 0.05). Notably, mRNA processing and RNA splicing were among the highly enriched GO terms (Supplementary Fig. S4D, Data S4), indicating that Smg5 loss heavily affected cellular signal transduction of OLs. KEGG pathway analysis identified 86 significantly enriched pathways associated with the target transcripts. Among the most enriched categories, the signaling pathways involved in glutamatergic synaptic transmission (Spitzer et al., 2016), phosphatidyl inositols (Ishii et al., 2021), Rap1 and Ras (Gutmann et al., 1997; Alcover-Sanchez et al., 2020), phospholipase D (Kato et al., 2021), and thyroid hormone (Tokumoto et al., 2017; Dai et al., 2022) are known to influence oligodendrocyte differentiation and maturation (Supplementary Fig. S4E). These results provide additional evidences for the regulation of myelinogenesis by the Smg5-mediated NMD pathway.

Since RNA isoforms containing premature termination codon (PTC) are frequently associated with alternative splicing events, we analyzed the AS-NMD in P7 mutant spinal cord tissues (Data S5) and 230 significantly dysregulated transcripts (Data S6). By this approach, a considerable number of PTC-containing isoforms was discovered in the mutants, which was further verified by reverse transcription PCR. Among these aberrantly splicing transcripts, a significant increase of PTC-containing transcripts resulted from exon inclusion (e.g., Hnrnpl, Hnrnpll), exon skipping (Snrpa1), as well as other alternative splicing in Smg5-CKO mice (Fig. 4). The increase of PTC-containing Hnrnpl (referred to as PTC-Hnrnpl) and Hnrnpll transcripts was coupled with the decreased proportions of their normal transcripts (Fig. 4A,B). Although the upregulation of PTC-Hnrnpl transcript was demonstrated in NMD-deficit mouse models such as Smg5 and Smg6 knock-outs (Li et al., 2015; Chen et al., 2024; Tan et al., 2024; Zhu et al., 2025), downregulation of its normal transcript was not reported previously. Thus, the protein level of HNRNPL was verified by immunofluorescent staining. Our results showed that SOX10+/HNRNPL+ double-positive cells in the spinal cord of Smg5-CKO mice at P15 was significantly reduced compared with those in controls, suggesting downregulation of Hnrnpl expression in the oligodendrocyte lineage (Supplementary Fig. S5A–C). Western blot analysis further confirmed the decreased abundance of HNRNPL protein in the spinal cord tissues of P15 Smg5-CKO mice (Supplementary Fig. S5D–E).

Figure 4.

Figure 4.

Open in a new tab

Categories of alternative splicing results in PTC-containing transcripts enriched in Smg5-CKO mice. A, Exon inclusion. B, Intron retention. C, Exon skipping. D, Alternative last exons. E, Alternative 3′ splice site. F, Complex alternative splicing patterns. G, Reference control. The asterisk symbolizes the atypical transcripts that carry the premature termination codon (PTC) signal.

Notably, aberrant splicing of Mag and Nfasc mRNA was detected in Smg5-CKOs (Fig. 5). MAG protein exhibits two isoforms (large MAG and small MAG) in the CNS (Fig. 5A). The mRNA encoding the shorter isoform (S-MAG) contains a termination codon in exon 12, while the mRNA encoding the longer isoform (L-MAG) skips exon 12 and produces a protein with a longer C-terminal region. L-MAG is required for the proper myelin formation in the CNS (Li et al., 1994; Fujita et al., 1998; Pan et al., 2005). Alternative splicing of neurofascin results in several isoforms, and the oligodendrocyte isoform Nfasc155 is a critical component of paranodal domain, and selective ablation of myelinating glia-specific Nfasc155 in mice leads to a gradual loss of paranodal axoglial junctions and concomitant disorganization of axonal domains (Poliak and Peles, 2003; Sherman et al., 2005; Roche et al., 2014). RT-PCR analyses revealed the altered splicing patterns of these two myelin-related genes. Specifically, we observed a significantly reduced skipping over exon 12 for Mag and increased skipping over exons 22 and 23 for Nfasc, resulting in downregulated expression of L-MAG and Nfasc155, respectively (Fig. 5B,C,E). Together, these findings indicate that Smg5 deletion compromised NMD in OLs, leading to aberrant Hnrnpl, Mag, and Nfasc splicing.

Figure 5.

Figure 5.

