Allyl isothiocyanate suppresses the growth and pathogenicity of Candida albicans

Abstract

Candida albicans is a fungus that is predominantly detected in the oral cavity and causes opportunistic infections. Among the elderly, a decline in the host's resistance to pathogens due to immunosenescence makes them more susceptible to oral candidiasis, which eventually may progress to systemic candidiasis. Allyl isothiocyanate (AITC) is a component found in Brassicaceae plants (such as wasabi), which possesses strong antibacterial properties and is used as a food preservative. In this study, the effects of AITC on C. albicans were investigated though: (1) inhibition of growth and biofilm formation, (2) inhibition of adhesion to denture base resin, (3) inhibition of dimorphic transformation that exacerbates pathogenicity, and (4) inhibition of the production of secretory aspartic protease and lipase. Taken together, this suggests that AITC suppresses the growth and pathogenicity of this fungus. Further investigation of the mechanism revealed a decrease in hyphae-specific gene expression in the intracellular signaling MAP kinase cascade and cAMP pathway, as well as the induction of oxidative stress and a tendency toward apoptosis within C. albicans cells. Based on these findings, we propose that AITC may be beneficial for the prevention and suppression of oral candidiasis and has the potential for clinical application aimed at improving oral care and quality of life.

Introduction

Candida albicans is a commensal fungus found on the skin, in the gastrointestinal tract, and in the oral cavity. It can cause opportunistic infections due to immunocompromised conditions such as cancer, AIDS, steroid use, and aging, as well as fungal dysbiosis caused by prolonged use of antibiotics that alter the microbiome.¹ Typically, C. albicans proliferates on the surface of the oral cavity and skin, causing white or red spots, with discomfort such as itching, irritation, or both. In patients with normal immune function, it is not usually a fatal disease. However, in patients with significantly weakened immune systems after surgery, C. albicans may colonize and proliferate in intravenous lines or drip tubes, leading to invasive candidiasis or candidemia, requiring prompt treatment.²

This fungus has several virulence factors, including the ability to adhere to host cells, produce tissue-degrading enzymes that damage the host’s tissue components, and form biofilms that allow it to evade the host’s immune responses and promote growth. Additionally, C. albicans exhibits dimorphism, meaning it can switch between yeast and hyphal forms depending on the surrounding environment. In the hyphal form, adhesion, tissue damage, and biofilm formation abilities are enhanced.3, 4

In the oral cavity, C. albicans can cause candidiasis, classified into denture stomatitis, pseudomembranous candidiasis, and erythematous candidiasis, and it has also been linked to glossodynia. Among the elderly patients and those hospitalized, the risk of candidiasis increases due to poor oral hygiene caused by the decline in physical function and immune suppression due to aging or chronic illness.5, 6 Furthermore, C. albicans adheres easily to acrylic resin, which is commonly used in dentures, making it more likely to be found in the oral cavities of elderly denture wearers.⁷ Similarly, the oral cavity serves as a reservoir for C. albicans, which has been presumed to contribute to systemic candidiasis, such as in the gastrointestinal tract and female reproductive organs.⁸

To prevent the onset of oral candidiasis, maintaining oral hygiene to reduce the total number of C. albicans in the mouth is crucial. Treatment generally involves antifungal medications. However, in patients with decreased physical function, adequate cleaning of their own oral cavity or dentures may not be possible, and long-term use of chemotherapy drugs carries the risk of developing resistant strains.⁹ Furthermore, there are many cases where the formation of biofilms produced by bacteria inhibits the penetration of drugs, making the condition difficult to treat.¹⁰ In this regard, the development of materials that can be used long-term to suppress the growth and virulence of C. albicans, with a low likelihood of resistance development and safe usage, is needed.

Allyl isothiocyanate (AITC) is a type of isothiocyanate found only in cruciferous plants (such as those containing glucosinolates) and is particularly abundant in wasabi.¹¹ AITC has potent antimicrobial properties and is used as a food preservative.¹² It has also been reported to have antifungal activity against C. albicans and, when combined with the antifungal drug fluconazole, shows synergistic effects, thereby enhancing antifungal activity.13, 14 The mechanism of action is believed to involve inhibition of ergosterol production and arresting the cell cycle, though detailed studies on the antifungal mechanisms are still limited.13, 15

This study aims to investigate the following: (1) effects of AITC on C. albicans growth; (2) ability of AITC to transform into the hyphal form due to dimorphism; (3) the protein and lipid-degrading enzyme activity of AITC involved in human tissue destruction; and (4) AITC effects on C. albicans adhesion to acrylic resin, which is a component of dentures, and biofilm formation. Moreover, the antifungal effects of AITC against C. albicans were confirmed, and its potential for preventing and clinically applying oral candidiasis was also considered.

