The authors report that blocking interactions between Leukocyte Ig-like receptors (LILRs), which are expressed on human NK and myeloid cells, and HLA using a monoclonal antibody to HLA induces NK- and myeloid-cell activation and antitumor immunity.
Abstract
Immune checkpoint blockade for the treatment of malignancies has been focused on reversing inhibitory pathways in T lymphocytes. NK cells are a potent innate defense against tumors and virally infected cells, but their therapeutic manipulation for anticancer immunity has been inadequately explored. Considerable attention has been focused on approaches to blocking inhibitory receptors on NK and myeloid cells. Most effort has been directed to the killer immunoglobulin-like receptors and CD94/NKG2A on NK cells. Another set of receptors with similar function in both NK cells and myeloid cells is the leukocyte immunoglobulin-like receptors (LILR) that interact with a wide variety of HLA molecules. Using pan–anti-HLA mAbs that recognize a conserved epitopic region on HLA also seen by LILRs, we investigated their functional effects in several models of tumor immunity. The pan–anti-HLA mAbs blocked the binding of most LILRs and did not block killer cell immunoglobulin-like receptors or CD94/NKG2A/C or T-cell receptor recognition. They also activated dysfunctional NK cells explanted from a variety of human cancers and resulted in enhancement of tumor immunity in humanized mice. The mAbs also exert direct antitumor effects. These results suggest that activation of innate immunity via disruption of HLA/LILR interactions is a potent approach for control of both primary tumors and potentially tumor metastases.
Introduction
NK cell–mediated innate immunity has evolved as a rapid, first line of defense against multiple pathogens and tumors (1–4). NK cells recognize classic MHC-I (HLA-A, -B, and -C in humans or H2-K, -D, and -L in mice) via differentially expressed inhibitory and activating receptors such as members of KIR (CD158) and leukocyte immunoglobulin like receptor (LILR; CD85), or of the murine Ly49, families (5, 6). A dynamic balance of inhibitory and stimulatory signals thus maintains immune homeostasis and regulates NK cell activation. Although both KIR and LILR have both activating and inhibitory allelomorphs, the inhibitory forms consistently dominate the resting, homeostatic situation. Complete loss of self–MHC-I expression on tumor cells (“missing self”) abrogates KIR/LILR- or Ly49-dependent inhibition, resulting in immediate NK cell activation and lysis of tumor cell (7). Structural studies have demonstrated that the murine Ly49 molecules interact with amino acid residues of the membrane proximal (α2 and α3) domains of the H2 heavy chain as well as with the β2-microglobulin (β2m) light chain but do not interfere with the T-cell receptor (TCR)-binding site (8). We previously demonstrated that global inhibition of Ly49/MHC-I interactions by administration of a pan–anti-MHC-I mAb, M1/42, to unmanipulated mice resulted in marked activation and proliferation of NK cells, myeloid cells, and T cells (9).
The dramatic in vivo effects of blocking H2/Ly49 interactions raised the possibility of translating these findings to humans by blocking HLA/KIR or HLA/LILR interactions. Crystal structures of HLA/KIR complexes reveal that the binding sites of human KIR on HLA antigens overlap with the TCR-binding site and would therefore likely inhibit CD8+ T-cell activation and suppress the adaptive immune response (10). In contrast, as illustrated by crystal structures of HLA-A2/LILRB1, -HLA-F/LILRB1, and -HLA-G/LILRB1/LILRB2 complexes (11–14), the LILRs interact with conserved regions of the MHC-I membrane proximal α3 domain and the nonpolymorphic β2m subunit and are therefore unlikely to interfere directly with T-cell recognition which is focused on the α1 and α2 helices and the bound peptide. Finally, unlike KIRs which exclusively interact with HLA, LILRs can bind to non-HLA ligands, offering additional possibilities for therapeutic manipulation (15).
The strong similarity between the binding interactions of H2/Ly49 and HLA/LILR raised the possibility that a pan–anti-HLA mAb having reactivity similar to the anti-mouse H2 mAb M1/42 would block the binding of the LILRBs to HLA, fail to block both the KIR- and TCR-binding sites on HLA, and result in activation of both the human innate and adaptive immune responses. In this report, we demonstrated that two previously well-characterized anti–pan-HLA mAbs, W6/32 (16) and DX17 (17), met all three criteria. Crystallographic analysis as well as binding and functional studies with human peripheral blood mononuclear cells (hPBMC) demonstrated that both DX17 Fab and W6/32 Fab blocked the interaction of multiple LILR multimers with HLA and resulted in enhanced NK cell proliferation and cytokine release. Blockade of HLA/LILR interaction in an ex vivo perfusion system and in humanized mouse tumor models revealed potent antitumor immunity. Overall, these results demonstrate that HLA/LILR interactions represent both an important pathway regulating innate immune system homeostasis and a potential target for checkpoint inhibition for the treatment of cancers in humans.
Materials and Methods
Mice
NOD/SCID gamma (NSG) and NSG mice expressing transgenic human IL-15 (NSG-IL-15) mice were purchased from Taconic Biosciences or The Jackson Laboratory (Taconic Biosciences, cat. # 13683; The Jackson Laboratory, cat. #030890) and housed under specific pathogen-free conditions. All mice were sex- and age-matched and used between 8 and 12 weeks of age. All animal protocols used in this study were approved by the National Institute of Allergy and Infectious Diseases Animal Care and Use Committee (protocol # LISB 15E).
Cell lines
All cell lines were maintained in RPMI supplemented with 10% FCS, 2 mmol/L L-glutamine, 1X NEAA, 10 mmol/L HEPES pH 7.2, 100 U/mL penicillin, 100 μg/mL streptomycin, and 50 μg/mL gentamicin in a humidified incubator at 37°C and 5% CO2. The HeLa cell line was obtained from the ATCC (CCL-2), the human pancreatic cell line KLM-1 was kindly provided by Dr. Serguei Kozlov (NCI), Jurkat cells expressing the T4H2 TCR specific for a gp100-derived peptide presented by HLA-A2 was a kind gift from Dr. Brian Baker (University of Notre Dame), and DX17 hybridoma was a kind gift from Dr. Lewis Lanier (University of California, San Francisco).
Isolation of hPBMCs from healthy individuals and patients with cancer
Human peripheral blood was collected from 20 healthy volunteers from the NIH Blood Bank or 25 patients with cancer (adenoid cystic–2, cholangiocarcinoma–4, colorectal–4, gastric–1, gastrointestinal stromal tumors–4, mesothelioma–2, neuroendocrine pancreatic–5, ovarian–1, small bowel adenocarcinoma–1, and metastatic melanoma–1) from the NCI Center for Cancer Research. hPBMCs were centrifuged at 2,000 rpm for 15 minutes (acceleration-1, deceleration-1) over Ficoll-Hypaque to obtain total leukocytes. After removing red blood cells (RBC) by ACK lysis buffer, a single-cell suspension of leukocyte buffy coat layers was washed with FACS buffer, and live cells were counted using a hemocytometer and trypan blue exclusion staining. Written informed consent according to the US Common Rule was obtained as detailed by the Institutional Review Board of the NIH (#NCT-01915225).
Tumor-infiltrating lymphocyte isolation
Tumor-infiltrating lymphocytes (TIL) were obtained from 25 patients with cancer (adenocystic–2, cholangiocarcinoma–4, colorectal–5, gastric–1, gastrointestinal stromal tumors–4, mesothelioma–2, neuroendocrine pancreatic–5, ovarian–1, and small bowel adenocarcinoma–1) undergoing surgical resection after written informed consent at the NCI Clinical Center according to the US Common Rule under protocol #13C0176, approved by the Institutional Review Board of the NIH. Freshly harvested tumor biopsy samples obtained from the operating room ranging from 1 to 2 cm thickness and 1 to 2 cm diameter were used. Necrotic tumor lesions were excluded from these samples and then dissected into small pieces in complete RPMI medium (10 mL) and placed in Gentle MACS C-tubes. The tubes were then subjected to program 37C_H_TDK_1X3 on the Gentle MACS Octo Dissociator (Miltenyi Biotec). RBCs from the dissociated tissues were ACK-lysed. A single-cell suspension was obtained by passing the cells twice through a 70 mm pore size strainer (BD Falcon) and finally washed with FACS staining buffer (PBS containing 10% FBS).
hPBMCs culture with Fab or Fc-silenced anti–pan-MHC-I antibodies
hPBMCs from healthy individuals or patients with cancer were suspended in RPMI-1640 complete medium supplemented with 10% FBS, 2 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, 1 mmol/L HEPES, 0.1 mmol/L nonessential amino acids, 50 mmol/L 2-mercaptoethanol, and 100 U/mL penicillin and streptomycin. Ten μg of DX17, W6/32 Fab, DX17LALAPG, or negative control hIgG1LALAPG was added to 0.5 × 106 mononuclear cells in 500 μL medium in 48-well plates (Falcon) and incubated for 48 to 96 hours.
Flow cytometry
hPBMCs from healthy donors or patients with cancer and their corresponding TILs (n = 25) were suspended in complete RPMI-1640 medium. For surface staining, the cells were initially blocked using FCX TruStain (BioLegend) for 5 minutes, followed by staining with the surface conjugate for 30 minutes in FACS staining medium (PBS, 10% heat-inactivated FBS, and 0.05% sodium azide). Intracellular Ki-67 staining was done by fixing and permeabilizing the surface-stained cells with Foxp3 staining buffer set (Thermo Fisher Scientific) as per the manufacturer’s guidelines and then staining with anti–Ki-67. To perform intracellular IFNγ staining, PBMCs in complete medium were stimulated with a cocktail of cell stimulation and protein transport inhibitors (Thermo Fisher Scientific) containing phorbol 12-myristate 13-acetate, ionomycin, brefeldin A, and monensin for 3 to 4 hours at 37°C. Cells were washed, fixed, permeabilized, and stained with anti-IFNγ (BD Biosciences) for 1 hour at 4°C. Finally, the cells were washed and analyzed using BD LSR Fortessa X-20 cell analyzer and BD FACSDiva Software (version 8.0.), and data were further analyzed by FlowJo version 10 (Tree Star).
CellTrace Violet proliferation assay
hPBMCs were stained with CellTrace violet according to the manufacturer’s instruction (Thermo Fisher Scientific) and cultured (0.5 × 106 cells in 500 μL complete RPMI medium) for 48 hours with 10 μg hIgG1LALAPG or DX17LALAPG mAb. After 48 hours, CellTrace Violet dilution was determined on live CD3−CD16+ NK cell by flow cytometry using BD Fortessa and analyzed by Flowjo version 10 (Tree Star).
HLA-A2 GP100 tetramer staining
HLA-A2+T4H2 Jurkat cells (0.1 × 106 cells) were incubated with 10 μg of anti-HLA–specific Fab, F(ab’)2, or mAb (DX17 or W6/32) at 4°C. After 10 minutes, PE-labeled HLA-A2 GP100 or TAX tetramer (5 μg/sample) as a negative control was added to the antibody-conjugated single-cell suspension and incubated for another 20 minutes. After 30 minutes of total incubation time, the cells were washed with FACS staining buffer and analyzed using the BD LSR Fortessa X-20 cell analyzer and BD FACS Diva software version 8.0.
LILR-Fc, KIR-Fc, CD94/NKG2A-Fc, and CD94/NKG2C-Fc protein staining
hPBMCs (0.1 × 106) or single HLA-transfected cell lines were incubated with specific anti-HLA mAbs (10 μg/mL per sample) at 4°C. After 10 minutes, a multimeric staining reagent consisting of streptavidin-conjugated biotinylated Fc-dimers specific to LILR, KIR, CD94/NKG2A, and CD94/NKG2C (5 μg/sample; MedChemExpress, R&D systems, and Acro Biosystems) was added to the single-cell suspension that had been conjugated with the respective antibody. The cells were then incubated for an additional 20 minutes. After a total incubation time of 30 minutes, the cells were washed with FACS staining buffer and analyzed using the BD LSR Fortessa X-20 cell analyzer and BD FACS Diva software version 8.0.