Open in a new tab

Smg5-mediated NMD regulates alternative splicing of Mag and Nfasc mRNA. A, The alternative splicing patterns of MAG pre-mRNA. Large MAG is produced by skipping exon 12, whereas small MAG is produced by inclusion of exon 12 which contains an in-frame stop codon TGA. B, The expression levels of large MAG and small MAG isoforms in different genotypes of mice (control and Smg5-CKO) were detected by RT-PCR, with GAPDH as the internal reference gene. C, The results showed that the expression of Large MAG was decreased and the large MAG/small MAG ratio was altered in Smg5-CKO mice (p = 0.0165). D, The schematic diagram shows the partial genomic structure of Nfasc at exons 21–30 and the alternative splicing patterns that generate three protein splice isoforms. The exon positions of each alternatively spliced segment (exons 22–23, exons 26–27, and exons 28–29) are indicated by different boxes. E, Detection of alternative splicing isoforms at exons 26–29 (neuron-specific splices) by RT-PCR. The primer sets employed for the analysis were designed based on the adjacent constitutive exon sequences. Myelinating glia-specific neurofascin (Nfasc155) is produced by including exons 22 and 23, meanwhile Nfasc186 and Nfasc180 is also produced by alternative including four tandem exons, ex26–29.

Hnrnpl promotes oligodendrocyte differentiation and regulates the alternative splicing of Mag

Both HNRNPL and HNRNPLL may interact with QKI (Data S7; Rolland et al., 2014; Huttlin et al., 2017; Lang et al., 2021), an essential protein for oligodendrocyte differentiation and myelination (Li et al., 2000; Larocque et al., 2002; Wu et al., 2002). In keeping with this notion, overexpressing Hnrnpl (OE-Hnrnpl) in CG4 cells markedly increased the expression of MBP upon 3 d of T3 treatment in differentiation medium. Surprisingly, overexpression of Hnrnpll displayed no significant changes (Fig. 6A–C). Moreover, shRNA-mediated knockdown of Hnrnpl but not Hnrnpll resulted in a lower percentage of MBP + CopGFP+/CopGFP+ cells and the decreased levels of Mbp and Plp1 mRNAs (Fig. 6D–G). To investigate whether PTC-Hnrnpl transcript exerts a dominant-negative regulatory effect, we first overexpressed the PTC-Hnrnpl construct in CG4 cell line. Quantitative analysis following 5 d of T3 differentiation treatment revealed no significant changes in the expression levels of MBP and PLP1 (Supplementary Fig. S6). Based on these results, we infer that the truncated PTC-hnRNPL protein is functionally inactive due to the absence of RNA-binding domains [such as the RNA recognition motif (RRM) region], thereby failing to mediate the differentiation process of oligodendrocytes. Together, our findings indicate that Hnrnpl is both sufficient and necessary for promoting OL differentiation and myelin gene expression, raising the possibility that defective Hnrnpl splicing may directly account for impaired OL differentiation in Smg5-CKO mice.

Figure 6.

Figure 6.

Open in a new tab

HNRNPL promoted MBP expression in CG4 cells upon induced differentiation. A, Costaining with MBP and CopGFP for CG4 cells transfected with CopGFP, Hnrnpl, and Hnrnpll after 3 d of T3-induced differentiation. B, Quantification of MBP+ CopGFP+ cells; error bars indicate SEM. C, qRT-PCR analysis indicates mRNA expression of mbp and plp1 in hnrnpl- or hnrnpll-transfected CG4 cells compared with control CG4 cells. The mRNA levels of Mbp and Plp1 were normalized to that of the GAPDH and graphically displayed with SD (n = 3). D, Costaining with MBP and CopGFP for Hnrnpl shRNA-treated and Hnrnpll shRNA-treated CG4 cell after 5 d of T3 treatment. E, Quantification of MBP+ CopGFP+ cells; error bars indicate SEM. F, qRT-PCR analysis indicates mRNA expression of Hnrnpl, Mbp, and Plp1 in Hnrnpl shRNA-treated CG4 cells (G) qRT-PCR analysis indicates mRNA expression of Hnrnpll, Mbp, and Plp1 in Hnrnpll shRNA-treated CG4 cells.

