Protocol to investigate the biochemical details of immune checkpoint ligand/receptor ubiquitination using in vitro ubiquitination assay

Summary

The activity and stability of immune checkpoint ligands/receptors, including PD-L1 and PD-1, are tightly regulated by ubiquitination. Here, we present a protocol for detecting ubiquitination of the cytoplasmic domain of PD-L1 by various E3 ligases and evaluating the effects of phosphorylation and membrane association on PD-L1 ubiquitination. We describe steps for expressing and purifying recombinant cytoplasmic domain of PD-L1 and related ubiquitination enzymes, preparing liposomes from DC2.4 cells, and detecting PD-L1 ubiquitination using in vitro ubiquitination assays.

For complete details on the use and execution of this protocol, please refer to Xie et al.¹

Graphical abstract

Highlights

• •Instructions for purifying the cytoplasmic domain of immune checkpoints
• •Purification of CUL3/RBX1 complex from insect cells for in vitro neddylation assay
• •Steps for the isolation of liposomes from DC2.4 cells
• •Procedures to detect PD-L1 polyubiquitination by different E3 ligases in vitro

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

The activity and stability of immune checkpoint ligands/receptors, including PD-L1 and PD-1, are tightly regulated by ubiquitination. Here, we present a protocol for detecting ubiquitination of the cytoplasmic domain of PD-L1 by various E3 ligases and evaluating the effects of phosphorylation and membrane association on PD-L1 ubiquitination. We describe steps for expressing and purifying recombinant cytoplasmic domain of PD-L1 and related ubiquitination enzymes, preparing liposomes from DC2.4 cells, and detecting PD-L1 ubiquitination using in vitro ubiquitination assays.

Before you begin

Immune checkpoint blockade has emerged as a promising therapeutic strategy for cancer, with drugs targeting PD-L1/PD-1 demonstrating significant clinical efficacy.^2,3,4 Ubiquitination, a critical mechanism regulating the stability and activity of immune checkpoint ligands and receptors, has consequently garnered substantial research interest. However, despite numerous publications identifying various E3 ligases that ubiquitinate PD-L1 or PD-1,^{5,6,7,8,9,10,11} rigorous validation of their ligase activity through in vitro ubiquitination assays using purified recombinant proteins remains scarce. This gap likely stems from the challenges associated with purifying full-length PD-L1 and PD-1 as transmembrane proteins, coupled with an underappreciation of the importance of reconstituted biochemical assays for elucidating the molecular details of catalytic mechanisms.

Considering that ubiquitination primarily modifies the cytoplasmic domains of mature PD-L1 localized at the plasma membrane (Figure 1A), we reasoned that these cytosolic regions could serve as ideal substrates for in vitro reconstitution of the enzymatic reaction. Indeed, generating purified cytoplasmic domains of PD-L1, PD-1 and potentially other immune checkpoint molecules is considerably more feasible (Figure 1B). In addition to PD-L1 in our published manuscript¹ we have also successfully generated cytoplasmic domain of PD-1 from bacteria.

Figure 1.

Pathway of PD-L1 degradation and structure of immune checkpoint members

(A) Schematic presentation of PD-L1 degradation regulated by ubiquitination. Newly synthesized PD-L1 is tightly regulated by ER-associated degradation (ERAD) pathway mediated by HUWE1 or HRD1 catalyzed ubiquitination, while the mature form of PD-L1 located at cytoplasmic membrane is ubiquitinated at its C-terminal domain by E3s involving ARIH1, CRL and the NEDD4 family. The ubiquitinated PD-L1 gets degraded by lysosome or proteasome.

(B) Schemata of structural architectures of different immune checkpoint ligands/receptors.

Here, we describe methods for detecting ubiquitination of the PD-L1 cytoplasmic domain using in vitro ubiquitination assays. These assays provide direct evidence of E3 ligase activity toward PD-L1 and elucidate the molecular mechanisms by which other modifications, such as phosphorylation, regulate PD-L1 ubiquitination. This protocol, validated using the PD-L1 cytoplasmic domain, offers a robust approach for assessing ubiquitination of other immune checkpoint ligands and receptors.