Results

Effect on growth, adhesion to resin discs, and biofilm formation

The inhibitory effect on growth was evaluated by measuring the turbidity of the culture medium. When AITC was added to the medium at concentrations ranging from 8 to 128 μg/mL and cultured, a concentration-dependent growth inhibition effect was observed starting from the 16 μg/mL concentration. At a concentration of 128 μg/mL, no growth was observed (Figure 1(a)). When experiments were conducted using denture base resin pieces on adhesion, to which C. albicans show strong affinity, and AITC was added, it was confirmed that the number of colony-forming unit (CFU) formed on agar medium decreased in a concentration-dependent manner from environments with AITC concentrations of 16 μg/mL or higher, showing an inhibition of adherence to the resin (Figure 1(b)). The experiment of the effect on biofilm formation was conducted under the same conditions as the growth inhibition experiment, the amount of biofilm formed after 48 h of incubation decreased in a concentration-dependent manner. This demonstrated the inhibitory effect of AITC on biofilm formation (Figure 1(c)).

Fig. 1.

(a) Evaluation of the effect of AITC on the growth of C. albicans. C. albicans showed concentration-dependent growth inhibition by AITC, and almost no growth was observed at a concentration of 128 μg/mL. (b) The effect of AITC on the adhesion of C. albicans to resin. AITC inhibited the adhesion of both strains of C. albicans to resin chips in a concentration-dependent manner. The number of C. albicans cells adhering to a single resin chip is shown. (c) The effect of AITC on biofilm formation by C. albicans. Biofilm formation was inhibited in a concentration-dependent manner in the presence of AITC. Each sample (n = 6) was analyzed using one-way analysis of variance (ANOVA) and Scheffe's test to determine the statistical significance between the control group and the treatment group.

Microscopic observation and flow cytometry analysis of hyphal morphogenesis

After culturing the test strain in media containing various concentrations of AITC (8-128 μg/mL), cell morphology was observed under a light microscope. A significant reduction in hyphal cells was observed in media with AITC concentrations of 16 μg/mL or higher. (Figure 2(a)).

Fig. 2.

The effect of AITC on dimorphic (hyphae) transformation. The inhibitory effect of dimorphic transformation on pathogenicity was evaluated by microscopic observation and flow cytometry. (a) Microscopic images of the control group culture (400× magnification) and microscopic images after culture in medium containing FCS and 8, 16 μg/mL AITC. (b) Measurement graph showing the effect of adding AITC at a concentration of 16 μg/mL. The graph shows measurement values, with the X-axis representing cell size and the Y-axis representing morphological complexity. Cells in the upper right region of each figure exhibit hyphal morphology. For each sample (n = 6), the statistical significance of the difference between the control and treated groups was determined using Scheffe's test in a one-way analysis of variance (ANOVA).

Furthermore, cells cultured in media with 16 μg/mL of AITC were analyzed by flow cytometry. The resulting plot was divided into four quadrants, with the bottom-left quadrant representing small-sized cells with simple internal structures, which were defined as yeast cells (low pathogenicity), and the other regions representing hyphal cells (high pathogenicity). Upon examining the effect of AITC on hyphal transformation, it was clearly observed that AITC treatment led to a predominance of small-sized, yeast-form cells (Figure 2(b)).

Effect on secreted aspartic protease and lipase activity

When the supernatant of the culture grown in media with added AITC was analyzed for secreted aspartyl proteinase (SAP) and Lipase activity, it was observed that the addition of FCS increased the activity. However, in media containing AITC, a concentration-dependent inhibition of protease and lipase activity was confirmed. (Figure 3(a),(b)).

Fig. 3.