Meanwhile, alternative splicing of Mag mRNA was also detected in CG4 cells. RT-PCR analyses verified that there was a significant increment in the inclusion of exon 12 of Mag in CG4 cells with shRNA-mediated knockdown of Hnrnpl (Fig. 7A–C). Notably, HNRNPL contains four RNA recognition motifs that bind to intronic CA-repeats or CA-rich elements and regulates the alternative splicing of introns dependent on their proximity to the 5′ splicing site (Hui et al., 2005; Zhang et al., 2013; Rossbach et al., 2014; Kishor et al., 2019). Given that exon 12 of Mag is flanked by short CA-repeats, we hypothesize that HNRNPL may directly regulate the alternative splicing of Mag. To test this possibility, we developed a dual-luciferase splicing reporter assay based on the expression vector psiCheck2 (Promega), which encodes both firefly and Renilla luciferase in the same vector. In the reporter, sequences containing Mag exons 11–13 and introns 11–12 are positioned upstream of the start codon of Renilla luciferase, but downstream of the transcription start site (Fig. 7D). Because Mag exon 12 contains a translation termination codon, inclusion of this exon precludes translation of Renilla luciferase. Our assay system showed that knocking down HNRNPL in 293T cells causes a decrease of Renilla luciferase activity while its overexpression causes an opposite effect (Fig. 7E). When CACA was deleted in the Mag intron, HNRNPL no longer regulated the splicing of Mag. Together, the results demonstrate that HNRNPL can bind to the intron of Mag and promote the expression of L-MAG (Fig. 7F). It is plausible that HNRNPL increases the L/S MAG isoform ratio by binding to the CA-repeat sequence of Mag.

Figure 7.

Figure 7.

Open in a new tab

Hnrnpl regulates the alternative splicing of Mag. A, The alternative splicing patterns of Mag pre-mRNA in CG4 cells. Large MAG is produced by skipping exon 12, whereas small MAG is produced by inclusion of exon 12 which contains an in-frame stop codon TGA. B, The expression levels of large MAG and small MAG isoforms in control and shRNA-mediated knockdown of Hnrnpl CG4 cells were measured by RT-PCR, with GAPDH as the internal reference gene. C, In Smg5-CKO mice, the expression of large MAG was decreased and the large MAG/small MAG ratio was altered (p = 0.0073). D, Design of the dual-luciferase splicing reporter gene system based on the psiCheck2 vector. The construct contains MAG exons 11–13 and their upstream and downstream sequences, with exon 12 containing the stop codon TGA. CA represents the HNRNPL binding site. E, F, In 293T cells, after overexpressing HNRNPL (OE-HnL) or knocking down HNRNPL (Sh-HnL), the luciferase activities of the reporter constructs containing the normal CACA sequence (Mag-Ren-Luc) and the mutant ΔCACA sequence (Mag-ΔCACA-Ren-Luc) were measured. In the presence of CACA sequence, overexpression of HNRNPL significantly increased the proportion of the large MAG isoform (p < 0.0001), and knockdown of HNRNPL significantly decreased this proportion (p < 0.0001). When the CACA sequence was deleted (ΔCACA), HNRNPL expression had no significant effect (NS).

Discussion

In this study, we have uncovered the significant role of Smg5 in the process of oligodendrocyte differentiation and its underlying molecular mechanism. Smg5 regulates the differentiation and maturation of oligodendrocytes through the nonsense-mediated mRNA decay (NMD) pathway. This regulatory effect is partially mediated by the alternative splicing of the RNA-binding protein Hnrnpl. In the CG4 oligodendrocyte cell line, overexpression of Hnrnpl promoted cell differentiation, while knockdown exhibited the opposite effect.

Recent interactome studies have shown that both HNRNPL and HNRNPLL have a direct interaction with QKI (Rolland et al., 2014; Huttlin et al., 2017; Lang et al., 2021), which is functionally essential for CNS (Li et al., 2000; Larocque et al., 2002; Wu et al., 2002) myelination by stabilizing Mbp and Mag mRNA through binding its 3′-UTR (Li et al., 2000; Larocque et al., 2002; Wu et al., 2002; Ryder and Williamson, 2004; Carmel et al., 2010). This observation prompted us to speculate that HNRNPL may cooperate with QKI to regulate oligodendrocyte differentiation and myelin gene expression. However, the direct interaction of HNRNPL and QKI was not detected in our Co-IP assay. Bimolecular fluorescence complementation (BiFC) analysis suggested that HNRNPL may form complex with all QKI isoforms (Supplementary Fig. S7). The fluorescent signal intensity is consistent with the fact that both QKI5 and HNRNPL are mainly localized within the nucleus, whereas QKI6 and QKI7 are predominantly localized in cytoplasm (Hardy et al., 1996; Mathew et al., 2023). The results suggested that HNRNPL may transiently interact with QKI, but the significance of this interaction remains to be determined.