Innovation

A key advancement of this protocol is the use of purified recombinant cytoplasmic domains rather than full-length transmembrane proteins, which are notoriously difficult to express and purify. The method includes detailed procedures for generating and purifying these domains, as well as essential ubiquitination machinery components (E1, E2, E3 enzymes). Additionally, the protocol introduces a novel approach to evaluate the effects of phosphorylation and membrane association on ubiquitination by incorporating synthetic phosphorylated peptides and cell-derived liposomes into the assay. This allows for more physiologically relevant reconstitution of membrane-proximal ubiquitination events. The workflow is standardized for high-throughput applicability across multiple E3 ligases, including CRL complexes, ARIH1, and NEDD4 family members, providing a robust and reproducible system to validate E3 activities and elucidate regulatory mechanisms that are often overlooked in conventional cellular assays.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
HRP-conjugated mouse anti HA-tag mAb	ABclonal	Cat#AE025; RRID: AB_2769866
CUL3 antibody	Cell Signaling Technology	Cat#2759; RRID: AB_2086432
Bacterial and virus strains
E. coli strain BL21(DE3)	Sangon Biotech	Cat#B528419
E. coli strain DH5α(DE3)	Sangon Biotech	Cat#B528413
E. coli strain DH10Bac	Sangon Biotech	Cat#A339030
Chemicals, peptides, and recombinant proteins
Ampicillin sodium	Sangon Biotech	Cat#A610028
Kanamycin sulfate	Sangon Biotech	Cat#A506636
Gentamycin sulfate	Sangon Biotech	Cat#A506614
Tetracycline hydrochloride	Sangon Biotech	Cat#A600504
Isopropyl b-D-1-thiogalactopyranoside (IPTG)	Sangon Biotech	Cat#A100487
Phenylmethyl sulfonyl fluoride (PMSF)	Sangon Biotech	Cat#A610425
Agar	Sangon Biotech	Cat#A505255
Agarose	Sangon Biotech	Cat#A620014
Imidazole	Sangon Biotech	Cat#A500529
Glutathione reduced	Sangon Biotech	Cat#A600229
Sodium chloride (NaCl)	Sangon Biotech	Cat#A610476
Sodium hydroxide (NaOH)	Sangon Biotech	Cat#A100583
Dithiothreitol (DTT)	Sangon Biotech	Cat#A620058
Glycerol	Sangon Biotech	Cat#A600232
Coomassie brilliant blue R-250	Sangon Biotech	Cat#A10037
Triton X-100	Sangon Biotech	Cat#A110694
RealBand pre-stained protein marker	Sangon Biotech	Cat#C610210
PBS buffer	Sangon Biotech	Cat#E607008
X-Gal solution	Sangon Biotech	Cat#B541006
Protease inhibitor cocktail (EDTA-free)	MedChemExpress	Cat#HY-K0011
Magnesium chloride anhydrous (MgCl2)	Adamas-beta	Cat#829999A
TM buffer	Beyotime	Cat#ST455
LipoInsect	Beyotime	Cat#C0551
Bovine serum albumin (BSA)	Solarbio	Cat#PC0001
Tris	Solarbio	Cat#T8060
Glycine	Solarbio	Cat#G8200
Sodium dodecyl sulfate (SDS)	Solarbio	Cat#S8010
Ni-NTA resin	Smart-Lifesciences	Cat#SA004025
Glutathione resin	Smart-Lifesciences	Cat#SA001025
2-mercaptoethanol	Thermo Scientific	Cat#A0417096
Tryptone	Thermo Scientific	Cat#LP0042B
Yeast extract	Thermo Scientific	Cat#LP0021B
BamhI	NEB	Cat#R3136V
NotI	NEB	Cat#R3189V
2× PrimeSTAR Max DNA polymerase	Takara	Cat#R045A
5× SDS-PAGE protein loading buffer	Yeasen	Cat#20315ES05
Biotin-CD270-290	Gil Biochemistry	N/A
Phosphorylated biotin-CD270-290	Gil Biochemistry	N/A
Experimental models: Cell lines
Sf9 insect cells	Thermo Scientific	Cat#11496015
DC2.4 cell	Sigma-Aldrich	Cat#SCC142M
Oligonucleotides
pGEX4T-1-HA-PD-L1 CD amplification sense primer 5′ AACCTGTATTTTCA GGGATCCATGTACCCCTACGACGTCCC 3′	Xie et al.1	N/A
pGEX4T-1-TEV-HA-PD-L1 CD amplification anti-sense primer 5′ TCAGTCAGTCACG ATGCGGCCGCTTACGTCTCCTCCAA ATGTGTATCACT 3′	Xie et al.1	N/A
pET28A-his-ARIH1(S427D) amplification sense primer 5′ CACATGCAGGACC TGCGCTTTGAGCACAAAC 3′	Xie et al.1	N/A
pET28A-his-ARIH1(S427D) amplification anti-sense primer 5′ AAGCGCAGGTCCT GCATGTGGTTCATATAGCGATTAC 3′	Xie et al.1	N/A
pGEX6P-2-GST-WWP2(Y369E) amplification sense primer 5′ TGTGCGTAATGAAGAA CAGTGGCAGAGTCAG 3′	Xie et al.1	N/A
pGEX6P-2-GST-WWP2(Y369E) amplification anti-sense primer 5′ TGCCACTGTTCTTCATT ACGCACATATTCTGCG3′	Xie et al.1	N/A
Recombinant DNA
pLEXM-PD-L1	Wei Jiang Lab, Fudan University, China	N/A
pGEX4T-1-GST-TEV-HA-PD-L1260-290	Xie et al.1	N/A
pGEX4T-1-GST-TEV-Ub	Xie et al.1	N/A
pGEX4T-1-GST-TEV-UBA3	Xie et al.1	N/A
pGEX4T-1-GST-TEV-UBC12	Xie et al.1	N/A
pGEX4T-1-GST-TEV-UbCH5B	Xie et al.1	N/A
pGEX4T-1-GST-TEV-UbcH7	Xie et al.1	N/A
pGEX4T-1-GST-TEV-NEDD8	Xie et al.1	N/A
pGEX6P-2-GST-Thrombin-WWP2(Y369E)	Xie et al.1	N/A
PBIG1A-GST-Thrombin-RBX1-CUL3	Weissmann et al.12	N/A
pET28A-his-Thrombin-UBA1	Xie et al.1	N/A
pET28A-his-Thrombin-SPOP	Xie et al.1	N/A
pET28A-his-Thrombin-UBA1	Xie et al.1	N/A
pET28A-his-Thrombin-ARIH1(S427D)	Xie et al.1	N/A
Software and algorithms
ImageJ	National Institutes of Health	https://imagej.net/ij/
Other
Superdex 200 10/300 GL	Cytiva	Cat#29148723
Gravity flow column	Cytiva	Cat#17043501
Spectrophotometer	Thermo Scientific	NanoDrop Onec
0.22 μm syringe filter	Sangon Biotech	Cat#F513163
Petri dish (60 × 15 mm)	Sangon Biotech	Cat#F611002
SIM SF expression medium	Sino Biological	Cat#MSF1
ClonExpress II one step cloning kit	Vazyme	Cat#C112
Incubator shaker	Shanghai Zhichen Instrument	Cat#ZWY-211B
Rotary shaker	Zhejiang Lichen Technology	Cat#OM12112404
Low-temperature centrifuge	Beckman Coulter	Cat#Allegra X-15R
Ultrahigh pressure nanometer homogenizer	Shanghai Litu Ultra High Pressure Equipment	Cat#FB-110X15
Thermostatic metal bath	JOANLAB Equipment	Cat#MDB100-C
PAGE gel quick preparation kit (12.5%)	Yeasen	Cat#20326ES62
HiPure gel pure micro kit	Magen Biotechnology	Cat#D2110-02
SuperPlasmid mini kit	Jiangsu CoWin Biotech	Cat#CW2109
Baculovirus shuttle vector bacmid mini preparation kit	YaJi Biological	Cat#D0031
10 kDa Amicon ultra centrifugal filter	Millipore	Cat#UFC9010
3 kDa Amicon ultra centrifugal filter	Millipore	Cat#UFC9003
Avanti Mini-Extruder	ANHEJIE	Cat#ANHEJIE-1

Materials and equipment

LB media (pH=7.0)

Reagent	Final concentration	Amount
Yeast extract	0.5% (w/v)	5 g
Tryptone	1% (w/v)	10 g
NaCl	1% (w/v)	10 g
ddH2O	N/A	up to 1 L
Total	N/A	1 L

Note: Autoclave and store at 4°C for up to 1 month.

LB agar plates

Reagent	Final concentration	Amount
Yeast extract	0.5% (w/v)	1 g
Tryptone	1% (w/v)	2 g
NaCl	1% (w/v)	2 g
Agar	1.5% (w/v)	3 g
ddH2O	N/A	up to 200 mL
Total	N/A	200 mL

Note: Following autoclaving, cool the solution to approximately 55°C, then add either ampicillin (100 μg/mL) or kanamycin (50 μg/mL) under sterile conditions and mix thoroughly. Dispense the medium into sterile petri dishes (5–6 mL per dish) within a laminar flow hood and store at 4°C for up to one month.

CRITICAL: When handling ampicillin/kanamycin, wear appropriate personal protective equipment (lab coat, gloves, and safety glasses) and avoid inhalation, ingestion, or skin contact.