Antibodies
The VH and VL sequences (sequence available in PDB 8TQ5) encoding the DX17 antibody were identified by RT-PCR and sequencing (Creative Biolabs). The H and L DNA sequences were optimized for human codon usage and subcloned into the EcoRI/BamHI sites of pCDNA3.1 (−) for secreted expression. DNA encoding the mouse Fc segment of the DX17 H chain was replaced with human IgG1 Fc by subcloning the VH gene into pFUSE-CHIg-hG1 (Invivogen). This is designated DX17-huIgG1. To abolish FcgR binding, the mutations L234A, L235A, and P329G were introduced in the H chain constant region (18) by site-directed mutagenesis using the QuikChange Lightning Multi Site-Directed Kit (Agilent) following the manufacturer’s instructions. This Fc-silenced antibody is designated DX17LALAPG. For preparation of Fab fragments, a 6X HIS tag followed by a stop codon was inserted after the second cysteine in the IgG1 hinge region using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All DNA constructs were verified by sequencing.
Plasmids encoding the DX17 H and L chains were mixed together at a 1:2 ratio, respectively, and transfected into Expi293F cells with ExpiFectamine following the manufacturer’s instructions (Thermo Fisher Scientific, Gibco). The culture medium was harvested 6 days later and purified either by affinity chromatography on Protein A Sepharose (Cytiva) for the full antibody or by metal-affinity chromatography on a TALON column (Takara) for Fab, followed by size-exclusion chromatography on a Superdex 200 Increase column (Cytiva).
Purified W6/32 was purchased from Bio X Cell (#BE0079). W6/32 Fab was prepared by adding 100 mg of W6/32 (Bio X Cell) in a volume of 9 to 1 mL of washed immobilized papain agarose beads (Thermo Fisher Scientific) in PBS pH 7.2 containing 20 mmol/L cysteine and 10 mmol/L EDTA. The mixture was incubated at 37°C for 5 hours in an Eppendorf ThermoMixer. The digest was dialyzed against 1 L of PBS overnight and passed through a 10 mL bed volume Protein G (Cytiva) column to remove undigested antibody. The flow through was concentrated and purified by size-exclusion chromatography on a Superdex 75 HiLoad 16/600 column in PBS. Fab and F(ab’)2 preparations of DX17 were prepared using Pierce Mouse IgG1 Fab and F(ab’)2 Preparation Kit according to the manufacturer’s instructions. We did not measure endotoxin in studies using the Fab fragments of the antibodies. All studies with the DX17LALAPG reagent were performed with an endotoxin-low (<2 EU/mg of protein) preparation of the mAb prepared by Bio X Cell.
Single MHC-I–expressing HeLa transfectants
HeLa cells were grown in RPMI supplemented with 10% FCS, 2 mmol/L L-glutamine, 1X NEAA, 10 mmol/L HEPES pH 7.2, and 50 μg/mL gentamicin. Plasmid encoding full-length HLA-A02:01 was obtained from GeneCopoeia (cat. # EX-Z5803-M02-10) and inserted into the Sleeping Beauty vector pSBi-Pur (Addgene plasmid 60523 deposited by Eric Kowarz) by InFusion cloning (Takara) at the SfiI site downstream of the EF-1-α promoter. To express other HLA allelomorphs, the extracellular domain of HLA-A02:01 from Gly1 – Trp274 (numbering is of the mature protein and excludes the first 24 residues which are from the signal peptide) was replaced with the corresponding extracellular domains of HLA-B44:05 (sequence as in PDB 1SYV), HLA-C03:04 (IMGT/HLA accession number HLA00413, gift of John Altman, NIAID Tetramer Facility), HLA-E (IMGT/HLA accession number HLA00934, synthesized by GenScript), and HLA-G (IMGT/HLA accession number HLA00939, synthesized by GenScript) by InFusion cloning (Takara). The MHC-I–deficient HeLa cell line was generated using the Alt-R CRISPR-Cas9 system (Integrated DNA Technologies) following the manufacturer’s instructions. Two predesigned guide RNAs (gRNA) from Integrated DNA Technologies were used to target each HLA-A, HLA-B, and HLA-C loci for a total of six gRNAs in the transfection mix. The sequences of the six gRNAs are as follows: for HLA-A, gRNA1: CGTAGCCCACGGCGATGAAG, gRNA2: GATAATGTATGGCTGCGACG; for HLA-B, gRNA1: CGCTGTCGAACCTCACGAAC, gRNA2: CATGACCAGTACGCCTACGA; for HLA-C, gRNA1: TATGACCAGTCCGCCTACGA, gRNA2: GATCACCCAGCGCAAGTTGG. One week following transfection, cells were stained with W6/32 to confirm the presence of a W6/32-negative population. The culture was expanded, and cells negative for W6/32 staining were FACS-sorted and subsequently expanded. One μg of HLA-A2, B4405, E, and G cloned into the Sleeping Beauty plasmid as described above was cotransfected with 100 ng of the pSB100X plasmid encoding the Sleeping Beauty transposase (Addgene 34789, deposited by Izsvak Zsuzsanna) in 50% confluent cultures in a 6-well plate. Forty-eight hours after transfection, the cells were transferred to medium containing 10 μg/mL puromycin. Five days later, cells were stained with W6/32 or allelomorph-specific antibodies to confirm expression. W6/32-positive cells were then FACS-sorted.
Recombinant soluble MHC-I engineering
Bacterial expression, denaturation, refolding, and purification of MHC-I were carried out essentially as described earlier (19). Briefly, HLA-A2:01 and HLA-B44:05 heavy chains and human β2m were separately expressed in Escherichia coli as insoluble inclusion bodies following IPTG induction and dissolved in 6 mol/L guanidine-HCl (EMD Millipore #369080-1KG), 100 mmol/L TRIS pH8, 2 mmol/L EDTA, and 0.1 mmol/L DTT. HLA heavy chain and β2m were renatured at 1:4 mol/L ratio in refolding buffer containing 0.4 mol/L arginine-HCl (Sigma-Aldrich #A5131-1KG), 5 mmol/L reduced glutathione (Sigma-Aldrich #G4251-100G), 0.5 mmol/L oxidized glutathione (Sigma-Aldrich #G4376-100G), and 10-fold molar excess of the influenza peptide GILGFVFTL for HLA-A2 or the HLA-DPα–derived self-peptide EEFGRAFSF for HLA-B44:05 (peptides were syntheized by Biopeptek). Following incubation for 4 days at 4°C, the refolding mixture was dialyzed against 25 mmol/L TRIS pH 8, 150 mmol/L NaCl (TBS), concentrated, and purified by size-exclusion chromatography on Superdex 200 (Cytiva) and ion-exchange chromatography on mono Q (Cytiva).
Surface plasmon resonance
Surface plasmon resonance experiments were carried out on a BiaCore T200 (Cytiva) at 25°C in 10 mmol/L TRIS pH 7.4, 150 mmol/L NaCl, 3 mmol/L EDTA, and 0.05% surfactant P20 at a flowrate of 30 mL/minute. DX17-huIgG1 and DX17LALAPG were covalently coupled to the surface of a CM5 chip to 600 RU. Graded concentrations of MHC-I ranging from 31.2 nmol/L to 1 mmol/L were sequentially injected over the antibody surfaces interspersed with a regeneration cycle with 0.1 mol/L glycine pH 2.3 between each concentration. Binding experiments were repeated three times. Sensorgrams were globally fit to a 1:1 binding model with BiaCore T200 Evaluation Software 3.1 and plotted with Prism (GraphPad Software).
Crystallization of the DX17/B*44:05 complex, data collection, and refinement
Purified HLA B*44:05 and DX17 Fab were mixed together at a 1:1.5 mol/L ratio at a final protein concentration of 10 mg/mL and incubated on ice for 2 hours. Crystallization conditions were identified by screening hanging drops at 18°C. Crystals of DX17/HLA B*44:05 were grown in 12% PEG 20000, 0.1 mol/L MES pH 6.5, cryoprotected in mother liquor containing 10% ethylene glycol, and flash-frozen in liquid nitrogen. Diffraction data were collected at wavelength 1.033 Å at Southeast Regional Collaborative Access Team beamline 22ID at the Advanced Photon Source, Argonne National Laboratory. The data were processed with XDS to 2.3 Å resolution (see Supplementary Table S1). The structure was solved by molecular replacement with Phaser using HLA B*44:05-T73C (7TUC) as a search model. For the DX17 Fab search, we used a modified model of 4M7J (both heavy and light chains) with the CDR loops omitted as the initial search model. Molecular replacement solutions were readily found and were subjected to several rounds of refinement with Phenix interspersed with manual building in Coot. Rwork/Rfree (%) values for final refined model of DX17/HLA B*44:05 are 19.4/23.6, respectively. Data collection and refinement statistics are summarized in Supplementary Table S1. The structure is deposited in the PDB as 8TQ5.
Structure analysis
The surface area of the interaction between MHC-I and antibody was calculated with AreaImol (as implemented in the CCP4 program suite, with the option “area differences due to ligand/subunit,” specifying either the whole antibody or individual H and L chains as ligands). The interface residues were identified using NCONT, with a 4 Å cutoff distance, as implemented in the CCP4 program suite (Supplementary Table S2). All structure figures were constructed in ChimeraX.
Ex vivo perfusion system
For ex vivo perfusion studies, only small tumor lesions ranging between 1 and 2 mm in thickness and 2 to 5 mm in diameter were used. The tumor cores from large tumor lesions tend to be necrotic and, therefore, were excluded from the perfusion assay systems. TILs of six different patients with cancer (gastric cancer, colorectal cancer, mesothelial cancer, ovarian cancer, and small bowel adenocarcinoma) were analyzed independently by flow cytometry after hIgG1LALAPG and DX17LALAPG mAb incubations for 48 hours in ex vivo perfusion systems.
Tumor tissue from eligible patients was procured directly from the operating room at the beginning of each operation. Tumor-bearing mesothelium or core needle biopsies were mounted loosely on the platform and secured in place with a silk suture. The tumor-bearing platforms were then immediately transferred into the perfusion system within a sterile incubator (Thermo Heracell VIOS 160i CO2 incubator) at 37°C and 5% CO2 for the duration of experimentation. The duration of the tissue preparation on to the platform was limited to an average of 5 minutes.
The perfusion system consisted of a chamber connected to an oxygenator (PermSelect silicone hollow fiber membrane module with 1,000 cm2 surface area) and a peristaltic pump (Ismatec ISM828 Reglo Analog Variable Speed Pump) using laboratory grade tubing (Ismatec Tygon LMT-55). The platform was 3D-printed with autoclavable photopolymer resin (Formlabs Form 2, Dental LT Clear Resin). The Platform consisted of two rings (base and tissue-mount) connected with two posts. The base ring had a diameter of 18.6 mm and was designed to fit snuggly into holes of the chamber lid in order to suspend the tissue in the perfusate. The tissue-mount ring was a smaller ring of 9.56 mm with a 0.5 mm indentation for suture fixation. The two rings were connected with two 16.75-mm posts containing four 1-mm holes to permit perfusate circulation. The chamber consisted of a 3D-printed 60-mm dish and lid from autoclavable photopolymer resin (Formlabs Form 2, Dental LT Clear Resin). The lid was constructed with four 14-mm apertures to suspend the perfusion platforms. The chamber was designed with inflow and outflow ports positioned opposite of each other, at offset heights of 5 and 2 mm from the base of the dish, respectively. The system was optimized before introduction of the tissue with autologous plasma perfusate allowed to equilibrate to 37°C with optimal gas dissolved using humidified 93% O2:7% CO2 at 0.5 to 1.5 L/minute. Physiologic parameters (pH, sodium, etc.) were maintained using point-of-care instruments. To compensate for evaporative losses over time, continuous introduction of sterile water and insulin was infused at a rate of 0.25 to 0.75 mL/hour using a metered syringe injector. Experimental drugs were introduced into the perfusate as indicated.