Previous studies have shown that RNA-binding proteins regulate gene expression by affecting the transcription, the splicing, or the stability of the (pre)-mRNA transcripts. Through this regulatory mechanism, they influence cellular differentiations and/or functions, especially in the developing nervous system (Bockbrader and Feng, 2008; Prashad and Gopal, 2021; Zhang et al., 2021). Many RNA-binding proteins including HNRNPL and HNRNPLL bind to their own pre-mRNA and cause alternative splicing to introduce a PTC, providing a negative feedback loop for regulating their own expression through AS-NMD (Hung et al., 2008; Rossbach et al., 2009). Our results showed that Smg5 mutation decreased the level of normal transcripts encoding the full-length HNRNPL and HNRNPLL and at the same time increased the level of PTC-containing transcripts (Fig. 4). In line with our current findings, previous studies have shown a significant increase in Hnrnpl transcript with PTCs in Smg5-CKO or Smg6-KO mice (Li et al., 2015; Chen et al., 2024; Tan et al., 2024; Zhu et al., 2025), suggesting that Hnrnpl might be a key regulatory gene in the NMD process. HNRNPL is a member of the heterogeneous nuclear ribonucleoprotein family of RNA-binding proteins (Pinol-Roma et al., 1989; Zhang et al., 2021; Subramani et al., 2024). HNRNPL functions as an alternative splicing factor, mainly responsible for regulating exon inclusion and exclusion (Cole et al., 2015; Kishor et al., 2019; Subramani et al., 2024). Meanwhile, it can directly stabilize specific transcripts with long 3′-UTRs by protecting them from NMD (Kishor et al., 2019). Our results demonstrated that HNRNPL plays an important role in the regulation of the alternative splicing of Mag, which is essential for the production of L-MAG during CNS myelination. We hypothesize that Smg5 regulates additional targets beyond these molecules, potentially through its role in mRNA quality control (e.g., nonsense-mediated decay, NMD) or RNA-binding protein networks that coordinate myelination-related transcripts. Future studies will aim to identify the Smg5-dependent RNA substrates or interacting factors and generate the CnpCre/+; Hnrnplfx/fx conditional knock-out mice to further explore the underlying mechanisms.

Data Availability

The data that support the findings of this study are available from the corresponding authors upon reasonable request.