IPTG stock solution

Reagent	Final concentration	Amount
IPTG	1 M	11.91 g
ddH2O	N/A	up to 50 mL
Total	N/A	50 mL

Note: Sterilize IPTG solution with a 0.22 mm syringe filter, then aliquot and store it at −20°C for up to 1 year.

DH10Bac agar plates

Reagent	Final concentration	Amount
Yeast extract	0.5% (w/v)	0.5 g
Tryptone	1% (w/v)	1 g
NaCl	1% (w/v)	1 g
Agar	1.5% (w/v)	1.5 g
ddH2O	N/A	up to 100 mL
Total	N/A	100 mL

Note: Following autoclaving, cool the solution to approximately 55°C. Add kanamycin to a final concentration of 50 μg/mL, gentamycin to 7 μg/mL, tetracycline to 10 μg/mL, X-gal to 100 μg/mL, and IPTG to 10 μg/mL, mixing thoroughly after each addition. Dispense 5–6 mL of the mixture into each petri dish. Wrap the prepared plates in aluminum foil to protect them from light, and store at 4°C for up to 2 weeks.

CRITICAL: When handling antibiotics, wear appropriate personal protective equipment (lab coat, gloves, and safety glasses) and avoid inhalation, ingestion, or skin contact.

Buffer I

Reagent	Final concentration	Amount
Tris-HCl (1 M, pH=8.0)	20 mM	20 mL
NaCl (5 M)	200 mM	40 mL
ddH2O	N/A	940 mL
Total	N/A	1 L

Note: Underwent autoclaving and stored at 4°C. Add the PMSF (1 mM), DDT (1 mM), and protease inhibitor cocktail (EDTA-Free) immediately before lysing E. coli cells.

CRITICAL: Always handle PMSF/DTT in a chemical fume hood while wearing suitable personal protective equipment, including gloves. Avoid contact and inhalation when handling PMSF/DTT. Do not get in eyes, on skin, or on clothing.

Wash buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M, pH=8.0)	20 mM	20 mL
NaCl (5 M)	200 mM	40 mL
Triton X-100	0.1% (w/v)	1 mL
ddH2O	N/A	939 mL
Total	N/A	1 L

Note: Add 1 mL Triton X-100 after autoclaving and store at 4°C.

CRITICAL: Triton X-100 is hazardous upon contact or inhalation. Avoid direct exposure, and prevent any contact with eyes, skin, or clothing. All handling should be conducted in chemical fume hood while wearing suitable personal protective equipment, including gloves.

GST elution buffer

Reagent	Final concentration	Amount
Glutathione reduced	25 mM	0.77 mg
Buffer I (pH=8.0)	N/A	up to 100 mL
Total	N/A	100 mL

Note: Adjust the pH to 8.0 using NaOH.

Imidazole stock solution

Reagent	Final concentration	Amount
Imidazole	1 M	6.81 g
Buffer I (pH=8.0)	N/A	up to 100 mL
Total	N/A	100 mL

Note: Due to the gradual decomposition and color change of imidazole in neutral pH aqueous solutions, the stock solution should be wrapped in aluminum foil and stored at 4°C for no longer than 3 months, and its color should be monitored during use.

SEC buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M, pH=8.0)	20 mM	10 mL
NaCl (5 M)	200 mM	20 mL
2-Mercaptoethanol	0.05% (w/v)	250 μL
ddH2O	N/A	469.75 mL
Total	N/A	500 mL

Note: Add 2-Mercaptoethanol to the buffer before use; the fresh buffer can be stored at 4°C for 2 days.

CRITICAL: 2-Mercaptoethanol is hazardous and can cause serious harm if swallowed, inhaled, or absorbed through the skin. Keep it away from heat sources, open flames, and oxidizing agents. Store at 4°C in a light-protected container. Always handle 2-Mercaptoethanol in a chemical fume hood while wearing suitable personal protective equipment, including gloves.

Coomassie blue staining buffer

Reagent	Final concentration	Amount
Coomassie brilliant blue R-250	0.25% (w/v)	2.5 g
Methanol	45% (w/v)	450 mL
Acetic acid	10% (w/v)	100 mL
ddH2O	N/A	450 mL
Total	N/A	1 L

Decolorization buffer

Reagent	Final concentration	Amount
Ethanol	5% (w/v)	50 mL
Acetic acid	10% (w/v)	100 mL
ddH2O	N/A	850 mL
Total	N/A	1 L

10×Ubiquitination buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M, pH=7.5)	500 mM	500 μL
NaCl (5 M)	50 mM	10 μL
MgCl2 (1 M)	50 mM	50 μL
ddH2O	N/A	440 μL
Total	N/A	1 mL

10×NEDDylation buffer

Reagent	Final concentration	Amount
Tris-HCl (1 M, pH=7.5)	500 mM	5 mL
MgCl2 (5 M)	100 mM	200 μL
ddH2O	N/A	4800 μL
Total	N/A	10 mL

PCR reaction

Reagent	Final concentration	Amount
Forward primer (10 μM)	0.5 μM	1.25 μL
Reverse primer (10 μM)	0.5 μM	1.25 μL
Template DNA	50∼100 ng	X μL
2×PrimeSTAR Max DNA Polymerase	1×	12.5 μL
ddH2O	N/A	up to 25 μL
Total	N/A	25 μL

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial denaturation	98°C	3 min	1
Denaturation	98°C	10 sec	25–35 cycles
Annealing	55°C	10 sec	N/A
Extension	72°C	10 sec	N/A
Final extension	72°C	5 min	1
Hold	4°C	forever	N/A

Double restriction enzyme digestion system of the vector

Reagent	Final concentration	Amount
Vector	2 μg	1∼20 μL
BamHI	N/A	1 μL
NotI	N/A	1 μL
10×rCutSmart buffer	1×	5 μL
ddH2O	N/A	up to 50 μL
Total	N/A	50 μL

Ligation reaction of DNA

Reagent	Final concentration	Amount
5 × CE II Buffer	1×	2 μL
Exnase II	N/A	1 μL
Insert (PCR products) (0.06 pmol)	80 ng	1 μL
Vector (0.03 pmol)	10 ng	0.5 μL
ddH2O	N/A	5.5 μL
Total	N/A	10 μL

Step-by-step method details

Construction of PD-L1 cytoplasmic domain plasmid

Timing: 4 days

• 1.
  PCR amplification of PD-L1 cytoplasmic domain.

  • a.
    Design primers to amplify the PD-L1 cDNA fragment encoding amino acids 260–290, introducing a BamHI site at the 5′ end and a NotI site at the 3′ end.
  • b.
    Use the full-length PD-L1 coding sequence as the PCR template.
  • c.
    Generate the PD-L1 CD_260–290 construct by PCR.

Note: The construct also incorporates a 5′–3′ nucleotide sequence encoding a TEV protease cleavage site to cleave the GST tag and an HA-tag for Western blot detection.