Single-cell RNA sequencing
Colorectal cancer patient-derived TILs isolated from the ex vivo perfusion system for 48 hours were enriched for CD45+ using REAlease CD45 (TIL) MicroBead Kit according to the manufacturer’s protocol (Miltenyi Biotec). After removing dead cells using the Dead Cells Removal Kit (Miltenyi), the CD45+ TILs were treated with oligonucleotide-tagged antibodies for cellular indexing of transcriptomes and epitopes by sequencing using Universal Total Cell Sequencing Kit according to the manufacturer’s protocol. CD45+ TILs were Fc-blocked (Human TruStain FcX, BioLegend) and labeled with oligonucleotide-tagged antibodies for cellular indexing of transcriptomes and epitopes by sequencing with TotalSeq-B Human Universal Cocktail B, version 1.0.
Library preparation was performed using the Chromium NextGEM Single Cell 3′ Reagent Kit version 3.1 (Dual Index) with Feature Barcode technology for Cell Surface Protein (10x Genomics) according to the manufacturer’s instructions. Briefly, antibody-labeled cells were resuspended in a Master Mix and loaded onto a microfluidics chip together with partitioning oil and barcoded gel beads to generate the gel bead-in-emulsion (GEM). The 10x Genomics Chromium pressurized the chip compartments to deliver cells and gel beads into a common microfluidics channel at a controlled rate, in which they were isolated into emulsion droplets by oil such that only one cell and only one unique barcoded gel bead were isolated together in each oil droplet, called a GEM. The poly-A RNA from the cell lysate contained in every single GEM was retrotranscribed to cDNA, which contains an Ilumina R1 primer sequence, unique molecular identifier (UMI), and the 10x Genomics barcode. The pooled barcoded cDNA was then cleaned up with Silane DynaBeads, amplified by PCR, and the appropriate sized fragments were selected with SPRI select reagent for subsequent library construction. The high–molecular weight fraction containing the cDNA derived from polyadenylated mRNA was used for 3′ Gene expression library preparation, whereas the low–molecular weight fraction containing DNA derived from cell-surface protein Feature Barcode was used for preparation of cell-surface protein libraries. During the library construction, Ilumina R2 primer sequence, paired-end constructs with P5 and P7 sequences, and a sample index were added. Final libraries were then sequenced on an Illumina NextSeq 2000 Sequencing System using two NextSeq 2000 P3 Reagent kits (100 cycles; Illumina) with the following cycles of sequencing chemistry: read 1 = 28 cycles, index 1 = 10 cycles, index 2 = 10 cycles, and read 2 = 90 cycles.
Single-cell RNA sequencing data analysis
The fastq files underwent 10x Genomics Cell Ranger count (version 7.1.0) for gene expression, and antibody-derived tag transcript counts per cell. Seurat (version 4.3.0) was used to analyze the raw counts from Cell Ranger. In the hIgG1LALAPG TIL sample, cells with the number of features below 500 or above 6,000 or with more than 38,000 UMIs were filtered out. Similarly, in the DX17LALAPG TIL sample, cells with the number of features below 500 or above 7,500 features or with more than 50,000 UMIs were removed. In both samples, cells that had a mitochondrial gene expression of greater than 10% were filtered out. The typical Seurat workflow with default parameters (unless otherwise specified) was then applied to all samples, including NormalizeData, FindVariableFeatures, ScaleData using all features, RunPCA, RunUMAP [using principal component analysis (PCA) dimensions 1–30], FindNeighbors (using PCA dimensions 1–30), and FindClusters (using resolution 0.1). Doublets were identified and removed using the scDblFinder (version 1.14) R package. All objects were integrated using the Seurat integration methods with default parameters, including SelectIntegrationFeatures, FindIntegrationAnchors, and IntegrateData.
The integrated object was then processed through NormalizeData, FindVariableFeatures, ScaleData, RunPCA, RunUMAP (using PCA dimensions 1–30), FindNeighbors (using PCA dimensions 1–30), and FindClusters (using resolution 0.1); default parameters were used unless specified. The SingleR (version 2.2.0) R package was used for cell typing, and the Novershtern reference dataset was accessed from the celldex (version 1.10) R package. Differential expression was done after subsetting the integrated object to only hIgG1LALAPG TIL and DX17LALAPG TIL samples. Differential expression in TILs was done on immune cell types, including monocytes, NK cells, memory CD4+ T cells, and memory CD8+ T cells, comparing DX17LALAPG with hIgG1LALAPG cells in gene expressions. The Seurat implementation of Wilcoxon rank-sum test was used for differential expression. Mitochondrial, ribosomal, and mitochondrial ribosomal genes were filtered from the differential expression results. Single-cell RNA-sequencing data have been uploaded to the Gene Expression Omnibus database (accession ID GSE262381).
Lymphocyte isolation
Spleen, liver, and lungs were harvested from NSG or NSG-IL-15 transgenic mice and homogenized the tissues using cell strainer (70 μm, BD Falcon, USA). After homogenization, liver and lung lymphocytes were isolated by 32% Percoll-mediated centrifugation. RBCs were lysed using sterile ACK lysing buffer [NH4Cl (0.15 mol/L), KHCO3 (10 mmol/L), and Na2EDTA (0.1 mmol/L), pH7.3]. by removal of RBCs, and then lymphocytes were washed, suspended in sterile complete medium [RPMI medium supplemented with 10% heat-inactivated FBS, L-glutamine (2 mmol/L), sodium pyruvate (1 mmol/L), HEPES (1 mmol/L), nonessential amino acids (0.1 mmol/L), 2-mercaptoethanol (50 μmol/L), and penicillin and streptomycin (100 U/mL)].
Humanized mouse tumor model
KLM-1 cancer cells were grown in DMEM medium supplemented with 10% heat-inactivated FBS, L-glutamine (2 mmol/L), sodium pyruvate (1 mmol/L), HEPES (10 mmol/L), nonessential amino acids (0.1 mmol/L), 2-mercaptoethanol (50 μmol/L), and penicillin and streptomycin (100 U/mL). Sex- and age-matched hIL-15 transgenic mice were injected subcutaneously (right flank region) with 1.5 × 105 KLM-1 cells suspended in 100 mL of sterile PBS. After 12 to 14 days of tumor cell engraftment, 10 × 106 CD3− hPBMCs, isolated from healthy individuals by negative selection on magnetic beads (Miltenyi Biotec), were retro-orbitally injected into the tumor-bearing mice. Isotype control and Fab or Fc-silenced anti–pan-HLA (W6/32 and DX17) mAb were administered retro-orbitally (intravenously) or intraperitonially twice a week for 2 weeks. Tumor size was measured in three dimensions regularly using digital calipers, and tumor volumes were calculated by multiplying length × width × depth. On day 30 after tumor implant, tumors were excised under sterile conditions, and TILs were prepared after mincing the tumor into tiny pieces and further dissociated by Gentle MACS tissue Dissociator (Program:m_impTumor_03).The dissociated tissue was passed through a 70-mm strainer (BD Falcon) and then treated with ACK lysing buffer to lyse RBC. The single-cell suspension of TILs was washed with FACS staining buffer and purified by 30% Percoll density gradient centrifugation.
Ingenuity Pathway Analysis
Differentially expressed genes of NK cells, monocytes, and memory CD8 harvested from ex vivo perfusion systems derived TILs were imported into the Ingenuity Pathway Analysis software (Ingenuity Systems; Qiagen and colleagues, www.ingenuity.com/) for functional canonical pathway and upstream regulatory analysis. The canonical pathway was adjusted using Fisher exact t test with a default P value of > 0.05 or a threshold of −log (P value) > 1.3 for significance. A threshold of −log (P value) > 2 was used for canonical pathway, and a Z-score >2 was defined as the threshold of significant activation. Conversely, the threshold of significant inhibition was defined as a Z-score <−2. The canonical pathways generated from differentially expressed genes of immune cell subsets were sorted by positive (orange) to negative (blue) Z-scores.
Statistical analysis
Statistical comparisons between groups were analyzed using a two-tailed unpaired t test or one-way ANOVA with Prism 10 (GraphPad Software). A P value of less than 0.05 was considered statistically significant.
Results
HLA interactions with LILR but not with KIR, CD94/NKG2A/C, and TCR are blocked by DX17 and W6/32 mAbs
We focused our investigations on two pan–anti-human mAbs, DX17 and W6/32 (20, 21). Reasoning that their broad reactivity is due to recognition of the most conserved features of HLA molecules, i.e., the β2m and α3 domains, we asked which HLA-reactive innate immune receptors recognize β2m and α3 and are thus likely to be blocked by DX17 and W6/32. The LILR family of receptors satisfied these criteria (6). We examined the ability of DX17 and W6/32 to block the binding of recombinant LILR-Fc multimers to cell-surface HLA on monocytes. (The gating strategies for lymphocytes and monocytes of healthy hPBMCs are shown in Supplementary Fig. S1A and S1B). DX17 and W6/32 inhibited binding of all LILRAs and LILRBs, except LILRB4, to cell-surface HLA (Fig. 1A). LILRA4 was not tested. To further confirm the staining and blocking results, we used HeLa cell lines expressing single HLA alleles, designated HLA*A2:01 (designated A02:01), B44:05, C03:04, E01:01, and G01:01, and examined the binding of LILRB1 and LILRB2. LILRB1 (Supplementary Fig. S2A) and LILRB2 (Supplementary Fig. S2B) bound to the single MHC-I transfectants, and their binding was blocked by DX17 but not by the B1.23.2 mAb which recognizes an epitope distinct from that of DX17 and W6/32 on HLA-B/C (20, 21). Binding of LILRB1 or LILRB2 to the E01:01 transfectant could not be detected (Supplementary Fig. S2C). DX17 and W6/32 cross-block each other completely, but they do not block another anti-HLA*A02 mAb, BB7.2 (Supplementary Fig. S2D).
Figure 1.
DX17 and W6/32 block binding of LILRs, but not KIRs, CD94/NKG2A/C and TCR, to MHC-I. A, Staining of monocytes by individual biotin-labeled LILR-Fc constructs after preincubation of the cells with the indicated anti-HLA antibodies. B, Staining of monocytes by individual biotin-labeled KIR2D-Fc constructs after preincubation of the cells with the indicated anti-HLA antibodies. C, Staining of PBMC monocytes by individual unlabeled KIR3DL1-Fc constructs after preincubation of the cells with the indicated anti-HLA antibodies. All samples were stained with anti–Fc-APC. D, Staining of PBMC monocytes or HLA-E01:01/HeLa by biotin-labeled CD94/NKG2A and CD94/NKG2C after preincubation of the cells with the indicated anti-HLA antibodies. E, Staining of T4H2 Jurkat cells with the PE-labeled gp100/HLA-A2 tetramer or negative control tetramer (anti-TAX) following preincubation of the cells with the indicated anti-HLA antibodies.
We then examined the ability of DX17 to block HLA binding of three inhibitory KIR2D isoforms and one KIR3D isoform on monocytes (Fig. 1B and C) and to the B44:05 and C03:04 transfectants. B1.23 blocked KIR binding (21), but DX17 did not inhibit KIR binding (Supplementary Fig. S2E and S2F). DX17 or B1.23.2 also failed to block the binding of CD94/NKG2A and CD94/NKG2C to their cognate ligand, HLA-E, on both monocytes and to the transfected E:01:01 line (Fig. 1D). Finally, we examined whether DX17 would block TCR recognition of cognate peptide/MHC-I complexes using a Jurkat line transfected with a TCR (T4H2) specific for a gp100 peptide presented by HLA-A2 (22). Staining of this Jurkat line by the HLA-A2gp100 tetramer was not blocked by DX17 and W6/32 (Fig. 1E). Blocking was observed with an HLA-A2–specific antibody, clone BB7.2 (23).