References

  1. Addington AM, et al. (2011) A novel frameshift mutation in UPF3B identified in brothers affected with childhood onset schizophrenia and autism spectrum disorders. Mol Psychiatry 16:238–239. 10.1038/mp.2010.59 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alcover-Sanchez B, Garcia-Martin G, Wandosell F, Cubelos B (2020) R-Ras GTPases signaling role in myelin neurodegenerative diseases. Int J Mol Sci 21:5911. 10.3390/ijms21165911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blanchard JW, et al. (2022) APOE4 impairs myelination via cholesterol dysregulation in oligodendrocytes. Nature 611:769–779. 10.1038/s41586-022-05439-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bockbrader K, Feng Y (2008) Essential function, sophisticated regulation and pathological impact of the selective RNA-binding protein QKI in CNS myelin development. Future Neurol 3:655–668. 10.2217/14796708.3.6.655 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bühler M, Steiner S, Mohn F, Paillusson A, Mühlemann O (2006) EJC-independent degradation of nonsense immunoglobulin-mu mRNA depends on 3′ UTR length. Nat Struct Mol Biol 13:462–464. 10.1038/nsmb1081 [DOI] [PubMed] [Google Scholar]
  6. Carmel AB, Wu J, Lehmann-Blount KA, Williamson JR (2010) High-affinity consensus binding of target RNAs by the STAR/GSG proteins GLD-1, STAR-2 and quaking. BMC Mol Biol 11:48. 10.1186/1471-2199-11-48 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chang YF, Imam JS, Wilkinson MF (2007) The nonsense-mediated decay RNA surveillance pathway. Annu Rev Biochem 76:51–74. 10.1146/annurev.biochem.76.050106.093909 [DOI] [PubMed] [Google Scholar]
  8. Chen C, Wei Y, Jiang X, Li T (2024) RNA surveillance factor SMG5 is essential for mouse embryonic stem cell differentiation. Biomolecules 14:1023. 10.3390/biom14081023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen T, et al. (2021) The genome sequence archive family: toward explosive data growth and diverse data types. Genomics Proteomics Bioinformatics 19:578–583. 10.1016/j.gpb.2021.08.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cole BS, Tapescu I, Allon SJ, Mallory MJ, Qiu J, Lake RJ, Fan HY, Fu XD, Lynch KW (2015) Global analysis of physical and functional RNA targets of hnRNP L reveals distinct sequence and epigenetic features of repressed and enhanced exons. RNA 21:2053–2066. 10.1261/rna.052969.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dai ZM, Guo W, Yu D, Zhu XJ, Sun S, Huang H, Jiang M, Xie B, Zhang Z, Qiu M (2022) SECISBP2L-mediated selenoprotein synthesis is essential for autonomous regulation of oligodendrocyte differentiation. J Neurosci 42:5860–5869. 10.1523/JNEUROSCI.2141-21.2022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. de Vries SEJ, et al. (2020) A large-scale standardized physiological survey reveals functional organization of the mouse visual cortex. Nat Neurosci 23:138–151. 10.1038/s41593-019-0550-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dunham NW, Miya TS (1957) A note on a simple apparatus for detecting neurological deficit in rats and mice. J Am Pharm Assoc Am Pharm Assoc 46:208–209. 10.1002/jps.3030460322 [DOI] [PubMed] [Google Scholar]
  14. Frischmeyer PA, Dietz HC (1999) Nonsense-mediated mRNA decay in health and disease. Hum Mol Genet 8:1893–1900. 10.1093/hmg/8.10.1893 [DOI] [PubMed] [Google Scholar]
  15. Fujita N, Kemper A, Dupree J, Nakayasu H, Bartsch U, Schachner M, Maeda N, Suzuki K, Popko B (1998) The cytoplasmic domain of the large myelin-associated glycoprotein isoform is needed for proper CNS but not peripheral nervous system myelination. J Neurosci 18:1970–1978. 10.1523/JNEUROSCI.18-06-01970.1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Garcia-Moreno JF, Romao L (2020) Perspective in alternative splicing coupled to nonsense-mediated mRNA decay. Int J Mol Sci 21:9424. 10.3390/ijms21249424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Guo W, Xie B, Jiang M, Zhu XJ, Qiu M, Dai ZM (2019) An improved overlap extension PCR for simultaneous multiple sites large fragments insertion, deletion and substitution. Sci Rep 9:15637. 10.1038/s41598-019-52122-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gutmann DH, Saporito-Irwin S, DeClue JE, Wienecke R, Guha A (1997) Alterations in the rap1 signaling pathway are common in human gliomas. Oncogene 15:1611–1616. 10.1038/sj.onc.1201314 [DOI] [PubMed] [Google Scholar]