The effect of AITC on SAP activity and lipase activity. (a) SAP activity was inhibited in a concentration-dependent manner by AITC. (b) Lipase activity was also inhibited in a concentration-dependent manner by AITC. Each sample (n = 6) demonstrated statistical significance in the difference between the control group and the treatment group, as determined by one-way analysis of variance (ANOVA) using Scheffe's test.

qRT-PCR assay

When comparing the mRNA expression of hyphal morphogenesis-related genes between the control (Ctrl) and AITC (16 μg/mL) treatments, no significant changes were observed in the expression of RAS gene. Upon examining the intracellular hyphal morphogenesis signaling pathways, specifically the MAP kinase cascade and cAMP-dependent PKA pathway, it was found that the expression of CST20 in the MAP kinase cascade and EFG1 in the cAMP-dependent PKA pathway was significantly suppressed. These results confirmed that AITC inhibits hyphal morphogenesis by targeting these signaling molecules. Furthermore, the expression levels of ALS3, a gene encoding an adhesin closely associated with hyphal morphogenesis, as well as those of the SAP4 to SAP6 genes, which belong to the secreted aspartyl proteinase (SAP) family, were markedly reduced (Figure 4(a),(b)).

Fig. 4.

The effect of AITC on intracellular signals involved in hyphal transformation and biofilm formation. (a) Diagram showing the MAP kinase cascade and PKA pathway, which are intracellular signaling pathways involved in hyphal transformation in C. albicans. (b) When C. albicans was treated with 16 μg/mL AITC, the expression levels of all genes examined were suppressed in hyphal transformation, including CST1 in the downstream region of the MAP kinase cascade and EFG1 in the PKA pathway, and in biofilm formation. Samples from the control group and the AITC-treated group are shown, and the statistical significance of the differences between the control group and the treated group in all qPCR analyses was determined using Scheffe's test in a one-way analysis of variance (ANOVA).

Effects on oxidative stress

After culturing C. albicans cells at AITC concentrations ranging from 4 to 64 μg/mL, cell disruption was followed by centrifugation. The measurement of superoxide dismutase (SOD), catalase, and hydrogen peroxide levels revealed that the intracellular SOD levels decreased in a concentration-dependent manner with increasing AITC concentration. In contrast, hydrogen peroxide levels significantly increased in a concentration-dependent manner. While catalase levels slightly increased at 4 μg/mL, they decreased in a concentration-dependent manner starting from 16 μg/mL. These findings confirm that AITC induces oxidative stress within C. albicans cells. (Figure 5(a)-(c)).

Fig. 5.

The occurrence of intracellular oxidative stress induced by AITC was examined. (a) A concentration-dependent decrease in SOD levels was observed. (b) The amount of hydrogen peroxide in the cells increased in a concentration-dependent manner with AITC. (c) Catalase activity was inhibited by AITC. Each sample (n = 6) demonstrated the statistical significance of the difference between the control group and the treatment group using Scheffe's test in a one-way analysis of variance (ANOVA). (*Comparison with the control group).

Effect on apoptosis

C. albicans CaMCA1 is a homolog of the metacaspase YCA1 of Saccharomyces cerevisiae and is involved in oxidative stress-induced apoptosis.¹⁶ The expression of the CaMCA1 gene in C. albicans cultured in media with AITC concentrations of 16 and 32 μg/mL was increased compared to the control. This suggests that AITC may upregulate the expression of the CaMCA1 gene, potentially promoting apoptosis in C. albicans (Figure 6).

Fig. 6.

The effect of AITC on CaMCA1 expression was examined. CaMCA1 expression increased in the presence of AITC. Each sample (n = 6) demonstrated the statistical significance of the difference between the control group and the treatment group using Scheffe's test in a one-way analysis of variance (ANOVA). (*Comparison with the control group).

Discussion

The genus Candida, particularly C. albicans, is a common resident fungus frequently detected on the skin, mucous membranes, oral cavity, intestinal tract, and vagina.¹ It can cause opportunistic infections and dysbiosis-related candidiasis due to changes in the microbiota following long-term antibiotic use or a decline in immune function. While antifungal agents are typically used to treat candidiasis, concerns remain regarding the emergence of drug-resistant strains and potential adverse effects on the host caused by prolonged use.¹⁷ Throughout this study, we focused on prevention rather than treatment, hypothesizing that reducing the number of Candida in the oral cavity and suppressing its pathogenicity would be important. Since oral Candida is considered one of the possible causes of gastrointestinal and vaginal candidiasis, we further hypothesized that preventing oral candidiasis might contribute to the prevention of related systemic diseases.