• 2.Linearize the pGEX4T-1 Vector via double Digestion with BamHI and NotI Enzymes.
• 3.Run a 1% agarose gel electrophoresis to confirm the size of the vector and the PCR products (Figures 3A and 3B).
• 4.Cut out the band corresponding to the vector and the target PCR product, and purify them using the HiPure Gel Pure Micro Kit (Magen, Cat#D2110-02).

Note: The expected size of the PCR product is 123 bp.

• 5.Quantify the purified products using a Nanodrop spectrophotometer.
• 6.Mix the PD-L1 CD insert with the pGEX4T-1 vector following the ligation reaction of DNA, and incubate at 37°C for 30 min.

Note: We calculated the amounts of vector and PCR product according to the instructions of the Vazyme One Step Cloning Kit (https://bio.vazyme.com/viewfilebizce/1767349639734972416/C112%E8%AF%B4%E6%98%8E%E4%B9%A6-V22.1.pdf) and ligation reactions were prepared using vector DNA concentrations and insert DNA concentrations within defined ranges; typically, the vector was used at 10∼50 ng/μL and the insert at 30∼150 ng/μL (corresponding to an insert-to-vector molar ratio of approximately 2:1), with total reaction volumes of 10 μL.

• 7.
  Transform the ligation product pGEX4T-1-HA-PD-L1 CD into DH5α competent cells.

  • a.
    Take a tube of DH5α competent cells (50 μL/tube) and thaw it on ice.
  • b.
    Add all of the ligation product to DH5α competent cells and incubate on ice for 30 min.
  • c.
    Heat shock the mixture at 42°C for 45 s, followed by placing it on ice for 2 min.
  • d.
    Add 200 μL Luria-Bertani medium (LB) to the mixture, shaking at 220 rpm at 37°C for 1 h.
  • e.
    Transfer the mixture onto an LB agar plate supplemented with 100 μg/mL ampicillin for selection and incubate 12∼16 h at 37°C.
  • f.
    Pick three single colonies from the LB agar plate using a sterile pipette tip.
  • g.
    Inoculate it into 5 mL LB containing ampicillin and incubate at 37°C in a shaker at 220 rpm for 12∼16 h.
  • h.
    Extract plasmid DNA using the SuperPlasmid Mini Kit (Cowin, Cat# CW2109) according to the manufacturer’s protocol https://www.cwbio.com/uploads/pdf/202412/0bec87ee702a2deddcc86f9b9ed98b6e.pdf.
  • i.
    Send a small aliquot of the plasmid for DNA sequencing to confirm the pGEX4T-1-HA-PD-L1 CD sequence.

Figure 3.

Purification of HA-PD-L1 CD

(A) Agarose gel electrophoresis of the PCR-amplified HA-PD-L1 cytoplasmic domain (HA-PD-L1 CD). showing a single band at ∼123 bp.

(B) Agarose gel electrophoresis of the pGEX-4T-1 vector after restriction enzyme digestion, showing a single band at ∼5,000 bp.

(C) The samples of pallet, lysate, flow through (FT), elution and elution after TEV protease digestion were analyzed by SDS-PAGE and visualized by Coomassie staining.

(D) SEC elution profiles of PD-L1 CD.

(E) The size-exclusion chromatography fractions 20–25 of PD-L1 CD, corresponding to the 17–19 mL elution volume, were analyzed by SDS-PAGE and visualized by Coomassie staining. A band at ∼10 kDa represents the HA-PD-L1 protein.

(F) Different titrations of PD-L1 CD recombinant protein were detected by Western Blot using an HA antibody.

Purification of recombinant PD-L1 cytoplasmic domain

Timing: 5 days

• 8.Transform the pGEX4T-1-HA-PD-L1 CD plasmid into BL21 (DE3) competent cells.
• 9.Pick a single colony and inoculate it into 10 mL of LB medium containing 100 μg/mL ampicillin, then incubate at 37°C and shake at 220 rpm for 16∼18 h.
• 10.Dilute the 10 mL LB culture 1:100 in 1 L of LB medium supplemented with 100 μg/mL ampicillin, and culture it at 37°C with shaking at 220 rpm until the OD600 value reaches 0.6∼0.8.
• 11.Move the flasks to 4°C and cool them.
• 12.Cool the shaker to 18°C, then add 500 μL of 1 M IPTG (final concentration: 0.5 mM) to the flask and induce protein expression with shaking at 220 rpm for 16∼18 h.
• 13.Centrifuge the bacterial culture at 5,000 rpm and 4°C for 10 min to pellet the bacteria, then discard the supernatant and retain the bacterial pellet.
• 14.Resuspend the bacterial pellet in 20 mL buffer I supplemented with 1 mM PMSF, 1 mM DTT, and 1 tablet of protease inhibitor cocktail (EDTA-Free) by pipetting up and down with a pipette until completely resuspended.

Note: Resuspend the cell pellet in Buffer I at a ratio of 20 mL per liter of culture.

CRITICAL: Always handle PMSF/DTT in a chemical fume hood while wearing suitable personal protective equipment, including gloves. Avoid contact and inhalation when handling PMSF/DTT. Do not get in eyes, on skin, or on clothing.

• 15.
  Lyse cells using a high-pressure homogenizer.

  • a.
    Pre-chill the high-pressure homogenizer (Shanghai Litu Ultra High Pressure Equipment, Cat# FB-110X15) to 4°C.
  • b.
    Add the resuspended bacteria and increase the pressure to 600 bar to lyse the bacterial cells until the bacterial suspension becomes clear.

Note: Representative images of the lysis steps are shown in Figure 2.

• 16.Centrifuge the lysate at 20,000 rpm for 20 min at 4°C to pellet bacterial debris and collect the supernatant. Aliquot 10 μL of pellet and supernatant and mix with 2 μL 5×SDS-PAGE protein loading buffer for SDS-PAGE analysis.
• 17.Mix the supernatant with 3 mL glutathione resin slurry in a 50 mL falcon tube, and incubate with rotation on a rotary shaker (Lichen, Cat# OM12112404) at 4°C for 2 h to allow protein binding.

Note: The glutathione resin is equilibrated with 5∼10 column volumes of buffer I before binding.

• 18.Let the mixture flow through a gravity flow column (Cytiva, Cat# 17043501) at 4°C, and collect the flow through fraction. Aliquot 10 μL of flow through fraction and mix with 2 μL 5×SDS-PAGE protein loading buffer for SDS-PAGE analysis.

Note: GST-HA-PD-L1 CD remains immobilized on the glutathione resin.