  19. Han SR, Kang YH, Jeon H, Lee S, Park SJ, Song DY, Min SS, Yoo SM, Lee MS, Lee SH (2020) Differential expression of miRNAs and behavioral change in the cuprizone-induced demyelination mouse model. Int J Mol Sci 21:646. 10.3390/ijms21020646 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Han X, Wei Y, Wang H, Wang F, Ju Z, Li T (2018) Nonsense-mediated mRNA decay: a “nonsense” pathway makes sense in stem cell biology. Nucleic Acids Res 46:1038–1051. 10.1093/nar/gkx1272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hardy RJ, Loushin CL, Friedrich VL Jr, Chen Q, Ebersole TA, Lazzarini RA, Artzt K (1996) Neural cell type-specific expression of QKI proteins is altered in quakingviable mutant mice. J Neurosci 16:7941–7949. 10.1523/JNEUROSCI.16-24-07941.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hargreaves K, Dubner R, Brown F, Flores C, Joris J (1988) A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32:77–88. 10.1016/0304-3959(88)90026-7 [DOI] [PubMed] [Google Scholar]
  23. Hu X, et al. (2024) Pan-ErbB inhibition impairs cognition via disrupting myelination and aerobic glycolysis in oligodendrocytes. Proc Natl Acad Sci U S A 121:e2405152121. 10.1073/pnas.2405152121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hug N, Longman D, Cáceres JF (2016) Mechanism and regulation of the nonsense-mediated decay pathway. Nucleic Acids Res 44:1483–1495. 10.1093/nar/gkw010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hui J, Hung LH, Heiner M, Schreiner S, Neumüller N, Reither G, Haas SA, Bindereif A (2005) Intronic CA-repeat and CA-rich elements: a new class of regulators of mammalian alternative splicing. EMBO J 24:1988–1998. 10.1038/sj.emboj.7600677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hung LH, Heiner M, Hui J, Schreiner S, Benes V, Bindereif A (2008) Diverse roles of hnRNP L in mammalian mRNA processing: a combined microarray and RNAi analysis. RNA 14:284–296. 10.1261/rna.725208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Huttlin EL, et al. (2017) Architecture of the human interactome defines protein communities and disease networks. Nature 545:505–509. 10.1038/nature22366 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Inoue K, et al. (2004) Molecular mechanism for distinct neurological phenotypes conveyed by allelic truncating mutations. Nat Genet 36:361–369. 10.1038/ng1322 [DOI] [PubMed] [Google Scholar]
  29. Ishii A, Furusho M, Bansal R (2021) Mek/ERK1/2-MAPK and PI3K/Akt/mTOR signaling plays both independent and cooperative roles in Schwann cell differentiation, myelination and dysmyelination. Glia 69:2429–2446. 10.1002/glia.24049 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kashima I, Yamashita A, Izumi N, Kataoka N, Morishita R, Hoshino S, Ohno M, Dreyfuss G, Ohno S (2006) Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay. Genes Dev 20:355–367. 10.1101/gad.1389006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kato D, Wake H (2021) Myelin plasticity modulates neural circuitry required for learning and behavior. Neurosci Res 167:11–16. 10.1016/j.neures.2020.12.005 [DOI] [PubMed] [Google Scholar]
  32. Kato Y, et al. (2021) Phospholipase D and phosphatidylinositol-4-phosphate 5-kinase 1 are involved in the regulation of oligodendrocyte morphological differentiation. Exp Cell Res 405:112654. 10.1016/j.yexcr.2021.112654 [DOI] [PubMed] [Google Scholar]
  33. Kishor A, Ge Z, Hogg JR (2019) hnRNP L-dependent protection of normal mRNAs from NMD subverts quality control in B cell lymphoma. EMBO J 38:e99128. 10.15252/embj.201899128 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kuroha K, Tatematsu T, Inada T (2009) Upf1 stimulates degradation of the product derived from aberrant messenger RNA containing a specific nonsense mutation by the proteasome. EMBO Rep 10:1265–1271. 10.1038/embor.2009.200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lang B, Yang JS, Garriga-Canut M, Speroni S, Aschern M, Gili M, Hoffmann T, Tartaglia GG, Maurer SP (2021) Matrix-screening reveals a vast potential for direct protein-protein interactions among RNA binding proteins. Nucleic Acids Res 49:6702–6721. 10.1093/nar/gkab490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lappe-Siefke C, Goebbels S, Gravel M, Nicksch E, Lee J, Braun PE, Griffiths IR, Nave KA (2003) Disruption of Cnp1 uncouples oligodendroglial functions in axonal support and myelination. Nat Genet 33:366–374. 10.1038/ng1095 [DOI] [PubMed] [Google Scholar]
  37. Larocque D, Pilotte J, Chen T, Cloutier F, Massie B, Pedraza L, Couture R, Lasko P, Almazan G, Richard S (2002) Nuclear retention of MBP mRNAs in the quaking viable mice. Neuron 36:815–829. 10.1016/S0896-6273(02)01055-3 [DOI] [PubMed] [Google Scholar]
  38. Laumonnier F, et al. (2010) Mutations of the UPF3B gene, which encodes a protein widely expressed in neurons, are associated with nonspecific mental retardation with or without autism. Mol Psychiatry 15:767–776. 10.1038/mp.2009.14 [DOI] [PubMed] [Google Scholar]