Through a search for substances with antifungal activity against C. albicans that are suitable for use in the oral cavity, we focused on AITC, a natural antimicrobial compound found in certain foods.¹² We first investigated the effect of AITC on the growth of C. albicans and found that AITC suppressed its growth in a concentration-dependent manner, with a significant inhibitory effect observed at a concentration of 125 μg/mL (Figure 1(a)). Although differences in strain, culture medium, and cultivation conditions were noted compared to the report,¹³ we confirmed that AITC alone could inhibit the growth of this fungus.

Subsequently, we considered that a key aspect of microbial pathogenicity lies in the expression of virulence factors that attack the host. If AITC could suppress these virulence factors at lower concentrations than those required to inhibit growth, it would provide highly valuable information for its clinical application. Major virulence factors of C. albicans include: 1. Adhesion to host surfaces, 2. Biofilm formation, 3. Dimorphic switching from yeast to hyphal form, which enhances pathogenicity, and 4. Production of proteolytic and lipolytic enzymes. We therefore examined the effects of AITC on these virulence factors at concentrations lower than those required for growth inhibition.

Adherence to host surfaces is the first step in the pathogenesis of microbial infections. C. albicans is frequently detected in the oral cavities of elderly individuals with weakened immune systems and is known to adhere easily to acrylic resin surfaces.⁷ This explains the high detection rate in the oral cavities of elderly individuals who wear dentures. Due to their structure, dentures accumulate food debris and denture plaque on the mucosal side, requiring proper hygiene guidance for denture users. However, biofilms formed by C. albicans and other oral microorganisms adhere firmly to denture surfaces. Among elderly individuals with cognitive impairment or underlying diseases such as rheumatoid arthritis or Parkinson’s disease, self-cleaning of dentures may be difficult, increasing the likelihood of poor oral hygiene and higher C. albicans counts.¹⁸ Based on this background, we evaluated the adhesion of C. albicans using denture resin specimens and CFU counts and found that AITC suppressed adhesion in a concentration-dependent manner, even at low concentrations. (Figure 1(b)) These results suggest that AITC could exert an antimicrobial effect not only when dentures are worn in the mouth, but also when applied to dentures after removal.

Similarly, it has been reported that C. albicans escapes human immune responses and antifungal agents by forming biofilms and enhances its pathogenicity by transitioning from the yeast form to the hyphal form.3, 19, 20 These two virulence factors—biofilm formation and hyphal transformation—are closely related. The presence of AITC inhibited biofilm formation and suppressed the hyphal transformation of C. albicans, which is associated with high pathogenicity (Figure 1(c), Figure 2). Notably, this suppression of hyphal formation was clearly observed through both optical microscopy and flow cytometry analysis (Figure 2). To investigate the effect of AITC on intracellular signaling pathways involved in biofilm formation and hyphal transformation, we measured the expression levels of related genes. Among the major genes involved in biofilm formation; ECE1 is essential for both cell elongation and biofilm development; BCR1 regulates upstream genes such as ALS3 and HWP1, which are involved in hyphal-specific cell wall proteins and adhesion factors; ECE1 is associated with biofilm formation in both in vitro and in vivo environments.²¹ Additionally, glycosylphosphatidylinositol-anchored proteins, including adhesion-related proteins such as Rbt1 and Eap1, and members of the ALS family is a member of the ALS gene family, which encodes large cell-surface glycoproteins involved in the adhesion of this fungus, have also been reported to contribute to biofilm formation.22, 23

The development of hyphae in C. albicans during morphogenesis is tightly regulated by environmental cues through two key intracellular signaling pathways: the Cek1-MAPK cascade and the cAMP-PKA pathway24, 25 (Figure 4(a)). Both pathways are initiated via stimulation of the membrane-localized GTPase Ras1.²⁶ Our gene expression analysis revealed that BCR1, ECE1, RBT1, and EAP1, all genes associated with biofilm formation, showed significantly reduced expression levels in the presence of AITC, confirming the suppression of biofilm development.

Regarding hyphal transformation, RAS1, as well as the cAMP-PKA pathway components CYR1, BCY1, and TPK2, showed no significant changes in gene expression (Figure 4(b)). However, gene expression was reduced for CST20 and CPH1 in the MAP kinase cascade, as well as for EFG1 in the cAMP-PKA pathway. Furthermore, genes associated with hyphal transformation, such as ALS3, and SAP4–6 also exhibited reduced expression.ALS3, another member of the ALS gene family, is not only involved in adhesion and biofilm formation but also contributes to increased biofilm pathogenicity through its role in co-aggregation with other microbial species.27, 28 SAP4 to SAP6 are responsible for the production of SAPs, and the suppression of their expression suggests a potential mechanism for the inhibition of SAP activity.