• 19.Wash the glutathione resin with 10∼20 column volumes of wash buffer.
• 20.Wash the glutathione resin with 10 column volumes of buffer I.
• 21.Elute the bound protein with 10 mL GST elution buffer, and collect the elution. Aliquot 10 μL of elution and mix with 2μL 5×SDS-PAGE protein loading buffer for SDS-PAGE analysis.
• 22.Add ∼100 μL of TEV protease (20 mg/mL) to the elution fraction, gently invert to mix, and incubate at 4°C for 16∼18 h to cleave the GST tag. Aliquot 10 μL of elution fraction after TEV protease digestion and mix with 2μL 5×SDS-PAGE protein loading buffer for SDS-PAGE analysis.
• 23.Heat the collected protein samples (pallet, lysate, flow through, elution and elution after TEV protease digestion) at 100°C for 5 min using a thermostatic metal bath (JOANLAB, Cat#MDB100-C).
• 24.Analyze the samples by SDS-PAGE followed by Coomassie staining to evaluate purification process and verify complete GST-tag cleavage (Figure 3C).
• 25.
  Purify HA-PD-L1 CD with Size Exclusion Chromatography (SEC).

  • a.
    Equilibrate a Superdex 200 Increase 10/300 GL column with 35 mL of SEC buffer at a flow rate of 0.3 mL/min.
  • b.
    Collect the HA-PD-L1 CD after TEV protease digestion and concentrate the sample to ≤500 μL using an Amicon concentrator (MWCO = 3 kDa) by centrifugation at 4,500 rpm, 4°C for approximately 2 h.
  • c.
    Inject the prepared HA-PD-L1 CD sample via the sample loop into a Superdex 200 Increase 10/300 GL column.

    Note: Before SEC injection, centrifuge the concentrated HA-PD-L1 CD sample at 15,000 × g for 10 min at 4°C to remove potential precipitates.

  • d.
    Collect the fractions of UV-absorbance curve peaks and analyze by SDS-PAGE to verify purity and molecular weight (Figures 3D and 3E).
• 26.Pool the fractions containing pure HA-PD-L1 CD and concentrate to 20 mg/mL using an Amicon concentrator (MWCO = 3 kDa) by centrifugation at 4,500 rpm, 4°C for approximately 2 h.
• 27.Add glycerol to 5% (v/v), aliquot, and store at −80°C.
• 28.Verify HA-PD-L1 CD by Western blotting with an anti-HA antibody (Figure 3F).

Optional: An HA tag is used to detect substrate ubiquitination; alternatively, FLAG or Myc tags can also be used.

Figure 2.

Workflow of cell lysis using a high-pressure homogenizer

The device is equipped with a pre-cooling unit, sample inlet cup, sample outlet tube, and pressure control valve. Before operation, the homogenizer is pre-cooled to 6–8°C using the pre-cooling unit. The sample is then loaded into the homogenizer via the inlet cup, and the pressure control valve is adjusted to 600 bar (within a range of 400–700 bar). Cell lysis is achieved through pressurization during high-pressure homogenization.

Expression and purification of recombinant CUL3/RBX1

Timing: 3 weeks

• 29.Transform 50 ng pFastBac-CUL3/RBX1¹² plasmid into 50 μL of DH10Bac competent cells. Streak out the cells onto DH10Bac LB agar plate.
• 30.Incubate the plate at 37°C and for 2∼3 days until distinct blue and white colonies are clearly visible.
• 31.Inoculate a single white colony into 3 mL of LB media supplemented with 50 μg/mL kanamycin, 7 μg/mL gentamicin, and 10 μg/mL tetracycline. Incubate in a shaker at 37°C, 220 rpm for 12∼16 h.
• 32.
  Isolate the recombinant Bacmid DNA.

  • a.
    Take 3 mL of the overnight culture and centrifuge at 10,000 × g for 1 min to collect the bacteria.
  • b.
    Add 300 μL of Solution I (with RNase A) to resuspend the bacterial pellet.
  • c.
    Add 300 μL of Solution II and gently invert the tube 4∼6 times to ensure complete lysis of the bacteria.

    Note: The solution should become clear. If it is not clear, invert the tube an additional 3∼5 times and let it stand at 25°C for 2∼3 min. Do not exceed a total lysis time of 5 min. Avoid vortexing.

  • d.
    Add 300 μL of Solution III and immediately invert the tube 4∼6 times to mix.

    Note: White floccules should appear.

  • e.
    Centrifuge at 12,000 × g for 10 min and transfer the supernatant to a clean 2 mL centrifuge tube.
  • f.
    Slowly add 800 μL of pre-chilled 70% isopropanol to the supernatant, invert to mix, and incubate on ice for 10 min.
  • g.
    Centrifuge at 12,000 × g for 10 min and discard the supernatant.
  • h.
    Resuspend the pellet in 500 μL of pre-chilled 70% ethanol.
  • i.
    Centrifuge at 15,000 × g for 5 min and discard the supernatant.
  • j.
    Resuspend the pellet again in 200 μL of pre-chilled 70% ethanol.
  • k.
    Centrifuge again at 15,000 × g for 5 min and discard the supernatant.
  • l.
    Allow the pellet to dry at 25°C until the ethanol has evaporated.
  • m.
    Dissolve the dried pellet in 20 μL of TE buffer and store at −20°C.

    Optional: We use the Solution I, II, III and TE buffer from the YaJi Biological Baculovirus Shuttle Vector Bacmid Mini Preparation Kit.

• 33.
  Transfect Sf9 cells with the bacmid DNA to produce the baculovirus.

  • a.
    In two 1.5 mL EP tubes containing 100 μL of SIM SF Expression Medium, add 8 μL of LipoInsect and 16 μg of Bacmid DNA separately. Gently mix the contents and incubate at 25°C for 20 min.

    Note: Transfect Sf9 cells during their logarithmic growth phase.

  • b.
    Count the Sf9 cells and adjust the density to 2×10⁶ cells/mL.
  • c.
    Add the mixed transfection reagent dropwise to 3 mL of the cell suspension.
  • d.
    Wrap the centrifuge tube containing the cell suspension with aluminum foil and incubate on a CO₂-free shaker at 27°C and 130 rpm for 72 h.
  • e.
    Centrifuge the cell suspension at 500 × g for 5 min to collect the viral supernatant after 72 h.
  • f.
    Label this supernatant as “P1” and store it at 4°C in the dark, wrapped with aluminum foil.
  • g.
    Transfer 1 mL of the P1 viral supernatant to 50 mL of Sf9 cells with a density of 2×10⁶ cells/mL. Incubate the mixture on a shaker at 27°C and 220 rpm for 72 h.
  • h.
    Centrifuge the cell suspension at 500 × g for 5 min to collect the viral supernatant after 72 h.
  • i.
    Label this supernatant as “P2” and store it at 4°C in the dark, wrapped with aluminum foil.

    Note: P1 and P2 viral supernatants should be used within 1 month.

• 34.Transfer 10 mL of the collected P2 viral supernatant to 500 mL of Sf9 cells with a density of 2∼2.5×10⁶ cells/mL. Incubate the mixture on a shaker at 27°C and 220 rpm for 72 h.