In contrast to Ly49 antigens in the mouse and KIRs in humans, LILRs have been reported to have a much broader tissue distribution (6). We performed a comprehensive study of the expression of LILRs on freshly isolated healthy hPBMCs (Supplementary Fig. S1C and S1D) using the indicted gating strategy (Supplementary Fig. S2A and S1B). Monocytes (CD3−CD14+) uniformly expressed all members of the family with the exception of LILRA4, which we did not detect with the available mAb. Varying percentages of B cells (CD3−CD19+) expressed LILRB1, B5, and A3. Among NK cells (CD16+CD56dim), ∼50% expressed LILRB1, whereas LILRA3 could be detected on ∼20% of NK cells. Approximately 25% of CD8+ T cells express LILRB1 with little or no expression of the other LILRs. Thus, monocytes express the full array of LILRB and LILRA molecules, whereas T cells, NK cells, and B cells reflect varied surface display.
Structural basis for the pan–anti-MHC-I reactivity and blocking of LILRs by DX17 and W6/32
We investigated the binding of DX17 and W6/32 to HLA by surface plasmon resonance and by X-ray crystallography. DX17 and W6/32 have similar binding kinetics and near identical contact surfaces on the HLA. Both antibodies bind to HLA with similar affinities (KD 30–50 nmol/L) and kinetic on and off rates (Fig. 2A and B). DX17 and W6/32 prefer both a human MHC-I heavy chain and human β2m for binding (Supplementary Fig. S3A and S3B), indicating that their epitopes encompass both subunits. Reduced binding of HLA molecules complexed with murine β2m was observed as was a detectable interaction with some mouse H2 molecules when complexed with human β2m (Supplementary Fig. S3A and S3B; ref. 24).
Figure 2.
Structure of the DX17/B44:05 complex. Kinetics and affinity of the interaction of HLA-A2:01 and HLA-B44:05 with the mAbs DX17 (A) and W6/32 (B) as measured by Surface plasmon resonance (SPR). The data are expressed as mean ± SD of three independent experiments. C, Overall structure of the DX17/B44:05 complex shown as a ribbon diagram. D, Footprint of DX17 on the B44:05 heavy chain. The heavy chain (purple) and β2m (yellow) are displayed as surfaces. Residues contacting the DX17 VH are shown in cyan, and those contacting the DX17 VL are shown in salmon color. Residues in white are contacted by both VH and VL of DX17. The contacting residues on B44:05 are indicated. E, Footprint of DX17 on the β2m subunit of B44:05, colored as in D. F, Structure based sequence alignment of the heavy chains of selected MHC-I molecules indicating residues that interact with DX17, W6/32 (from PDB 7T0L), LILRB1 (from PDB 1P7Q), and LILRB2 (from PDB 2DYP). The key to the symbols is shown adjacent to the figure. The MHC-I sequences are the extracellular regions of HLA-A2:01 (IMGT/HLA Accession HLA00006), HLA-B44:05 (IMGT/HLA Accession HLA00322), HLA-C05:01 (IMGT/HLA accession number HLA00427), HLA-E (IMGT/HLA accession number HLA00934), HLA-F (IMGT/HLA accession number HLA01096), HLA-G (IMGT/HLA accession number HLA00939), and H2-Dd (PDB ID 1DDH). G, Structure-based sequence alignment of the mature forms of human (UniProt P61769) and mouse β2m (UniProt P01887) with the interacting residues depicted as in E.
We determined the crystal structure of the DX17 Fab/B44:05 complex to 2.3 Å resolution and compared it with the crystal structure of the W6/32 Fab/B27:05 complex previously reported (PDB 7T0L; ref. 25). Data collection and refinement statistics are shown in Supplementary Table S1, and a list of intermolecular contacts in Supplementary Table S2. As seen in the overall structure of the complex (Fig. 2C), DX17 engages B44:05 beneath the peptide-binding platform and interacts with conserved residues on both the MHC heavy chain and β2m subunits. The interaction with DX17 buries an area of 1,159 Å2 on MHC-I, more than half of which, 635 Å2, is on the B44:05 heavy chain, and the remaining 524 Å2 on β2m. Contacts to the B44:05 heavy chain include residues Tyr85 and Gln87 in the α1 domain, Gly121-Asp123 and Ala136-Thr138 in the α2 domain, and residues Thr225-Glu233 in a strand of the α3 domain that includes the CD8-binding Thr225-Asp227 loop (Fig. 2D and E). Of the 17 contacts on the HLA heavy chain, 13 are conserved in HLA-A, -B, -C, -E, -F, and -G (Fig. 2F), explaining the broad reactivity of DX17 for both classic and nonclassic HLA molecules. DX17 contacts β2m amino terminal residues Ile1, Gln2, Arg3, Thr4, and Lys6 and residues Lys58 to Ser61 in a loop that abuts the floor of the MHC-I platform domain (Fig. 2D and E). The footprint of W6/32 on B27:05 is remarkably similar to that of DX17 on B44:05 (Supplementary Fig. S3C–S3E), although W6/32 buries a slightly larger area on MHC-I (1,363 vs. 1,159 Å2). W6/32 shares all contacts with DX17 on the HLA heavy chain with the addition of the conserved Asn86 in the α1 domain, the partially conserved Lys223, and the conserved Lys243 in the α3 domain (Fig. 2F). Similarly, W6/32 shares all contacts with DX17 on β2m, with additional contacts to Ser56 and Thr86 (Fig. 2G). Superposition of the DX17 and W6/32 MHC-I complexes demonstrates the strong similarities in their docking modes (Supplementary Fig. S3F).
The structures of DX17 and W6/32 complexes with MHC-I also provide insight into the steric clashes that prevent simultaneous engagement by both LILR and antibody. The footprint of LILRBs on HLA has been previously illuminated by the structures of the D1/D2 domains of LILRB1 in complex with HLA-A2 [1P7Q (10), 4NO0 (25), 6EWA, 6EWC, and 6EWO (26)] and HLA-F (5KNM; ref. 27) and of the D1to D4 domains of LILRB1 with HLA-G1 (6AEE; ref. 12). Similar to DX17 and W6/32, the LILRs focus primarily on the MHC α3 domain and β2m. However, because the LILRs approach MHC-I at a different angle than DX17 and W6/32, their interaction with α3 is directed toward the membrane proximal 193 to 200 loop, a site that is not seen by either DX17 or W6/32. Blocking of LILRs by DX17 and W6/32 is thus largely due to steric hindrance by their VH/VL focused on the amino-terminal residues 1 to 4 of β2m in which the footprints of LILRs and the antibodies coincide. Competition in favor of the antibodies is assured by their significantly higher affinities for MHC-I [KD 30–50 nmol/L, (Fig. 2A and B)] compared with LILR affinities for MHC-I which are only in the micromolar range (12).
mAb-mediated blocking of HLA/LILR interactions induces activation and proliferation of human NK cells in vitro
To determine whether inhibition of HLA/LILR interactions by DX17 and W6/32 leads to immune cell activation in vitro, we cultured PBMCs for 4 days in the presence of intact DX17, DX17 Fab, or W6/32 Fab. (The gating strategy on the 4-day cultures is shown in Supplementary Fig. S4A–S4E). Ninety to 95% of the cells were viable after 4 days of culture with or without antibody treatment. Inhibition of HLA/LILR interactions by DX17 Fab and W6/32 Fab resulted in enhancement of CD16 expression, whereas NKp46 receptor expression on NK cells (CD16+NKp46+) was maintained in the presence or absence of DX17 Fab and W6/32 Fab (Fig. 3A). DX17 Fab and W6/32 Fab also markedly enhanced NK cell proliferation as measured by increased Ki-67 staining (Fig. 3B) and activation as indicated by expression of IFNγ (Fig. 3C) and IL-15Rα (Fig. 3D). It is therefore possible that treatment with DX17 might induce a cytokine storm in vivo. No enhancement was seen with full-length DX17. KIR expression increased in the Fab-treated cultures (Fig. 3E and F). NK cells cultured in medium alone lost the expression of LILRB1 (Fig. 3E and F), whereas cells cultured with DX17 Fab or W6/32 Fab maintained the expression of LILRB1 at levels observed on freshly explanted NK cells (Supplementary Fig. S1). Monocytes did not proliferate under any conditions tested (Supplementary Fig. S5A), upregulated IL-15Rα expression on treatment with DX17 Fab or W6/32 Fab (Supplementary Fig. S5B), and maintained LILRB1 expression with or without the addition of the antibodies (Supplementary Fig. S5C). No proliferation of CD4+ or CD8+ T cells was observed during culture with DX17 Fab (Supplementary Fig. S5D and S5E).
Figure 3.
DX17 markedly activates NK cells and monocytes in the hPBMC. Representative flow cytometry analysis of the expression of NKp46 (A), Ki-67 (B), IFNγ (C), IL-15Rα (D), KIR2DL1/L2 (E and F), and LILRB1 (E and F) on CD16+CD56dim NK cells following incubation of healthy donor hPBMCs for 96 hours with the indicated antibodies. The measurement of Ki-67 and IL-15Rα expression are done in the absence of PMA/ionomycin, whereas IFNγ production requires treatment with PMA/ionomycin. The percentage of CD16+CD56dim, CD16+NKp46+ NK cells (G), and CD16−CD56+ and NKp46−LILRB1+ NK cells (H) in hPBMCs and TILs from patients with the indicated different types of cancer is shown. PMA, phorbol 12-myristate 13-acetate. I, Representative example of the expression of NKp46 on NK cells from PBMCs from a patient with metastatic melanoma cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. J, Summary of the percentage of NKp46+ NK cells from patients with five different cancers cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. K, Representative example of the expression of IL-15Rα on CD14+ monocytes from PBMCs from a patient with metastatic melanoma cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. L, Summary of the percentage of CD14+IL-15Rα+ monocytes from patients with five different cancers cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. M, Representative example of the expression of CD86 on CD14+ monocytes from PBMCs from a patient with colorectal cancer cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. N, Summary of the percentage of CD14+CD86+ monocytes from patients with three different cancers cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. O, Representative example of the expression of CD163 on CD14+ monocytes from PBMCs from a patient with colorectal cancer cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. P, Summary of the percentage of CD14+CD163+ monocytes from patients with three different cancers cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG.
It seemed likely that the failure of the intact DX17 mAb to induce NK cell proliferation (Fig. 3A) and IL-15Rα upregulation on NK cells (Fig. 3C) and monocytes (Supplementary Fig. S5B) was due to the interaction of the Fc region of the mAb with inhibitory Fc receptors on myeloid cells as these assays were performed with unseparated hPBMCs. In contrast to W6/32 Fab and DX17 Fab, both intact W6/32 and DX17 inhibited the binding of anti-CD16 to NK cells and anti-CD32 to monocytes (Supplementary Fig. S5F and S5G). To abrogate interactions with Fc receptors, we first mutated W6/32 and DX17 Fc residues Leu234 and Leu235 to alanine (W6/32LALA and DX17LALA) and also generated double mutants (Pro329Gly, W6/32LALAPG, and DX17LALAPG; ref. 26). Whereas W6/32LALA and DX17LALA partially blocked the binding of CD16 to NK cells and CD32 to monocytes, both W6/32LALAPG and DX17LALAPG did not inhibit anti-FcR binding. The DX17LALAPG mutation did not alter the binding properties of the mAb as DX17LALAPG cross-blocked the binding of W6/32 to lymphocytes (Supplementary Fig. S6A), displayed similar affinities for A02:01 and B44:05 as DX17 (Supplementary Fig. S6B and S6C), induced NK cell proliferation in 3-day PBMC cultures (Supplementary Fig. S6D and S6E), enhanced NK cell production of IFNγ, and enhanced expression of both LILRB1 and IL-15Rα (Supplementary Fig. S6F–S6H).