These findings suggest that AITC may inhibit the expression of hyphae-specific genes through both intracellular signaling pathways. Additionally, the upregulation of YWP1, which is associated with yeast-form cell wall production, provides further evidence for the suppression of hyphal transformation. Moreover, since ALS3 and HWP1 encode cell wall proteins that play critical roles in intercellular adhesion and cell-surface interactions and are essential for the proper formation of the three-dimensional structure of biofilms,²⁹ the observed effects further support the antimicrobial properties of AITC.

We also investigated the effect of AITC on the enzymatic activities of major virulence factors produced by this fungus that are known to damage oral tissues—specifically secreted aspartyl proteases (SAPs) and lipases.30, 31 AITC was found to inhibit the activity of both enzymes (Figure 3). Taken together, these results demonstrate that AITC can attenuate the pathogenicity of C. albicans even at concentrations that do not significantly inhibit fungal growth.

Next, although this study demonstrated the antifungal activity of AITC against C. albicans, we attempted to explore its possible mechanisms of action. There have been numerous reports on the antimicrobial mechanisms of various compounds,32, 33 and we first investigated the involvement of oxidative stress.³⁴ Intracellular components were extracted from C. albicans treated with AITC and analyzed. The results showed that the amount of SOD—an enzyme that decomposes superoxide anion radicals, one of the most potent reactive oxygen species (ROS)—decreased in a concentration-dependent manner with increasing AITC levels (Figure 5(a)). Conversely, the intracellular accumulation of hydrogen peroxide (a type of reactive oxygen species) increased (Figure 5(b)). Furthermore, AITC reduced intracellular levels of catalase, suggesting that the breakdown of hydrogen peroxide was suppressed, leading to its further accumulation within the cells (Figure 5(c)). These findings clearly indicate that AITC exerts oxidative stress on C. albicans, thereby suppressing its growth and pathogenicity.

We further investigated the relationship between AITC treatment and cell death. Previous studies have shown that C. albicans strains lacking the gene CaMCA1, which encodes a metacaspase, exhibit resistance to oxidative stress-induced cell death, indicating that CaMCA1 plays a role in triggering cell death under such conditions.¹⁶ Our analysis showed that AITC treatment increased the expression of the CaMCA1 gene (Figure 6). In addition, given reports suggesting that C. albicans apoptosis is mediated by excess intracellular hydrogen peroxide,³⁵ our results showing hydrogen peroxide accumulation further support the hypothesis that AITC may induce apoptosis in C. albicans.

Considering emerging concerns regarding antifungal resistance, AITC may serve as a potential preventive agent, either as an alternative or as a complementary approach to existing antifungal therapies. Further detailed analyses of AITC's antifungal mechanisms are needed. Since AITC is a volatile compound, development of new delivery systems—such as encapsulation technologies—may be necessary. Moreover, because AITC is a pungent compound that activates the TRPA1 receptor, which is involved in pain perception in the tongue, nasal cavity, and pharynx, careful consideration of its effective concentration and duration of use will be essential. Future studies, including animal experiments, are warranted to explore its clinical applicability.

In summary, AITC was found to inhibit the growth of C. albicans and suppress key virulence factors, including adhesion, biofilm formation, hyphal transformation, and proteolytic and lipolytic activity. These effects were associated with AITC-induced oxidative stress and apoptosis in C. albicans. These findings suggest that AITC possesses potential as an oral care agent through the regulation of both the cell count and virulence factors of C. albicans.

Materials and methods

Strains and materials

In this study, the test strains Candida albicans ATCC18804 and NUD202 were used. The ATCC18804 strain (a commercially available standard strain of C. albicans) and the NUD202 strain (isolated from the university hospital affiliated with our institution) were used in this study to investigate whether differences in their origins contribute to phenotypic or genotypic variations. For culturing these fungi, Sabouraud glucose agar medium (1.0% polypepton, 2.0% glucose, pH 5.5: SG) was employed. AITC was obtained from FUJIFILM Wako Chemicals (Osaka, Japan).