Note: A dilution ranging from 1:50 to 1:200 by volume of P2 virus to Sf9 cells is recommended. However, if the protein yield is not optimal, it is suggested to measure the viral titer and infect the cells with a MOI of 0.05∼0.1.

• 35.
  Purify recombinant CUL3/RBX1 protein.

  • a.
    Centrifuge the 500 mL cell suspension at 1,000 rpm and 4°C for 10 min after 72 h.
  • b.
    Discard the supernatant and resuspend the pellet in 40 mL of buffer I supplemented with 1 mM PMSF, 1 mM DTT, and 1 tablet of protease inhibitor cocktail (EDTA-Free).

    Note: Prepare buffer supplemented with 5% glycerol before use.

  • c.
    The next purification procedures are performed as described in steps 15∼25 (Figures 4A–4C).
  • d.
    Concentrate the CUL3/RBX1 protein using an Amicon concentrator (MWCO = 10 kDa) by centrifugation at 4,500 rpm, 4°C for approximately 20 min.
  • e.
    Add glycerol to 5% (v/v), aliquot, and store at −80°C.

Figure 4.

Purification of N8∼CUL3/RBX1

(A) The samples of flow through (FT), elution and elution after TEV protease digestion were analyzed by SDS-PAGE and visualized by Coomassie staining.

(B) SEC elution profiles of CUL3/RBX1.

(C) The size-exclusion chromatography fractions 8–11 of CUL3/RBX1, corresponding to the 11–12 mL elution volume, were analyzed by SDS-PAGE and visualized by Coomassie staining, showing CUL3 and RBX1 bands.

(D) Coomassie staining and Western blot with anti-CUL3 of samples before (0 min) and after (15 min) the in vitro neddylation reaction.

(E) SEC elution profiles of N8∼CUL3/RBX1.

(F) The size-exclusion chromatography fractions 6–12 of N8∼CUL3/RBX1, corresponding to the 10–12.5 mL elution volume, were analyzed by SDS-PAGE and visualized by Coomassie staining.

In vitro neddylation

Timing: 1 day

• 36.Follow Table 1 to set up 3 mL in vitro neddylation reaction mixture. Add all components to the reaction mixture and mix thoroughly.

Note: Do not add ATP at this step.

• 37.Allow the reaction mixture to stand at 25°C for 10 min.
• 38.Aliquot 10 μL of reaction mixture and mix with 2μL 5×SDS-PAGE protein loading buffer for SDS-PAGE analysis.
• 39.Add ATP to the reaction mixture to initiate the neddylation reaction.
• 40.Incubate the reactions for 15 min at 25°C.
• 41.Quench the reactions by adding 5 mM EDTA.
• 42.Aliquot 10 μL of reaction mixture after 15 min and mix with 2μL 5×SDS-PAGE protein loading buffer for SDS-PAGE and Western blot analysis (Figure 4D).
• 43.Spin the quenched reactions at 4,500 rpm and 4°C for 20 min using an Amicon concentrator (MWCO = 10 kDa).
• 44.
  Apply the mixtures to size exclusion column to purify N8∼CUL3/RBX1 from the reaction components.

  • a.
    Equilibrate a Superdex 200 Increase 10/300 GL column with 35 mL of SEC buffer at a flow rate of 0.3 mL/min.
  • b.
    Inject the mixtures via the sample loop into a Superdex 200 Increase 10/300 GL column.

    Note: Before SEC injection, centrifuge the sample at 15,000 × g for 10 min at 4°C to remove potential precipitates of denatured protein.

  • c.
    Collect the fractions of UV-absorbance curve peaks and analyze by SDS-PAGE followed by Coomassie staining and Western blotting to verify purity and molecular weight (Figures 4E and 4F).
• 45.Concentrate the N8∼CUL3/RBX1 protein using an Amicon concentrator (MWCO = 10 kDa) by centrifugation at 4,500 rpm, 4°C for approximately 20 min.
• 46.Add glycerol to 5% (v/v), aliquot, and store at −80°C.

CRITICAL: DTT is hazardous upon contact or inhalation. Avoid direct exposure, and prevent any contact with eyes, skin, or clothing. All handling should be conducted in chemical fume hood while wearing suitable personal protective equipment, including gloves.

Table 1.

The reaction settings used for in vitro neddylation assay

Reagent	Final concentration	Reaction
10×NEDDylation buffer	1×	300 μL
ATP	2 mM	+
DTT	5 mM	+
NEDD8	15 μM	+
UBA3	50 nM	+
UBC12	1 μM	+
CUL3/RBX1	1 μM	+
ddH2O	N/A	up to 3 mL

Expression and purification of recombinant S427D-ARIH1

Timing: 4 days

This section outlines the process for expressing S427D-ARIH1 with a 6× His tag in a bacterial expression system, followed by purification through affinity chromatography and subsequent size-exclusion chromatography.

• 47.Transform the pET28-his-S427D-ARIH1 plasmid of into BL21 (DE3) competent cells.
• 48.Select a single colony and transfer to 10 mL LB containing 50 μg/mL kanamycin and grow at 37°C with shaking at 220 rpm for 16∼18 h.
• 49.Transfer the 10 mL LB culture to 1 L LB medium with 50 μg/mL kanamycin.
• 50.Inculcate the culture at 37°C with shaking at 220 rpm for 3∼5 h, monitoring growth until OD600 reaches 0.6∼0.8.
• 51.Move the flasks to 4°C and cool them.
• 52.Cool the shaker to 18°C, then add IPTG (final concentration: 0.2 mM) to the flasks.
• 53.Incubate at 220 rpm for 16∼18 h to induce protein expression.
• 54.Collect the cells by centrifugation at 5,000 × g for 10 min at 4°C and discard the supernatant.
• 55.Resuspend the cell pellet in Buffer I at a ratio of 20 mL per liter of culture.
• 56.Disrupt the bacterial suspension by high-pressure homogenization at 600 bar for 10–20 passes until the solution becomes translucent.

Note: Representative images of the lysis steps are shown in Figure 2.

• 57.Transfer the lysate into centrifuge tubes and centrifuge at 20,000 × g for 20 min at 4°C.
• 58.Transfer the supernatant to a clear 50 mL centrifuge tube.
• 59.Equilibrate 2 mL Ni-NTA affinity resin with 10 column volumes of Buffer I.
• 60.Mix the clarified supernatant with equilibrated resin and incubate at 4°C for 2 h with rotation on a rotary shaker.
• 61.Let the mixture flow through a gravity column at 4°C and collect the flow through fraction.
• 62.Wash the Ni-NTA resin with 10∼20 column volumes of wash buffer.
• 63.Wash the Ni-NTA resin with 10 mL buffer I containing 10 mM imidazole to remove nonspecifically bound proteins.
• 64.Elute bound proteins using 5 mL of buffer I containing a linear 50–500 mM imidazole concentration gradient.
• 65.Analyze the elution fractions by SDS-PAGE followed by Coomassie staining (Figure 5A).
• 66.Concentrate the target protein to ≤500 μL for size exclusion chromatography, the procedures are performed as described in step 25 (Figures 5B and 5C).
• 67.Concentrate the ARIH1 protein using an Amicon concentrator (MWCO = 10 kDa) by centrifugation at 4,500 rpm, 4°C for approximately 20 min.
• 68.Add glycerol to 5% (v/v) aliquot, and store at −80°C.