Inhibition of HLA/LILR interactions enhances expression of the natural cytotoxicity receptor NKp46 on NK cells and TILs from patients with multiple cancers
Human peripheral blood NK cells can be divided into two subsets based on the expression of CD16 and CD56 (27, 28). Mature KIR+ NK cells (80%–90%, CD16+CD56dim) play critical roles in tumor immunity, whereas the immature KIRdim/− NK cell subset (5%–15%, CD16−CD56bright) plays a role in immunoregulation. Both subsets express multiple natural cytotoxicity receptors (NCR), including NKp46, NKp30, NKG2D, and DNAM1, which recognize diverse stress-induced ligands or altered proteoglycans expressed on cancer cells (29, 30) Several studies have suggested that the number of NK cells in the peripheral blood of patients with malignancies is lower than normal and that their NK cells express fewer NCRs (30, 31). We therefore examined NK cell frequency and NCR expression on both the peripheral blood and TILs of patients with advanced cancers. We first excluded monocytes based on cell size and gated on CD3−CD19− lymphocytes (Supplementary Fig. S7) and quantitated the percentages of live CD16+CD56dim cells, CD16+CD56dimNKp46+cells, CD16−CD56+, and NKp46−LILRB1+ cells in freshly isolated PBMCs and corresponding tumor biopsy samples (Fig. 3G and H). In PBMCs, modest decreases were found in the percentages of CD16+CD56dim and CD16+CD56dimNKp46+ populations accompanied by modest increases in the CD16−CD56bright cells and NKp46−CD56brightLILRB1+ cells. Among TILs, CD16+CD56dim cells and CD16+CD56dimNKp46+ cells were almost undetectable, whereas CD16−CD56bright cells and NKp46−LILRB1+ cells were markedly increased (Fig. 3H).
We then explored the effects of DX17LALAPG on NKp46 expression by PBMCs in five patients with cancer. The gating strategies for lymphocytes and monocytes from a patient with metastatic melanoma cancer are shown in Supplementary Fig. S7. In contrast to the results obtained with healthy donor PBMCs in which NKp46 expression was maintained in control cultures (Fig. 3A), NKp46 expression was lost when PBMCs from patients with cancer were cultured in the absence of stimulation (Fig. 3I). Addition of DX17LALAPG treatment during the culture restored NKp46 expression on 95% to 99% of NK cells. Similar results were seen when we cultured hPBMCs from patients with other cancers in the presence of DX17LALAPG (Fig. 3J). DX17LALAPG also upregulated IL-15Rα and CD86 expression and downregulated CD163 expression on monocytes from patients with different cancers (Fig. 3K–P).
To determine whether DX17LALAPG was capable of activating lymphocytes within the tumor microenvironment (TME), we utilized an oxygenated ex vivo perfusion circuit (32) that maintains explanted tumors in near-physiologic conditions with the use of autologous patient plasma (Supplementary Fig. S8A). Fresh intact tumor tissue from a patient with advanced colorectal cancer was perfused with control hIgG1LALAPG or DX17LALAPG (5 μg/mL) for 48 hours. Following perfusion, the tumor explants were removed and dissociated into single-cell suspensions. To confirm that DX17LALAPG could penetrate the tumor sample, we stained the cell suspension with the cross-blocking W6/32 mAb. (Gating strategy is shown in Supplementary Fig. S9). Marked reduction of W6/32 staining was observed on NK cells (and T cells) derived from DX17LALAPG-treated tumors, indicating that the antibody had penetrated the intact tumor sample and bound to MHC-I (Supplementary Fig. S8B). Similar to what was observed in PBMC cultures from patients with cancer, DX17LALAPG markedly upregulated NKp46 expression on NK cells, upregulated IL-15Rα and CD86 expression, and downregulated CD163 expression on monocytes derived from the explanted tumor tissue from five different patients with advanced cancer (Fig. 4A–H).
Figure 4.
DX17 markedly avctivates NK cells and monocytes in TILs. A, The expression of NKp46 on NK cells in the indicated TIL subpopulations from a patient with colorectal cancer following culture for 48 hours in the ex vivo perfusion system in the presence of DX17LALAPG (5 μg/mL perfusate) or control human IgG1LALAPG antibody. B, Summary of the expression of NKp46 on NK cells in TILs from patients with five various cancers cultured for 48 hours in the ex vivo perfusion system in the presence of DX17LALAPG or control hIgG1LALAPG. C, Representative example of the expression of IL-15Rα on CD14+ monocytes from TILs from a patient with colorectal cancer cultured for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. D, Summary of the expression of IL-15Rα on monocytes in TILs from patients with various cancers cultured for 48 hours in the ex vivo perfusion system in the presence of DX17LALAPG or control hIgG1LALAPG. E, Representative example of the expression of CD86 on CD14+ monocytes from TILs from a patient with colorectal cancer cultured for 48 hours in the ex vivo perfusion system in the presence of DX17LALAPG or control hIgG1LALAPG. F, Summary of the percentage of CD14+CD86+ monocytes from patients with colorectal and gastric cancers cultured in the ex vivo perfusion system for 48 hours in vitro in the presence of DX17LALAPG or control hIgG1LALAPG. G, Representative example of the expression of CD163 on CD14+ monocytes from TILs from a patient with colorectal cancer cultured for 48 hours in the ex vivo perfusion system with DX17LALAPG or control hIgG1LALAPG. H, Summary of the percentage of CD14+CD163+ monocytes from patients with colorectal and gastric cancers cultured for 48 hours in the ex vivo perfusion system with DX17LALAPG or control hIgG1LALAPG.
Molecular analysis of leukocyte activation of TME cells ex vivo with HLA/LILR blockade
A primary colorectal carcinoma biopsy sample was placed in the ex vivo perfusion system and cultured for 48 hours in the presence of DX17LALAPG (5 μg/mL) or control hIgG1LALAPG. The biopsy was then dissociated, and human CD45+ TILs were purified from both cultures by magnetic cell sorting and processed using single-cell RNA sequencing. Although more cells were recovered from the DX17LALAPG sample (13,800) than the hIgG1LALAPG sample (7,892), the relative cellular compositions were similar (Fig. 5A). Monocytes accounted for ∼20 to 25% of the total cells, whereas the frequencies of dendritic cells (1%) and B cells (∼3.5%) were low. Predominant among the T lymphocytes were memory CD4+ (41%–43%) and memory CD8+ (18%–25%) subsets compared with naïve CD4+ (4%–6%) and naïve CD8+ (2%–3%) T cells. Very few NK cells (<1%) were recovered from either group explored by UMAP analysis (Fig. 5B). We then performed a detailed differential gene expression and pathway analysis of monocytes, memory CD4+ and CD8+ T lymphocytes, and NK cell clusters on a single-cell basis as well as by volcano plot and heat map analyses (Fig. 5C–F; Supplementary Figs. S10 and S11).
Figure 5.
Differential gene expression analysis of monocytes and memory CD8+ T cells from TILs of a single patient with colorectal cancer after culture in the ex vivo perfusion system in the presence of DX17LALAPG or control hIgG1. A, Pie chart representation of the percentages of the indicated cell subsets as determined by single-cell RNA sequencing (scRNA-seq). B, UMAP analysis depicted clusters of immune cell subsets. C, Heat map analysis of differentially expressed genes in monocytes from scRNA-seq data. D, Volcano plot analysis of differentially expressed genes in monocytes. E, Heat map analysis of differentially expressed genes in memory CD8+ T cells from scRNA-seq data. F, Volcano plot analysis of differentially expressed genes in memory CD8+ T cells. FC, fold change; GZM, granzyme.
Treatment of cultures with DX17LALAPG enhanced the expression of innate and inflammatory receptors (CLEC5A and S100A8/9), cytokines, and chemokines (IL-1b, IL-8, CCL3, CCL4, CXCL7, CXCL8, MMP9, etc.), as well as a complement gene, C3, on monocytes. In contrast, immunosuppressive molecules TREM2, APOE, EGR1, and GPNMB were downregulated (Fig. 5C and D; Supplementary Fig. S10A). Pathway analysis of differentially expressed genes demonstrated that MHC-I–mediated antigen processing pathway, IL-8, and IL-12 signaling pathways were upregulated, whereas the alternative activation signaling pathway and IL-4/IL-13 signaling pathways were downregulated after DX17LALAPG treatment (Supplementary Fig. S10B).
Marked changes in gene expression by memory CD8+ T lymphocytes were also induced by culture in the presence of DX17LALAPG (Fig. 5E and F; Supplementary Fig. S10C), including enhancement of genes encoding Th1 type cytokine (IFNG), cytotoxic granules (GZMA/B/H/K and PERF1), chemokines (CCL4, CCL5, and CXCL5), and transcription factors (RUNX3, Eomes, and KLRD1) that play critical roles in sustained long-term effector or memory CD8+ T-cell responses. Pathway analysis of activated memory CD8+ T lymphocytes indicated upregulated TCR and costimulation signaling, IFNγ signaling, Th1 pathway, DAP12 interactions, and IFN α/β and CGAS-STING signaling pathways and downregulated Th2 pathway and PD-1/PD-L1–dependent and CTLA4-dependent checkpoint inhibition signaling (Supplementary Fig. S10D). Despite the paucity of NK cells in either sample, the addition of DX17LALAPG to the ex vivo perfusion system enhanced NK cell expression of chemokines (CCL3/4, CXCL3/5, and IL-8), transcription factors (ETS2), and kinases involved in pAKT-mTOR signaling (PDPK1, IPPK, Raptor; Supplementary Fig. S10E and S10F). Pathway analysis of differentially expressed genes revealed that DX17LALAPG significantly enhanced multiple proinflammatory cytokine pathways (IL-1/-7/-8/-9/-10/-12 as well as IL-15), PI3K/pAKT, mTOR, JAK/STAT, and ERK/MAPK signaling and downregulated PTEN, RIPK1-mediated necrosis, and apoptosis signaling (Supplementary Fig. S11A). Only modest cytokine and chemokine gene expression activation by memory CD4+ T cells was observed (Supplementary Fig. S11B–S11D). Thus, blockade of HLA/LILR interactions in the TME as reflected in the ex vivo perfusion system culture resulted not only in marked activation of the innate immune response but also a dramatic increase in the adaptive antitumor response, particularly in memory CD8+ T lymphocytes.
DX17LALAPG augments NK cell and T-cell activation in vivo in humanized mice
To assess the potential of HLA/LILR blockade to induce cellular activation in vivo, we reconstituted NSG mice that lack mouse T, B, and NK cells with hPBMCs followed by treatment with W6/32 Fab (250 μg/mouse, intravenously; Fig. 6A). (Gating strategy is shown in Supplementary Fig. S12A–S12C). W6/32 Fab markedly enhanced human NK cell and T-cell proliferation, reflected by elevated Ki-67 staining of lymphocytes from spleen, liver, and lung (Fig. 6B–D).
Figure 6.
Administration of W6/32 Fab to NSG or NSG-IL-15 animals enhances human NK cell and T-cell proliferation in lymphoid and nonlymphoid organs. Outline of the experimental protocol for engraftment of NSG mice with PBMCs followed by antibody treatment (A). Flow cytometric expression of Ki-67 in NK cells and T-cell populations from spleen (B), lung (C), and liver (D) on day 6. Statistical analysis (n = 3) is shown on the right. Outline of experimental protocol for engraftment of NSG-IL-15 mice with NK-enriched PBMCs followed by antibody treatment (E). Expression of Ki-67 in NK cell and T-cell populations from spleen (F), lung (G), and liver (H) on day 16. Statistical analysis (n = 3) is shown on the right.