Effect on growth

AITC was prepared in the culture medium by serial two-fold dilution to final concentrations ranging from 8 to 128 μg/mL. A total of 150 μL of each concentration was added to each well of a 96-well plate. The test strains, which were pre-cultured in SG broth, were inoculated with 10 μL (approximately 1.0×10⁴ cells/mL) of the culture into each well and incubated at 37 °C for 18 h under aerobic conditions. Following incubation, the optical density at 600 nm (OD₆₀₀) was measured using a microplate reader (TrisStar LB941, Berthold Technologies, Baden-Württemberg, Germany) to evaluate the effect of the bacterial supernatants on fungal growth.

Effect on adhesion to resin discs

In all subsequent experiments, 5% fetal calf serum (FCS) was supplemented to the culture medium with the aim of enhancing pathogenicity. Since C. albicans tends to adhere easily to the acrylic resin of dentures, the effect of AITC on adhesion was investigated. PMMA resin discs (diameter 10 mm × thickness 1 mm: SHOFU Co., Ltd., Kyoto, Japan) were placed in wells of a 24-well plate. After adding 2 mL of filtered whole saliva (treated at 56 °C for 1 h) to each well, the saliva was incubated at 37 °C for 1 h to form a salivary pellicle. After washing with phosphate-buffered saline (PBS), a suspension of the test fungus (1.0 × 10⁷ cells/mL PBS) containing AITC at concentrations ranging from 8 to 128 μg/mL was added, and the plates were incubated at 37 °C for 1 h. After removing the fungal suspension, the non-adherent fungi were washed away with PBS. The resin discs were then subjected to ultrasonic treatment in 2 mL of PBS (20 W, on ice: 90 s, HandySonic UR-21P, Tomy Seiko Co., Ltd., Tokyo, Japan) to detach and recover the fungi adhered to the resin. The fungal suspension was diluted and spread onto SG agar plates and incubated overnight. After incubation, CFUs were counted to measure the number of fungi that had adhered to the resin discs.³⁶

Effect on biofilm formation

The biofilm produced by C. albicans inhibits the action of chemotherapy drugs and makes it difficult to remove the bacteria from surfaces. Therefore, a decrease in biofilm formation is believed to suppress the pathogenicity of Candida itself and contribute to the enhancement of antifungal drug efficacy.

The same conditions used for the growth inhibition experiments were applied to prepare the fungal suspension, and it was incubated at 37 °C for 48 h. After removing the supernatant, each well was washed with PBS, and 50 μL of 0.01% crystal violet solution was added for 30 min of incubation. The crystal violet solution was removed, and the wells were washed twice with PBS. Afterwards, 200 μL of ethanol was added to elute the dye bound to the biofilm. The absorbance of each well was measured at 570 nm using a microplate reader (TrisStar LB941, Berthold Technologies, Baden-Württemberg, Germany) and used as a measure of biofilm formation,³⁷ which in-turn was calculated by comparing the results to the control (without AITC), which was considered as 100%.

Microscopic observation and flow cytometry analysis of hyphal morphogenesis

C. albicans is a dimorphic fungus capable of switching between yeast and hyphal forms, and its pathogenicity is enhanced during the hyphal form transition. Therefore, the effect of AITC on hyphal morphogenesis of the test strain was evaluated using optical microscopy for cell morphology observation and flow cytometry analysis. The NUD202 strain was used in the following experiments.

The test strain was cultured at 37 °C for 18 h in media containing various concentrations (4, 8, 16, 32, 64, 128 μg/mL). After culturing, the fungal cells were smeared onto a glass slide, dried, and fixed by flame, then stained with crystal violet. The cell morphology was observed under an optical microscope.

Additionally, after culturing with 16 μg/mL of AITC, the fungal pellet was washed twice with distilled water (d.w.), followed by fixation with 5% glutaraldehyde at 4 °C for 2 h. The fixed fungal cells were washed and then resuspended in distilled water. The fungal suspension was analyzed using a BD Accuri™ C6 flow cytometer (BD Bioscience, Franklin Lakes, NJ, USA). A total of 3000 cells were measured, and laser illumination was used for measurement. Cell size was plotted on the X-axis, and internal complexity was plotted on the Y-axis to observe the changes in cell morphology due to AITC.

Effect on secreted aspartic protease and lipase activity

Secreted aspartic protease (SAP) and lipase are well-known host tissue-damaging enzymes produced by C. albicans, and it has been reported that genes involved in SAP production are downstream of signaling pathways related to hyphal morphogenesis. The test strain was inoculated into media containing FCS and various concentrations (8-32 μg/mL) of AITC and incubated aerobically at 37 °C for 18 h. After culturing, the supernatant was collected by centrifugation (5000 g, 10 min, 4 °C) and concentrated 25 times using a centrifugal filter unit (Ultracel™-10K centrifugal filter unit, Millipore).