  39. Li C, Tropak MB, Gerlai R, Clapoff S, Abramow-Newerly W, Trapp B, Peterson A, Roder J (1994) Myelination in the absence of myelin-associated glycoprotein. Nature 369:747–750. 10.1038/369747a0 [DOI] [PubMed] [Google Scholar]
  40. Li T, et al. (2015) Smg6/Est1 licenses embryonic stem cell differentiation via nonsense-mediated mRNA decay. EMBO J 34:1630–1647. 10.15252/embj.201489947 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Li Z, Zhang Y, Li D, Feng Y (2000) Destabilization and mislocalization of myelin basic protein mRNAs in quaking dysmyelination lacking the QKI RNA-binding proteins. J Neurosci 20:4944–4953. 10.1523/JNEUROSCI.20-13-04944.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lin L, et al. (2024) Epistatic interactions between NMD and TRP53 control progenitor cell maintenance and brain size. Neuron 112:2157–2176.e2112. 10.1016/j.neuron.2024.04.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH (2002) Common developmental requirement for Olig function indicates a motor neuron/oligodendrocyte connection. Cell 109:75–86. 10.1016/S0092-8674(02)00678-5 [DOI] [PubMed] [Google Scholar]
  44. Marques S, et al. (2016) Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system. Science 352:1326–1329. 10.1126/science.aaf6463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Martin G, Marquez Y, Mantica F, Duque P, Irimia M (2021) Alternative splicing landscapes in Arabidopsis thaliana across tissues and stress conditions highlight major functional differences with animals. Genome Biol 22:35. 10.1186/s13059-020-02258-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mathew V, et al. (2023) hnRNPL expression dynamics in the embryo and placenta. Gene Expr Patterns 48:119319. 10.1016/j.gep.2023.119319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Members C-N, Partners (2024) Database Resources of the National Genomics Data Center, China National Center for Bioinformation in 2024. Nucleic Acids Res 52:D18–D32. 10.1093/nar/gkad1078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Meyer OA, Tilson HA, Byrd WC, Riley MT (1979) A method for the routine assessment of fore- and hindlimb grip strength of rats and mice. Neurobehav Toxicol 1:233–236. [PubMed] [Google Scholar]
  49. Nguyen LS, Kim HG, Rosenfeld JA, Shen Y, Gusella JF, Lacassie Y, Layman LC, Shaffer LG, Gecz J (2013) Contribution of copy number variants involving nonsense-mediated mRNA decay pathway genes to neuro-developmental disorders. Hum Mol Genet 22:1816–1825. 10.1093/hmg/ddt035 [DOI] [PubMed] [Google Scholar]
  50. Pan B, Fromholt SE, Hess EJ, Crawford TO, Griffin JW, Sheikh KA, Schnaar RL (2005) Myelin-associated glycoprotein and complementary axonal ligands, gangliosides, mediate axon stability in the CNS and PNS: neuropathology and behavioral deficits in single- and double-null mice. Exp Neurol 195:208–217. 10.1016/j.expneurol.2005.04.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Pinol-Roma S, Swanson MS, Gall JG, Dreyfuss G (1989) A novel heterogeneous nuclear RNP protein with a unique distribution on nascent transcripts. J Cell Biol 109:2575–2587. 10.1083/jcb.109.6.2575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Poliak S, Peles E (2003) The local differentiation of myelinated axons at nodes of Ranvier. Nat Rev Neurosci 4:968–980. 10.1038/nrn1253 [DOI] [PubMed] [Google Scholar]
  53. Prashad S, Gopal PP (2021) RNA-binding proteins in neurological development and disease. RNA Biol 18:972–987. 10.1080/15476286.2020.1809186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Roche SL, et al. (2014) Loss of glial neurofascin155 delays developmental synapse elimination at the neuromuscular junction. J Neurosci 34:12904–12918. 10.1523/JNEUROSCI.1725-14.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Rolland T, et al. (2014) A proteome-scale map of the human interactome network. Cell 159:1212–1226. 10.1016/j.cell.2014.10.050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Rossbach O, Hung LH, Schreiner S, Grishina I, Heiner M, Hui J, Bindereif A (2009) Auto- and cross-regulation of the hnRNP L proteins by alternative splicing. Mol Cell Biol 29:1442–1451. 10.1128/MCB.01689-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Rossbach O, Hung LH, Khrameeva E, Schreiner S, König J, Curk T, Zupan B, Ule J, Gelfand MS, Bindereif A (2014) Crosslinking-immunoprecipitation (iCLIP) analysis reveals global regulatory roles of hnRNP L. RNA Biol 11:146–155. 10.4161/rna.27991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Ryder SP, Williamson JR (2004) Specificity of the STAR/GSG domain protein Qk1: implications for the regulation of myelination. RNA 10:1449–1458. 10.1261/rna.7780504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Schaeren-Wiemers N, Gerfin-Moser A (1993) A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry 100:431–440. 10.1007/BF00267823 [DOI] [PubMed] [Google Scholar]