Figure 5.

Purification of S427D-ARIH1 and Y369E-WWP2

(A) The flow through (FT) and elution fractions of the Ni-NTA affinity resin were analyzed by SDS-PAGE and Coomassie staining to detect S427D-ARIH1.

(B) SEC elution profiles of S427D-ARIH1.

(C) The S427D-ARIH1 elution fractions from size exclusion chromatography were analyzed by SDS-PAGE and Coomassie staining.

(D) The samples of pallet, lysate, flow through (FT), elution and elution after TEV protease digestion were analyzed by SDS-PAGE and Coomassie staining.

(E) SEC elution profiles of Y369E-WWP2.

(F) The Y369E-WWP2 elution fractions from size exclusion chromatography were analyzed by SDS-PAGE and Coomassie staining.

Expression and purification of recombinant HECT NEDD4 family ligases

Timing: 4 days

To comprehensively evaluate the activity of NEDD4 family E3 ubiquitin ligases in catalyzing PD-L1 ubiquitination, we purified a series of NEDD4 family E3s. The expression and purification processes of all NEDD4 family E3 ubiquitin ligases were standardized. To illustrate, we provide a detailed description of the expression and purification methods for WWP2 as an example.

• 69.Transform pGEX6P-2-GST-Y369E-WWP2 plasmid into BL21 (DE3) competent cells.
• 70.Culture a single colony in LB medium: the procedures are performed as described in steps 9∼11.
• 71.Cool the shaker to 18°C, then add IPTG to a final concentration of 0.5 mM to induce protein expression with shaking at 220 rpm for 16∼18 h.
• 72.Harvest the cells using a high-pressure homogenizer. Follow the procedures outlined in steps 13∼16.
• 73.Purify WWP2 with GST affinity chromatography and size exclusion chromatography: the procedures are performed as described in steps 17∼25 (Figures 5D–5F).
• 74.Concentrate the WWP2 protein using an Amicon concentrator (MWCO = 10 kDa) by centrifugation at 4,500 rpm, 4°C for approximately 20 min.
• 75.Add glycerol to 5% (v/v), aliquot, and store at −80°C.

Quantify the protein concentration using BSA as the standard

Timing: 1 day

This step allows for the quantification of protein concentrations using ImageJ software after analyzing a Coomassie-stained gel, with BSA utilized to create a standard curve of band intensities.

• 76.Thaw the following proteins on ice: Ub, UBA1, UbcH7, S427D-ARIH1, and HA-PD-L1 CD.
• 77.Dilute the thawed proteins to 1 mg/mL using buffer I.
• 78.Dilute the BSA standard protein to 1 mg/mL using buffer I.
• 79.Load 2, 4, 6, and 8 μL aliquots of the BSA standard protein onto the SDS-PAGE gel.
• 80.Load 3 and 5 μL aliquots of the diluted protein onto the SDS-PAGE gel.
• 81.Stain the SDS-PAGE gel with coomassie brilliant blue.
• 82.Generate a BSA standard curve by analyzing grayscale values from the stained gel.
• 83.Calculate sample protein concentrations by applying the BSA standard curve.

Preparation of liposomes from DC2.4 cells

Timing: 1 week

The following protocols describe the detailed procedures for extracting DC2.4 cells and isolating liposomes.

• 84.
  Collection of DC2.4 cells.

  • a.
    Remove the cell culture medium when DC2.4 cells in four 10 cm dishes reach 80% confluency and wash twice by adding 5 mL PBS buffer.
  • b.
    Add 500 μL of PBS buffer to the cells, then scrape the cells off using a cell scraper and centrifuge at 1,000 × g for 5 min at 4°C.
  • c.
    Remove the supernatant, then the cell pellets were subsequently resuspended in 500 μL 0.25×TM buffer and incubated at 4°C for 30 min to induce low permeability.
  • d.
    Subject the cells to three rounds of quick freeze-thaw cycles at −80°C.
  • e.
    Centrifuge the cells again at 1,000 × g for 5 min at 4°C.
  • f.
    Collect the pellet after centrifugation.
• 85.
  Liposomes Preparation.

  • a.
    Centrifuge the collected pellet at 12,000 × g for 10 min at 4°C.
  • b.
    Collect the pellet and centrifuge it at 100,000 × g for 1 h at 4°C.
  • c.
    Collect the pellet, which contains cell membrane species.
  • d.
    Pass the collected cell membranes through 400 nm, 200 nm, and 100 nm polycarbonate films using a manual extruder with syringes (ANHEJIE, Cat#ANHEJIE-1) for at least 10 cycles to obtain homogeneous liposomes.

    Note: Representative video of liposome extrusion with a manual extruder is provided in Methods Video S1.

  • e.
    Aliquot and store at −20°C.
  • f.
    Count the liposomes under a microscope.

    Note: Counting liposomes is essential for adjusting the amount used in the in vitro ubiquitination assay.

PD-L1 CD in vitro ubiquitination assays

Timing: 2 days

• 86.Thaw Ub, Ub-transferring enzymes (UBA1, UbcH7 and S427D-ARIH1), and substrate proteins (HA-PD-L1 CD) on ice.
• 87.Assemble 20 μL in vitro ubiquitination reaction mixtures according to Table 2 except ATP, with the negative control reactions missing Ub, E1, E2, E3, and substrate.
• 88.Add liposomes to in vitro ubiquitination reaction mixtures according to Table 3 except ATP.
• 89.Allow the reaction mixtures to stand at 25°C for 10 min.
• 90.Take 4 μL of reaction mixtures and mix with 8 μL 1×SDS-PAGE protein loading buffer for SDS-PAGE analysis.
• 91.Add ATP to the reaction mixtures to initiate the reaction at 37°C.
• 92.Take 4.5 μL of reaction mixtures and mix with 7.5 μL 1×SDS-PAGE protein loading buffer at the indicated times to quench the reactions, followed by boiling at 100°C for 5 min.

Note: To avoid sample loss during prolonged incubation at 37°C, briefly centrifuge the reaction mixtures before taking an aliquot.

• 93.Analyze the ubiquitination of HA-PD-L1 CD using an anti-HA antibody by Western blotting (Figures 6A and 6B).

CRITICAL: DTT is hazardous upon contact or inhalation. Avoid direct exposure, and prevent any contact with eyes, skin, or clothing. All handling should be conducted in chemical fume hood while wearing suitable personal protective equipment, including gloves.