W6/32 Fab–mediated immune cell activation was also explored in human IL-15 transgenic NSG animals that support engraftment and long-term survival of human NK cells (33). Human NK cell–enriched (T cell–depleted) PBMCs were transferred into IL-15 transgenic NSG mice (Fig. 6E). W6/32 Fab was then administered and mice were euthanized 48 hours later. A marked enhancement of NK cell proliferation in spleen, liver, and lung was observed (Fig. 6F–H). The engrafted population contained a small percentage of CD4+ and CD8+ T cells, and an enhancement of their proliferation was also observed. Thus, W6/32 Fab treatment induces proliferation of human NK and T cells in both lymphoid and nonlymphoid organs in NSG mice.
Pan–anti-MHC-I triggers tumor immunity in vivo in humanized mice
To determine whether HLA/LILR blockade by anti–MHC-I would also augment antitumor immunity, we used the KRAS- and p53-mutated human pancreatic tumor cell line, KLM-1 (34), which expresses all classic and nonclassic HLA class I antigens, and multiple NCR-specific ligands Calr (35), MICA/B, ULBP, FcγRII (CD32), LILRBs, and LILRAs (Supplementary Fig. S13A–S13C). IL-15 transgenic NSG mice were injected with KLM-1 tumor cells, engrafted with hPBMCs on day 14, and 3 days after reconstitution were treated with DX17LALAPG or control hIgG1LALAPG (Fig. 7A). Tumor growth was markedly reduced in the DX17LALAPG-treated mice (Fig. 7B and C). Similar results were seen when mice were injected with KLM-1 cells and treated with W6/32 Fab (Supplementary Fig. S13D–S13E). NK cells isolated from the TILs of treated mice expressed higher levels of Ki-67 and NKp46 (Fig. 7D). (Gating strategy is shown in Supplementary Fig. S12D).
Figure 7.
DX17LALAPG augments antitumor immunity in NSG-IL-15 mice. A, Outline of the experimental protocol for the establishment of the KLM-1 pancreatic cell line in NSG-IL-15 mice followed by engraftment with CD3− PBMCs (day 14), administration of the antibodies (100 μg DX17LALAPG or isotype control mAb, i.v.; every 3–4 days intervals, from day 17–day 28) and analyses of TILs on day 30. B, Growth kinetics of KLM-1 tumor and (C) tumor sizes in DX17LALAPG- or control hIgG1LALAPG-treated mice. D, Percentage of CD16+NKp46+ NK cells and expression of Ki-67 on CD16+ NK cells in TILs on day 30 in hIgG1LALAPG- and DX17LALAPG-treated mice. E, Outline of the experimental protocol for treatment of the KLM-1 cells in NSG-IL-15 mice engrafted or ungrafted with CD3− PBMCs. F, Comparison of KLM-1 growth kinetics and (G) tumor size in CD3− PBMC grafted vs. ungrafted NSG-IL-15 mice. H, Selected LILRA and (I) LILRB expression on freshly harvested Epcam+ cancer cells isolated from biopsies of the indicated six different cancers.
Several studies have suggested that expression of members of the LILRB, but not LILRA, family on tumors positively correlated with tumor progression (36–40). Analysis of a colorectal and pancreatic tumor data set also indicated that multiple LILRs are expressed by colorectal and pancreatic carcinomas at the mRNA level (Supplementary Fig. S14). As KLM-1 cells express multiple LILRs, it remains possible that anti–MHC-I–mediated inhibition of tumor growth might not only result from blocking HLA/LILRB interaction between tumor cells and effector cells but may be secondary to blockade of cis or trans interactions of LILRs with HLA on the tumor cells themselves. We repeated the studies described above in IL-15 transgenic mice that had not been reconstituted with hPBMCs. In this setting, significant inhibition of tumor growth was also seen in mice treated with DX17LALAPG (Supplementary Fig. S13F and S13G). We then compared directly the antitumor effects of DX17LALAPG treatment on tumor-bearing mice that had been reconstituted with hPBMCs or non-reconstituted controls (Fig. 7E–G). Whereas DX17LALAPG alone inhibited tumor growth to the same extent as mice reconstituted with CD3-negative cells alone, much greater inhibition of growth was observed in mice reconstituted with CD3-negative hPBMCs and treated with DX17LALAPG (Fig. 7F and G). Lastly, these studies raised the possibility that primary tumors or tumor metastases might also express members of the LILR family. We readily detected the expression of multiple LILRA and LILRB members on Epcam+ tumor cells of diverse tumor origin (Fig. 7H and I).
Discussion
Immune check point blockade has revolutionized the treatment of many cancers (41). However, only a small number of inhibitory pathways have been identified, and blocking these pathways has proven to be useful in a minority of patients. The field has been focused on reversing the inhibitory and exhaustion pathways manifest by antitumor effector T cells. More than 100 cell-surface receptors with inhibitory (ITIM)-containing motifs have been identified (42). Many of these inhibitory receptor families are expressed by cells of the innate immune system, including NK cells and myeloid cells. In this study, we demonstrate that members of the LILR family play important roles in the control of the innate response against human tumors and function as a new class of checkpoint inhibitors.
Previous studies in a mouse model demonstrated that a pan–anti-H2 mAb which inhibited the binding of members of the Ly49 antigen family to their target H2 ligand resulted in a potent antitumor response initiated by NK cell activation and subsequent activation of the adaptive immune response (9). Whereas KIRs in humans play a role similar to the murine Ly49 antigens and bind HLA, the binding sites on HLA of many of the KIR family members overlap with the TCR footprint, and blocking KIR/HLA interactions could potentially inhibit T-cell function (10). We initially identified two pan–anti-HLA mAbs which blocked HLA/LILR interactions, did not block HLA/TCR interactions, and blocked the binding of dimeric constructs of LILRB1, B2, B3, B5, but not LILRB4, and the binding of LILRA1, A2, A3, A5, and A6 (A4 not tested) to all classic and some nonclassic HLA molecules. Crystallographic structures confirmed that both DX17 and W6/32 have overlapping binding sites and that their footprints overlap with the binding site of LILRB1/B2 on HLA. Whereas HLA/LILR interactions were blocked by DX17 and W6/32, these mAbs had no effect on the binding of several KIRs or CD94/NKG2A/NKG2C. In general, MHC-I molecules display a number of different faces that are seen by their ligands. TCRs engage their complementarity determining regions with the membrane distal α1α2 peptide structure to recognize MHC-I bound peptides (43). The CD94/NKG2A (inhibitory) and the CD94/NKG2C (activating) heterodimers bind p/α1α2 of HLA-E similarly (44). KIR2 and KIR3 molecules bind the carboylterminal region of α1α2 peptide, in a MHC-dependent and peptide influenced manner (45), whereas LILRs focus on the membrane proximal α3/β2m domain unit (46). Among each of these MHC-I surfaces, the pan–anti-HLA mAbs, DX17 and W6/32, only compete with the LILR and the CD8 sites, leaving potential recognition by TCR, KIR, or CD94/NKG2A/NKG2C available.
The addition of Fab fragments of both mAbs (DX17 or W6/32) to cultures of PBMCs in the absence of other stimuli resulted in NK cell proliferation, enhanced capacity to produce IFNγ, and upregulated expression of IL-15Rα. Whereas monocytes did not proliferate in culture, enhanced expression of the IL-15Rα and CD86 were observed as well as downregulation of CD163. We speculate that the failure of intact DX17 or W6/32 to induce NK cell activation was likely due to engagement of their Fc regions with an inhibitory FcR on myeloid cells which resulted in inhibition of IL-15Rα upregulation as Fab fragments and a chimeric version of DX17 containing human IgG1 with a disabled Fc region were stimulatory. The capacity of these mAbs to activate human NK cells and T cells in vivo was demonstrated by treatment of immunodeficient NSG mice that had been reconstituted with hPBMCs.
NK cells, both in the peripheral blood of patients with advanced cancers and in the TME, are dysfunctional, and a decreased percentage of NK cells in patients with tumors has been correlated with tumor progression and poor patient survival (30). Dysfunctionality is characterized not only by a decrease in number but also with decreased proliferation, production of IFNγ and TNFα, as well as impaired cytotoxic activity. Most importantly, in many cancers, NK cells express low levels of NCRs, including NKp46, NKp30, CD16, and others (47). We have confirmed these findings and extended them by demonstrating that NK cells in the TME of several solid tumors have an abnormal phenotype characterized by the presence of a high percentage of CD16−CD56+NKp46− (so-called immature) NK cells which also express high levels of LILRBs. Culture of hPBMCs in vitro or TILs derived from perfusion of intact tumors ex vivo in the presence of DX17 resulted in increased expression of NKp46 on NK cells. NK cells and monocytes from a primary colon carcinoma perfused ex vivo in the presence of DX17 upregulated a proinflammatory gene expression profile and memory CD8+ T cells in the TILs and monocytes demonstrated marked upregulation of a Th1-like response and downregulation of Th2-like responses and checkpoint inhibitory pathways.
When we inoculated NSG mice with KLM-1 cells, a human pancreatic tumor cell line, and then reconstituted the mice with PBMCs, mice treated with DX17 had a marked reduction of tumor growth, accompanied by NK cell proliferation and NKp46 expression in the TIL. KLM-1 cells expressed many members of the LILR family, raising the possibility that the therapeutic effects of HLA/LILR blockade were due to direct effects on the tumor cells. Marked reduction of tumor sizes was observed when we treated NSG mice that had been inoculated with the KLM-1 cells but not reconstituted with PBMCs. We then directly compared treatment of tumor-inoculated mice that had or had not been reconstituted with PBMCs. Whereas some reduction of tumor size was seen in the non-reconstituted cohort, the greatest degree of reduction of tumor sizes was seen in the PBMC-reconstituted group.
Multiple studies have demonstrated expression of LILRB family members on tumor cells but not adjacent tissue (48, 49). In our studies, expression of both LILRB and LILRA members was readily demonstrable by flow cytometry on several freshly explanted solid tumors of diverse origin. As mAb treatment alone can enhance antitumor effects, these results raise the possibility that interaction of LILRs with HLA either on the tumor cells themselves (in cis) or with various lymphoid cells (in trans) contributes to tumorigenicity (50). The possible tumor-promoting effects of engagement of either LILRB or LILRA alone or together is an important area for future investigation.
Several clinical studies have been reported targeting inhibitory receptors on NK cells, including KIRs, NKG2A, and LILRs. One study used IPH2101 (lirilumab) which blocks interactions among KIR2DL-1, -2, and -3 and HLA. Unfortunately, phase II studies with this mAb in several cancers did not demonstrate efficacy (51). Other studies have utilized monalizumab, a humanized mAb to NKG2A, an inhibitory receptor distinct from KIRs and the LILRB family, which blocks the binding of NKG2A to its ligand HLA-E and prolongs progression-free survival of patients with non–small cell lung cancer when given together with anti–PD-L1 (52). Several early clinical studies have used antagonistic mAbs to LILRB1 and LILRB2 either alone or as bispecific reagents (52–55) or as components of chimeric antigen receptor T cells (56), but clinical effectiveness has not yet been reported. Whereas reversing the LILRB-mediated inhibitory signals on NK cells is the proposed primary mechanism of action, one study has shown that blocking LILRB1 engagement on macrophages with either anti-LILRB1 or anti-HLA enhanced the capacity of macrophages to kill some tumor cell lines in an Fc-dependent manner in the presence of an anti-CD47 mAb (57). However, in contrast to our data, this study did not observe enhanced killing with anti-LILRB1 or anti-HLA alone in vitro or in vivo. Recent studies (58–60) have demonstrated that antagonistic mAbs to LILRB1 and LILRB2 can reprogram macrophages in the TME from an immunosuppressive M2 phenotype to a stimulatory M1 phenotype. In one study (59), an anti-LILRB2 mAb seemed to function in the presence of cis or trans engagement similar to what we observed in our experiments treating mice that had not been reconstituted with hPBMCs.