The SAP activity in the sample was measured using a colorimetric quantification method.³⁸ Briefly, the sample was mixed with a 1% solution of the enzyme substrate azocasein in acetate buffer (pH 4.8) and incubated at 37 °C for 1 h. After the incubation, 10% trichloroacetic acid was added to stop the reaction, and the mixture was centrifuged (10,000g, 10 min, room temperature). The supernatant was transferred to wells of a 96-well plate and mixed with an equal volume of 0.5 N NaOH. After 15 min, optical density (OD) at 440 nm was measured using a microplate reader (TriStar LB941, Berthold Technologies). A standard curve for enzyme activity (units) was created using pepsin.

Lipase activity was tested using the QuantiChrom™ Lipase Assay Kit (BioAssay Systems, CA, USA), and the lipase activity in fungal cells was measured at 412 nm, following the manufacturer’s instructions.

qRT-PCR assay

The experiment was conducted according to a previously published study.³⁶

The strain was inoculated into media containing AITC (16 μg/mL) and FCS (5%) and incubated aerobically at 37 °C for 1 h. The test strain was then collected by centrifugation (5000 g, 10 min, 4 °C) and washed twice with PBS. The resulting fungal cells were treated with Zymolyase (20 T, Seikagaku Biobusiness Corp., Tokyo, Japan) to digest the cell wall, and RNA was extracted using the Mag Extractor -RNA- (Toyobo Co., Ltd., Osaka, Japan). cDNA was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo Co., Ltd., Osaka, Japan). All kits were used according to the manufacturer's recommendations.

Biofilm formation and hyphal morphogenesis are closely related, so we investigated the expression levels of genes involved in biofilm formation, namely ECE1, BCR1, EAP1, and RBT1. To evaluate the two major intracellular signaling pathways related to hyphal morphogenesis (MAP kinase cascade and PKA pathway), we analyzed the mRNA expression levels of the corresponding signaling pathway genes (RAS1, CST20, CPH1, CYR1, BCY1, TPK2, EFG1), genes related to yeast cell wall proteins (YWP1), and the gene encoding hyphal cell wall protein (HWP1).

qRT-PCR was performed using SYBR Premix Ex Taq (Takara Bio Inc., Otsu City), starting with an initial denaturation step at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 1 min. After each PCR cycle, a dissociation curve was created to confirm that a single product was amplified using Thermal Cycle Dice™ real-time system software (Takara Bio Inc.). The expression results were normalized to the expression of EFB1, and the relative gene expression was calculated using the comparative Ct method.³⁹

Gene-specific primers were used to perform qRT-PCR to analyze the gene expression levels within the cells. The nucleotide sequences of the specific primers used for each analysis are shown in Table 1.22, 40, 41, 42, 43, 44, 45, 46, 47, 48

Table 1.

List of specific primers used in this study.

Gene	Forward (5′-3′)	Reverse (5′-3′)	(Refs.)
EFB1	CATTGATGGTACTACTGCCAC	TTTACCGGCTGGCAAGTCTT	40
RAS1	GTTGTTGTTGGAGGTGGTGGTGTT	GGCCAGATATTCTTCTTGTCCAGC	41
EFG1	CCAGGGTGGTGCTGCTAATAG	GGGTGAAGGGTGAACTGAACC	42
CPH1	CGAGAACCAGCATTATCATTCCA	GAGTTTCCATGTGTTTACCCAATTG	43
CST20	CGGTAACATCAAGATCACTGA	GATATAATGCCCTCAATGGAG	41
CYR1	GAACCAGATGTTATAACCGG	TTCCGGCATTTTCATTGCCC	41
BCY1	ATGTCTAATCCTCAACAACA	TTAATGACCAGCAGTTGG	44
TPK2	GAAGTTATGACCGTTACATGG	ACTGCTGATTTGACAAGAAG	44
YWP1	CTGATATTCGTAATGCTGGTAAAGTG	GGAGTTTCACCCATTAATCTTCTTC	45
HWP1	CAGAAGCTTCCATTCCACCT	TTTGGAACAGCTGGAGAGGT	45
ALS3	CCAAGTGTTCCAACAACTGAAA	GAACCGGTTGTTGCTATGGT	46
SAP4	CGCTGGTGTCCTCTTAGATTCTG	AGGCATAGATAATGCTACGAGCAA	40
SAP5	CCAGCATCTTCCCGCACTT	TTTAGCGTAAGAACCGTCACCAT	40
SAP6	GATTGTAAAACTTCAGGTACCGTTGA	CGAAGCAGGAACGGAGATCT	40
BCR1	GCATTGGTAGTGTGGGAAGTTTGAT	AGAGGCAGAATCACCCACTGTTGTA	47
EAP1	CTGCTCACTCAACTTCAATTGTCG	GAACACATCCACCTTCGGGA	22
ECE1	CCCTCAACTTGCTCCTTCACC	GATCACTTGTGGGATGTTGGTAA	47
RBT1	CTGCCATTCAACCATCTGCTAACTCCTCATAC	CAGCAAGACCAATAATAGCAGCACCATAAGT	22
CaMCA1	TATAATAGACCTTCTGGAC	TTGGTGGACGAGAATAATG	48