Table 2.

The reaction settings used for in vitro ubiquitination assay

Reagent	Final concentration	Reaction1	Reaction2 (-Ub)	Reaction3 (-UBA1)	Reaction4 (-UbcH7)	Reaction5 (-ARIH1)	Reaction6 (-Substrate)
10×Ubiquitination buffer	1×	2 μL	2 μL	2 μL	2 μL	2 μL	2 μL
ATP	5 mM	+	+	+	+	+	+
DTT	10 mM	+	+	+	+	+	+
Ub	100 μM	+	–	+	+	+	+
UBA1	0.5 μM	+	+	–	+	+	+
UbcH7	1 μM	+	+	+	–	+	+
ARIH1	1 μM	+	+	+	+	–	+
Substrate	5 μM	+	+	+	+	+	–
ddH2O	N/A	up to 20 μL	up to 20 μL	up to 20 μL	up to 20 μL	up to 20 μL	up to 20 μL

Table 3.

The reaction settings used for in vitro ubiquitination assay in the presence of liposomes

Reagent	Final concentration	Reaction1	Reaction2	Reaction3	Reaction4
10×Ubiquitination buffer	1×	2 μL	2 μL	2 μL	2 μL
ATP	5 mM	+	+	+	+
DTT	10 mM	+	+	+	+
Ub	100 μM	+	+	+	+
UBA1	0.5 μM	+	+	+	+
UbcH7	1 μM	+	+	+	+
ARIH1	1 μM	+	+	+	+
Substrate	5 μM	+	+	–	–
Phosphorylated substrate	5 μM	–	–	+	+
Liposomes	2 per/μL	–	2.6 μL	–	2.6 μL
ddH2O	N/A	up to 20 μL	up to 20 μL	up to 20 μL	up to 20 μL

Figure 6.

In vitro ubiquitination assay for PD-L1 CD

(A) In vitro ubiquitination assay for PD-L1 CD by S427D-ARIH1 with the negative controls.

(B) In vitro ubiquitination assay for WT PD-L1 CD_270-290 and the phosphorylated PD-L1 CD_270-290 by S427D-ARIH1.

Expected outcomes

This protocol enables the detection of ubiquitination in the cytoplasmic domain of PD-L1 by various E3 ligases, as well as the evaluation of how phosphorylation and membrane association affect PD-L1 ubiquitination. An example of this is shown in Figure 6A that S427D-ARIH1 can catalyze the polyubiquitination of the cytoplasmic domain of PD-L1 demonstrated by appearance of higher molecular weight bands while all the negative controls remain unchanged. Figure 6B shows that the ubiquitination of nonphosphorylated PD-L1 CD is inhibited in the presence of liposomes, while the phosphorylated PD-L1 CD is much less affected by liposomes.

Limitations

While this protocol provides solid evidence to support the enzymatic activities of E3 ligases towards cytoplasmic domains of immune checkpoint ligands/receptors, one should remain cautious to interpret the results. Stringent negative controls should be included in the assays to avoid false positive results. In case negative results are obtained, it does not necessarily mean the E3 could not catalyze the reaction in the cell. It could be that other factors such as particular modifications or binding partners are required to enable the ubiquitination by such E3s. The other limitation is that this protocol is limited by feasibility of expressing and purifying enzymes and substrates needed for the reaction.

Troubleshooting

Problem 1

The expression levels of substrate proteins from E. coli cells are low (steps 1∼26).

Potential solution

In this study, we initially attempted to use a 6×His-SUMO tag for the fusion expression of the cytoplasmic domain of PD-L1. However, due to the small size of the PD-L1 CD, this strategy resulted in low protein expression levels and difficulties in effectively separating the SUMO tag from the target protein. Consequently, we switched to using the solubility-enhancing GST tag for fusion expression. GST has a dimeric nature, which allows for efficient separation from PD-L1 CD via AKTA Pure system, thereby successfully yielding a high-purity and high-yield PD-L1 CD protein.

Problem 2

The transfer step during western blotting for PD-L1 CD is tricky due to its small size, which can easily be over-transferred. (step 93).

Potential solution

Use mild setting and short time during the transfer. We set the transfer voltage to 80 V for 30 min, or apply a current of 200 mA for 45 min.

Problem 3

The amount of liposome used in the reaction should be optimized. While small amount of liposome could not inhibit the ubiquitination reaction, too much liposome could hinder the detection of the substrate by Western blotting. (step 85 and 88).

Potential solution

It is necessary to observe and count the liposomes under a microscope and perform a gradient optimization of the vesicle addition amount.

Problem 4

GST-tagged CUL3/RBX1 produced by Sf9 insect cells is prone to proteolysis during the purification process, which leads to a marked reduction in the final protein yield (Step 35).

Potential solution

To reduce CUL3/RBX1 degradation, we added 5% glycerol to Buffer I before cell lysis, pre-cooled all materials and equipment, performed the entire procedure at 4°C, and minimize the purification time.

Problem 5

When wildtype E3 ligases were used, no or little ubiquitination was observed for PD-L1. This is because the enzymatic activities of E3 ligases are tightly controlled and are usually in inactive or less active form (step 47 and 69).

Potential solution

Strategies to activate the E3 ligases should be applied to ensure the ubiquitination assay works. In our case, we generated phosphomimetic mutants (S427D-ARIH1¹³ and Y369E-WWP2¹⁴), which relieve autoinhibition and restore E3 activity, enabling detection of their activities towards substrates in the subsequent in vitro ubiquitination assays.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Professor Zan Chen (zanchen@cqmu.edu.cn).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Guojiao Xie (2025130522@stu.cqmu.edu.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

• •Original data have been deposited to Mendeley Data: https://doi.org/10.17632/rgbf8xptc2.1.
• •This study did not generate any code.

Acknowledgments

We thank Dr. Wei Jiang from Fudan University for sharing the plasmids of PD-L1. This work was supported by the National Key R&D Program of China (2024YFB4612400 to Z.C.); the National Natural Science Foundation of China (32201027 to Z.C.); the Natural Science Foundation of Chongqing, China (CSTB2023NSCQ-MSX0299 to Z.C.); Chongqing Human Resources and Social Security Bureau Innovation Funding for Overseas Chinese Students’ Return (to Z.C.); Research Startup Funds of Chongqing Medical University (to Z.C.); and the CQMU Program for Youth Innovation in Future Medicine (to Z.C.).

Author contributions

G.X. conceived the study, performed the experiments, conducted data analysis, and wrote the manuscript. L.G., L.T., T.Z., and X.L. contributed reagents, performed related experiments, and conducted data analysis. X.Y. and H.J. supervised the study. Z.C. conceived and supervised the study, interpreted the data, and wrote the manuscript.

Declaration of interests

The authors declare no competing interests.