One major problem with blocking one or several members of an inhibitory receptor family is the presence of unblocked members of the same family. For example, lirilumab blocks KIR2DL-1, -2, and -3 but does not block KIR3DL family members. Our results suggest that blocking both the engagement of LILRB and LILRA families by a mAb to their common ligand, HLA, potentially represents the most efficient method of neutralizing the inhibitory effects of members of this pathway on innate immune cells in the TME as well as the potential tumor-promoting function of LILR signaling in the tumor cells themselves. This approach implies that LILRB signaling dominates over LILRA and that blocking releases the dominant effect of LILRB. Selective targeting of individual LILRBs may potentially result in altered signaling (either enhancement or suppression) by LILRA family members. Complete neutralization of LILR signaling results not only in potent activation of NK cells but seems to generate a downstream pathway involving monocyte/macrophage activation, IL-15 production, and activation of memory T lymphocytes. Our studies raise the possibility of the potential therapeutic use of pan–anti-HLA mAbs as checkpoint inhibitors in the treatment of localized tumors and tumor metastases (61). In addition, blocking HLA/LILR interactions may also have a role in the treatment of chronic infectious diseases and as an adjuvant for augmentation of responses to weak vaccines (9).
Supplementary Material
Figure S1. Differential expression levels of LILRs in healthy human PBMC derived Immune cells.
Figure S2. DX17 pan-anti-HLA mAb blocks HLA/LILR interactions but doesn’t interfare with multiple HLA/KIR interations.
Figure S3. Molecular interactions of DX17 and W6/32 pan-anti-HLA with mouse and human MHC-I.
Figure S4. Flowcytometric gating strategy of healthy human PBMC derived monocytes and lymphocytes subsets.
Figure S5. Functional effects of intact and Fab fragments of DX17 and W6/32 on T cell and monocyte activation in vitro
Figure S6. Functional effects of DX17LALAPG antibody on human PBMC derived NK cells and monocytes activation invitro.
Figure S7. Flowcytometric gating strategies of lymphocytes and monocytes from PBMC of metastatic melanoma patient.
Figure S8. Schematic diagram of exvivo perfusion circuits and validation of DX17LALAPG mAb penetration to tumor tissue.
Figure S9. Flowcytometric gating strategies of lymphocytes and monocytes from TILs of Colorectal Cancer patient.
Figure S10. ScRNA and pathway analysis of T/Ls derived monocytes, memory COB and NK cells.
Figure S11. ScRNA analysis of TILs derived memory CD4 T cells.
Figure S12. Flowcytometric gating strategies of engrafted human lymphocytes in spleen, liver, lung and TILs from NSG/NSG-IL15 mice.
Figure S13. Flowcytometric cell surface marker analysis of KLM-1 pancreatic cancer cell line.
Figure S14. Differential gene expression analysis of LILRs in colorectal and pancreatic cancer from primary and metastatic sites.
Fig S15. Pan-anti-HLAs (DX17 and W6/32) Inhibit LILRs binding to HLA but do not interfare with TCR, KIRs & CD94/NKG2A interactions.
Table S1. X-ray data collection and refinement statistics of the DX17/HLA-B*44:05 complex.
Table S2. List of contacts between HLA-B*44:05 and DX17.
Reagents and Resources
Acknowledgments
We thank Brian M. Baker and Jesus Alonso (University of Notre Dame) for providing HLA-A2+ T4H2 Jurkat cells and HLA-A2 GP100 tetramer. We thank Craig Martens, Brittany Dulek, and Francisco Otaizo-Carrasquero from the NIAID Research Technologies Branch for single-cell RNA sequencing, and Jinfang (Jeff) Zhu from the NIAID for discussion. This work was supported by the Division of Intramural Research, NIAID, NIH.
Footnotes
Note: Supplementary data for this article are available at Cancer Immunology Research Online (http://cancerimmunolres.aacrjournals.org/).
Data Availability
Macromolecular biologic structural data have been deposited in wwPDB. Single-cell RNA-sequencing data have been uploaded to the Gene Expression Omnibus database (accession ID GSE262381). All other materials, data, protocols, resources, and reagents described in this article (Supplementary Table S3) are available upon request to the corresponding author, E.M. Shevach.
Authors’ Disclosures
A.K. Panda reports a patent for PCT/US2022/077634; US Patent Application No: 18699057; EPO Application No: 2022803142 pending. K. Natarajan reports a patent for US-2024409640-A1 issued. M. Buszko reports other support from Johnson and Johnson Innovative Medicine outside the submitted work. J.M. Hernandez reports a patent for 62/988,783 issued. D.H. Margulies reports a patent for US-2024409640-A1 pending. E.M. Shevach reports a patent 20240409640 pending. No disclosures were reported by the other authors.
Authors’ Contributions
A.K. Panda: Conceptualization, resources, data curation, software, formal analysis, supervision, funding acquisition, investigation, methodology, writing–original draft, writing–review and editing. K. Natarajan: Conceptualization, resources, data curation, software, formal analysis, supervision, investigation, visualization, methodology, writing–original draft, writing–review and editing. S. Sinha: Data curation, software, investigation, visualization, writing–original draft, writing–review and editing. J. Jiang: Data curation, software, investigation. S. Chempati: Data curation, software, methodology. L.F. Boyd: Data curation, formal analysis, methodology. P.P. Desai: Data curation. M. Buszko: Data curation. Y.-H. Kim: Formal analysis. S. Kazmi: Data curation. B. Fisk: Resources, data curation, formal analysis. M.E. Teke: Resources, data curation. C.M. Larrain: Data curation, software, formal analysis, validation. K. Remmert: Resources, formal analysis, methodology, writing–review and editing. A.M. Blakely: Resources, supervision, validation, investigation, methodology, writing–original draft, writing–review and editing. I. Douagi: Data curation, software, formal analysis, validation. J.M. Hernandez: Resources, data curation, methodology, writing–review and editing. D.H. Margulies: Data curation, supervision, validation, investigation, methodology, writing–original draft, writing–review and editing. E.M. Shevach: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, writing–original draft, writing–review and editing.
References
- 1. Vivier E, Rebuffet L, Narni-Mancinelli E, Cornen S, Igarashi RY, Fantin VR. Natural killer cell therapies. Nature 2014;626:727–36. [Google Scholar]
- 2. Wolf NK, Kissiov DU, Raulet DH. Roles of natural killer cells in immunity to cancer, and applications to immunotherapy. Nat Rev Immunol 2013;23:90–105. [Google Scholar]
- 3. Bald T, Krummel MF, Smyth MJ, Barry KC. The NK cell-cancer cycle: advances and new challenges in NK cell-based immunotherapies. Nat Immunol 2020;21:835–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. López-Soto A, Gonzalez S, Smyth MJ, Galluzzi L. Control of metastasis by NK cells. Cancer Cell 2017;32:135–54. [DOI] [PubMed] [Google Scholar]
- 5. Miller JS, Lanier LL. Natural killer cells in cancer immunotherapy. Annu Rev Cancer Biol 2019;3:77–103. [Google Scholar]
- 6. Deng M, Chen H, Liu X, Huang R, He Y, Yoo B, et al. Leukocyte immunoglobulin-like receptor subfamily B: therapeutic targets in cancer. Antibody Ther 2021;4:16–33. [Google Scholar]
- 7. Kärre K, Ljunggren HG, Piontek G, Kiessling R. Selective rejection of H–2-deficient lymphoma variants suggests alternative immune defence strategy. Nature 1986;319:675–8. [DOI] [PubMed] [Google Scholar]
- 8. Natarajan K, Boyd LF, Schuck P, Yokoyama WM, Eliat D, Margulies DH. Interaction of the NK cell inhibitory receptor Ly49A with H-2Dd: identification of a site distinct from the TCR site. Immunity 1999;11:591–601. [DOI] [PubMed] [Google Scholar]
- 9. Panda AK, Gangaplara A, Buszko M, Natarajan K, Boyd LF, Sharma S, et al. Cutting edge: inhibition of the interaction of NK inhibitory receptors with MHC class I augments antiviral and antitumor immunity. J Immunol 2020;205:567–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Li Y, Mariuzza RA. Structural basis for recognition of cellular and viral ligands by NK cell receptors. Front Immunol 2014;5:123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Willcox BE, Thomas LM, Bjorkman PJ. Crystal structure of HLA-A2 bound to LIR-1, a host and viral major histocompatibility complex receptor. Nat Immunol 2013;4:913. [Google Scholar]
- 12. Chapman TL, Heikema AP, West AP Jr, Bjorkman PJ. Crystal structure and ligand binding properties of the D1D2 region of the inhibitory receptor LIR-1 (ILT2). Immunity 2000;13:727–36. [DOI] [PubMed] [Google Scholar]
- 13. Wang Q, Song H, Cheng H, Qi J, Nam G, Tan S, et al. Structures of the four Ig-like domain LILRB2 and the four-domain LILRB1 and HLA-G1 complex. Cell Mol Immunol 2020;17:966–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Shiroishi M, Tsumoto K, Amano K, Shirakihara Y, Colonna M, Braud VM, et al. Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G. Proc Natl Acad Sci U S A 2023;100:8856–61. [Google Scholar]
- 15. Abdallah F, Coindre S, Gardet M, Meurisse F, Naji A, Suganuma N, et al. Leukocyte immunoglobulin-like receptors in regulating the immune response in infectious diseases: a window of opportunity to pathogen persistence and a sound target in therapeutics. Front Immunol 2021;12:717998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Barnstable CJ, Bodmer WF, Brown G, Galfre G, Milstein C, Williams AF, et al. Production of monoclonal antibodies to group A erythrocytes, HLA and other human cell surface antigens-new tools for genetic analysis. Cell 1978;14:9–20. [DOI] [PubMed] [Google Scholar]
- 17. Phillips JH, Gumperz JE, Parham P, Lanier LL. Superantigen-dependent, cell-mediated cytotoxicity inhibited by MHC class I receptors on T lymphocytes. Science 1995;268:403–5. [DOI] [PubMed] [Google Scholar]
- 18. Lo M, Kim HS, Tong RK, Bainbridge TW, Vernes J-M, Zhang Y, et al. Effector-attenuating substitutions that maintain antibody stability and reduce toxicity in mice. J Biol Chem 2017;292:3900–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Li H, Natarajan K, Malchiodi EL, Margulies DH, Mariuzza RA. Three-dimensional structure of H-2Dd complexed with an immunodominant peptide from human immunodeficiency virus envelope glycoprotein 120. J Mol Biol 1988;283:179–19. [Google Scholar]
- 20. Rebaï N, Malissen B. Structural and genetic analyses of HLA class I molecules using monoclonal xenoantibodies. Tissue Antigens 1983;22:107–17. [DOI] [PubMed] [Google Scholar]
- 21. Stewart CA, Laugier-Anfossi F, Vely F, Saulquin X, Riedmuller J, Tisserant A, et al. Recognition of peptide-MHC-I complexes by activating killer immunoglobulin-like receptors. Proc Natl Acad Sci U S A 2005;102:13224–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Borbulevych OY, Baxter TK, Yu Z, Restifo NP, Baker BM. Increased immunogenicity of an anchor-modified tumor-associated antigen is due to the enhanced stability of the peptide/MHC complex: implications for vaccine design. J Immunol 2005;174:4812–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Parham P, Brodsky FM. Partial purification and some properties of BB7.2. A cytotoxic monoclonal antibody with specificity for HLA-A2 and a variant of HLA-A28. Hum Immunol 1081;3:277–99. [Google Scholar]