Effects on oxidative stress

The oxidative stress generated in C. albicans cells due to AITC treatment was measured. AITC (concentrations of 4, 8, 16, 32, and 64 μg/mL) was added to the medium, and aerobic incubation was carried out for 18 h. After incubation, fungal cells were collected and washed twice with PBS. The cells (approximately 1.0×10^8 cells) were suspended in 150 μL of extraction buffer (50 mM Tris-HCl buffer (pH 7.6), 1 mM EDTA, 0.5% Triton-X 100). The solution was then placed in a ZircoPrep Mini (Nippon Genetics Co. Ltd., Tokyo, Japan) and subjected to 10 min of stirring and cell disruption using a Cell disruptor (µT-12, TAITEC, Tokyo, Japan). After centrifugation, the supernatant was used as the sample.³⁶

The Superoxide Dismutase Assay Kit (Cayman Chemical Company Inc., Ann Arbor, MI, USA) was used to measure the amount of SOD in the tested fungal cells. The Red Hydrogen Peroxide Assay Kit (Enzo Life Sciences Inc., Farmingdale, NY, USA) was used to measure the hydrogen peroxide levels in the cells, following our previous research [0]. The Catalase Assay Kit (Cayman Chemical Company Inc., Ann Arbor, MI, USA) was used to measure catalase activity in the cells. All kits were used according to the manufacturer's recommendations.

Effect on apoptosis

Since CaMCA1, the homolog of the metacaspase YCA1 in S. cerevisiae, is involved in the oxidative stress-induced apoptosis of C. albicans,¹⁶ we investigated the relationship between AITC and apoptosis. C. albicans cultured in media prepared with AITC at concentrations of 16 and 32 μg/mL was used to extract mRNA (using the same method as above). After constructing cDNA, the gene expression level of CaMCA1, which is involved in apoptosis, was analyzed by real-time PCR.

Statistical analyses

Statistical significance of differences between samples was determined by one-way ANOVA with Scheffe’s test. A significance level of 95% or 99% (P < 0.05 or 0.01) was considered statistically significant.

Ethics statement

N/A.

Funding and support

This study was financially supported by the Japan Society for the Promotion of Science Grants in Aid for Scientific Research (C) (grant numbers 21K10219 and 25K13294) and the Sato Fund from Nihon University School of Dentistry (2023-6, 2024-6, and 2025-6).

CRediT authorship contribution statement

Hideki Nishiura: Writing – review & editing, Writing – original draft, Visualization, Software, Methodology, Investigation, Formal analysis, Data curation. Muneaki Tamura: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Data curation, Conceptualization. Rieko Matsuike: Visualization, Validation, Methodology, Investigation. Marni C. Cueno: Writing – review & editing, Writing – original draft, Methodology, Conceptualization. Tomoka Ito: Visualization, Validation, Methodology, Investigation. Yasuhiro Namura: Validation, Supervision, Formal analysis, Conceptualization. Toshimitsu Iinuma: Writing – original draft, Supervision, Conceptualization. Kenichi Imai: Writing – original draft, Supervision, Conceptualization.

Declaration of Competing Interest

The authors declare the following financial interests/personal relationships, which may be considered as potential competing interests. Muneaki Tamura reports financial support was provided by the Japan Society for the Promotion of Science. Muneaki Tamura reports a relationship with the Japan Society for the Promotion of Science that includes: funding grants. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

Data will be made available on request.