  60. Sherman DL, et al. (2005) Neurofascins are required to establish axonal domains for saltatory conduction. Neuron 48:737–742. 10.1016/j.neuron.2005.10.019 [DOI] [PubMed] [Google Scholar]
  61. Spitzer S, Volbracht K, Lundgaard I, Káradóttir RT (2016) Glutamate signalling: a multifaceted modulator of oligodendrocyte lineage cells in health and disease. Neuropharmacology 110:574–585. 10.1016/j.neuropharm.2016.06.014 [DOI] [PubMed] [Google Scholar]
  62. Stadelmann C, Timmler S, Barrantes-Freer A, Simons M (2019) Myelin in the central nervous system: structure, function, and pathology. Physiol Rev 99:1381–1431. 10.1152/physrev.00031.2018 [DOI] [PubMed] [Google Scholar]
  63. Stolt CC, Rehberg S, Ader M, Lommes P, Riethmacher D, Schachner M, Bartsch U, Wegner M (2002) Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10. Genes Dev 16:165–170. 10.1101/gad.215802 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Subramani PG, Fraszczak J, Helness A, Estall JL, Moroy T, Di Noia JM (2024) Conserved role of hnRNPL in alternative splicing of epigenetic modifiers enables B cell activation. EMBO Rep 25:2662–2697. 10.1038/s44319-024-00152-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Tan X, Chen C, Gao X, Wang H, Zhang Y, Li T (2024) SMG5, a component of nonsense-mediated mRNA decay, is essential for the mouse spermatogonial differentiation and maintenance. FASEB J 38:e70268. 10.1096/fj.202402422R [DOI] [PubMed] [Google Scholar]
  66. Tarpey PS, et al. (2007) Mutations in UPF3B, a member of the nonsense-mediated mRNA decay complex, cause syndromic and nonsyndromic mental retardation. Nat Genet 39:1127–1133. 10.1038/ng2100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Tasic B, et al. (2016) Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat Neurosci 19:335–346. 10.1038/nn.4216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Tokumoto Y, Tamaki S, Kabe Y, Takubo K, Suematsu M (2017) Quiescence of adult oligodendrocyte precursor cells requires thyroid hormone and hypoxia to activate Runx1. Sci Rep 7:1019. 10.1038/s41598-017-01023-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Võikar V, Kõks S, Vasar E, Rauvala H (2001) Strain and gender differences in the behavior of mouse lines commonly used in transgenic studies. Physiol Behav 72:271–281. 10.1016/S0031-9384(00)00405-4 [DOI] [PubMed] [Google Scholar]
  70. Wang W, Czaplinski K, Rao Y, Peltz SW (2001) The role of Upf proteins in modulating the translation read-through of nonsense-containing transcripts. EMBO J 20:880–890. 10.1093/emboj/20.4.880 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wilusz CJ, Wang W, Peltz SW (2001) Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev 15:2781–2785. 10.1101/gad.943701 [DOI] [PubMed] [Google Scholar]
  72. Wu JI, Reed RB, Grabowski PJ, Artzt K (2002) Function of quaking in myelination: regulation of alternative splicing. Proc Natl Acad Sci U S A 99:4233–4238. 10.1073/pnas.072090399 [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Yao Z, et al. (2021) A taxonomy of transcriptomic cell types across the isocortex and hippocampal formation. Cell 184:3222–3241.e3226. 10.1016/j.cell.2021.04.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zhang M, et al. (2023) Molecularly defined and spatially resolved cell atlas of the whole mouse brain. Nature 624:343–354. 10.1038/s41586-023-06808-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Zhang Q, et al. (2021) Nuclear speckle specific hnRNP D-like prevents age- and AD-related cognitive decline by modulating RNA splicing. Mol Neurodegener 16:66. 10.1186/s13024-021-00485-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Zhang W, Zeng F, Liu Y, Zhao Y, Lv H, Niu L, Teng M, Li X (2013) Crystal structures and RNA-binding properties of the RNA recognition motifs of heterogeneous nuclear ribonucleoprotein L: insights into its roles in alternative splicing regulation. J Biol Chem 288:22636–22649. 10.1074/jbc.M113.463901 [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Zhu S, et al. (2025) Fine-tuning of Wnt signaling by RNA surveillance factor Smg5 in the mouse craniofacial development. iScience 28:111972. 10.1016/j.isci.2025.111972 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding authors upon reasonable request.

Articles from The Journal of Neuroscience are provided here courtesy of Society for Neuroscience

RESOURCES