- 24. Ivanyi D, van de Meugheuvel W. A monomorphic HLA-specific monoclonal antibody, W6/32, reacts with the H-2Db molecule of normal mouse lymphocytes. Immmunogentics 1984;20:699–703. [Google Scholar]
- 25. Pymm P, Saunders PM, Ananda S, MacLachlan BJ, Faoro C, Hitchen C, et al. The structural basis for the recognition of human leukocytes antigen class I molecules by the pan-HLA antibody w6/32. J Immunol 2024;3:876–85. [Google Scholar]
- 26. Delidakis G, Kim JE, George K, Georgiou G. Improving antibody therapeutics by manipulating the Fc domain: immunological and structural considerations. Annu Rev Biomed Eng 2022;24:249–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Freud AG, Mundy-Bosse BL, Yu J, Caligiuri MA. The broad spectrum of human natural killer cell diversity. Immunity 2017;47:820–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Crinier A, Milpied P, Escalière B, Piperoglou C, Galluso J, Balsamo A, et al. High-dimensional single-cell analysis identifies organ-specific signatures and conserved NK cell subsets in humans and mice. Immunity 2018;49:971–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Barrow AD, Martin CJ, Colonna M. The natural cytotoxicity receptors in health and disease. Front Immunol 2019;10:909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Huntington ND, Cursons J, Rautela J. The cancer–natural killer cell immunity cycle. Nat Rev Cancer 2020;20:437–54. [DOI] [PubMed] [Google Scholar]
- 31. Cózar B, Greppi M, Carpentier S, Narni-Mancinelli E, Chiossone L, Vivier E. Tumor-infiltrating natural killer cells. Cancer Discov 2012;11:34–44. [Google Scholar]
- 32. Hernandez JM, Pohida TJ, Germendia MA, Ruff SM, Wach MM, Gupta S, et al. Systems, methods, and devices for ex vivo analysis of resected tissue samples. PCT/US2021/021525. 2021. [Google Scholar]
- 33. Katano I, Nishime C, Ito R, Kamisako T, Mizusawa T, Ka Y, et al. Long-term maintenance of peripheral blood derived human NK cells in a novel human IL-15- transgenic NOG mouse. Sci Rep 2017;7:17230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Kimura Y, Kobari M, Sunamura M, Kimura M, Shimamura H, Matsuno S. Establihment of an experimental liver metastasis model by intraportal injection of a newly derived human pancreatic cancer cell line (KLM-1). Int J Pancreatol 1996;20:43–50. [DOI] [PubMed] [Google Scholar]
- 35. Sen Santara S, Lee D-J, Crespo Â, Hu JJ, Walker C, Ma X, et al. The NK cell receptor NKp46 recognizes ecto-calreticulin on ER-stressed cells. Nature 2023;616:348–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Dobrowolska H, Gill KZ, Serban G, Ivan E, Li Q, Qiao P, et al. Expression of immune inhibitory receptor ILT3 in acute myeloid leukemia with monocytic differentiation. Cytometry B Clin Cytom 2013;84:21–9. [DOI] [PubMed] [Google Scholar]
- 37. Churchill HRO, Fuda FS, Xu J, Deng M, Zhang CC, An Z, et al. Leukocyte immunoglobulin-like receptor B1 and B4 (LILRB1 and LILRB4): highly sensitive and specific markers of acute myeloid leukemia with monocytic differentiation. Cytometry B Clin Cytom 2021;100:476–87. [DOI] [PubMed] [Google Scholar]
- 38. Urosevic M, Kamarashev J, Burg G, Dummer R. Primary cutaneous CD8+ and CD56+ T-cell lymphomas express HLA-G and killer-cell inhibitory ligand, ILT2. Blood 2004;103:1796–8. [DOI] [PubMed] [Google Scholar]
- 39. Siu LL, Wang D, Hilton J, Geva R, Rasco D, Perets R, et al. First-in-class anti-immunoglobulin-like transcript 4 myeloid-specific antibody MK-4830 abrogates a PD-1 resistance mechanism in patients with advanced solid tumors. Clin Cancer Res 2022;28:57–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Cai Z, Wang L, Han Y, Gao W, Wei X, Gong R, et al. Immunoglobulin-like transcript 4 and human leukocyte antigen-G interaction promotes the progression of human colorectal cancer. Int J Oncol 2019;54:1943–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. June CH, Warshauer JT, Bluestone JA. Is autoimmunity the Achilles’ heel of cancer immunotherapy? Nat Med 2017;23:540–7. [DOI] [PubMed] [Google Scholar]
- 42. Rumpret M, von Richthofen HJ, Peperzak V, Meyaard L. Inhibitory pattern recognition receptors. J Exp Med 2021;219:e20211463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Marrack P, Scott-Browne JP, Dai S, Gapin L, Kappler JW. Evolutionarily conserved amino acids that control TCR-MHC interaction. Annu Rev Immunol 2008;26:171–203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Wada H, Matsumoto N, Maenaka K, Suzuki K, Yamamoto K. The inhibitory NK cell receptor CD94/NKG2A and the activating receptor CD94/NKG2C bind the top of HLA-E through mostly shared but partly distinct sets of HLA-E residues. Eur J Immunol 2004;34:81–90. [DOI] [PubMed] [Google Scholar]
- 45. Sim MJW, Brennan P, Wahl KL, Lu J, Rajagopalan S, Sun PD, et al. Innate receptors with high specificity for HLA class I–peptide complexes. Sci Immunol 2023;8:eadh1781. [DOI] [PubMed] [Google Scholar]
- 46. Redondo-García S, Barritt C, Papagregoriou C, Yeboah M, Frendeus B, Cragg MS, et al. Human leukocyte immunoglobulin-like receptors in health and disease. Front Immunol 2023;14:1282874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Mamessier E, Sylvain A, Thibult M-L, Houvenaeghel G, Jacquemier J, Castellano R, et al. Human breast cancer cells enhance self tolerance by promoting evasion from NK cell antitumor immunity. J Clin Invest 2011;121:3609–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Zhang Y, Lu N, Xue Y, Zhang M, Li Y, Si Y, et al. Expression of immunoglobulin-like transcript (ILT)2 and ILT3 in human gastric cancer and its clinical significance. Mol Med Rep 2012;5:910–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Fan J, Wang L, Chen M, Zhang J, Li J, Song F, et al. Analysis of the expression and prognosis for leukocyte immunoglobulin-like receptor subfamily B in human liver cancer. World J Surg Oncol 2022;20:92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Carosella ED, Gregori S, Tronik-Le Roux D. HLA-G/LILRBs: a cancer immunotherapy challenge. Trends Cancer 2021;7:389–92. [DOI] [PubMed] [Google Scholar]
- 51. Carlsten M, Korde N, Kotecha R, Reger R, Bor S, Kazandjian D, et al. Checkpoint inhibition of KIR2D with the monoclonal antibody IPH2101 induces contraction and hyporesponsiveness of NK cells in patients with myeloma. Clin Cancer Res 2016;22:5211–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. André P, Denis C, Soulas C, Bourbon-Caillet C, Lopez J, Arnoux T, et al. Anti-NKG2A mAb is a checkpoint inhibitor that promotes anti-tumor immunity by unleashing both T and NK cells. Cell 2018;175:1731–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Mandel I, Haves Ziv D, Goldshtein I, Peretz T, Alishekevitz D, Fridman Dror A, et al. BND-22, a first-in class humanized ILT2-blocking antibody, promotes antitumor immunity and tumor regression. J Immunother Cancer 2022;10:e004859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Villa-Álvarez M, Sordo-Bahamonde C, Lorenzo-Herrero S, Gonzalez-Rodriguez AM, Payer AR, Gonzalez-Garcia E, et al. Ig-like transcript 2 (ILT2) blockade and lenalidomide restore NK cell function in chronic lymphocytic leukemia. Front Immunol 2018;9:2917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Kim A, Han C-J, Driver I, Olow A, Sewell AK, Zhang Z, et al. LILRB1 blockade enhances bispecific T cell engager antibody-induced tumor cell killing by effector CD8+ T cells. J Immunol 2019;203:1076–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. John S, Chen H, Deng M, Gui X, Wu G, Chen W, et al. A novel anti-LILRB4 CAR-T cell for the treatment of monocytic AML. Mol Ther 2018;26:2487–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Barkal AA, Weiskopf K, Kao KS, Gordon SR, Rosental B, Yiu YY, et al. Engagement of MHC class I by the inhibitory receptor LILRB1 suppresses macrophages and is a target of cancer immunotherapy. Nat Immunol 2018;19:76–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Umiker B, Hashambhoy-Ramsay Y, Smith J, Rahman T, Mueller A, Davidson R, et al. Inhibition of LILRB2 by a novel blocking antibody designed to reprogram immunosuppressive macrophages to drive T-cell activation in tumors. Mol Cancer Ther 2023;22:471–84. [DOI] [PubMed] [Google Scholar]
- 59. Tian J, Ashique AM, Weeks S, Lan T, Yang H, Chen H-IH, et al. ILT2 and ILT4 drive myeloid suppression via both overlapping and distinct mechanisms. Cancer Immunol Res 2024;12:592–613. [DOI] [PubMed] [Google Scholar]
- 60. Jones DC, Irving L, Dudley R, Blümli S, Wolny M, Chatzopoulou EI, et al. LILRB2 blockade facilitates macrophage repolarization and enhances T cell-mediated antitumor immunity. J Immunother Cancer 2025;13:e010012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Wang J, Lu Q, Chen X, Aifantis I. Targeting MHC-I inhibitory pathways for cancer immunotherapy. Trends Immunol 2024;45:177–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1. Differential expression levels of LILRs in healthy human PBMC derived Immune cells.
Figure S2. DX17 pan-anti-HLA mAb blocks HLA/LILR interactions but doesn’t interfare with multiple HLA/KIR interations.
Figure S3. Molecular interactions of DX17 and W6/32 pan-anti-HLA with mouse and human MHC-I.
Figure S4. Flowcytometric gating strategy of healthy human PBMC derived monocytes and lymphocytes subsets.
Figure S5. Functional effects of intact and Fab fragments of DX17 and W6/32 on T cell and monocyte activation in vitro
Figure S6. Functional effects of DX17LALAPG antibody on human PBMC derived NK cells and monocytes activation invitro.
Figure S7. Flowcytometric gating strategies of lymphocytes and monocytes from PBMC of metastatic melanoma patient.
Figure S8. Schematic diagram of exvivo perfusion circuits and validation of DX17LALAPG mAb penetration to tumor tissue.
Figure S9. Flowcytometric gating strategies of lymphocytes and monocytes from TILs of Colorectal Cancer patient.
Figure S10. ScRNA and pathway analysis of T/Ls derived monocytes, memory COB and NK cells.
Figure S11. ScRNA analysis of TILs derived memory CD4 T cells.
Figure S12. Flowcytometric gating strategies of engrafted human lymphocytes in spleen, liver, lung and TILs from NSG/NSG-IL15 mice.
Figure S13. Flowcytometric cell surface marker analysis of KLM-1 pancreatic cancer cell line.
Figure S14. Differential gene expression analysis of LILRs in colorectal and pancreatic cancer from primary and metastatic sites.
Fig S15. Pan-anti-HLAs (DX17 and W6/32) Inhibit LILRs binding to HLA but do not interfare with TCR, KIRs & CD94/NKG2A interactions.
Table S1. X-ray data collection and refinement statistics of the DX17/HLA-B*44:05 complex.
Table S2. List of contacts between HLA-B*44:05 and DX17.
Reagents and Resources
Data Availability Statement
Macromolecular biologic structural data have been deposited in wwPDB. Single-cell RNA-sequencing data have been uploaded to the Gene Expression Omnibus database (accession ID GSE262381). All other materials, data, protocols, resources, and reagents described in this article (Supplementary Table S3) are available upon request to the corresponding author, E.M. Shevach.







