Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2005 Oct;139(2):1065–1077. doi: 10.1104/pp.105.067603

Pseudomonas fluorescens and Glomus mosseae Trigger DMI3-Dependent Activation of Genes Related to a Signal Transduction Pathway in Roots of Medicago truncatula1

Lisa Sanchez 1,2, Stéphanie Weidmann 1, Christine Arnould 1, Anne Rose Bernard 1, Silvio Gianinazzi 1, Vivienne Gianinazzi-Pearson 1,*
PMCID: PMC1256018  PMID: 16183836

Abstract

Plant genes induced during early root colonization of Medicago truncatula Gaertn. J5 by a growth-promoting strain of Pseudomonas fluorescens (C7R12) have been identified by suppressive subtractive hybridization. Ten M. truncatula genes, coding proteins associated with a putative signal transduction pathway, showed an early and transient activation during initial interactions between M. truncatula and P. fluorescens, up to 8 d after root inoculation. Gene expression was not significantly enhanced, except for one gene, in P. fluorescens-inoculated roots of a Myc−Nod− genotype (TRV25) of M. truncatula mutated for the DMI3 (syn. MtSYM13) gene. This gene codes a Ca2+ and calmodulin-dependent protein kinase, indicating a possible role of calcium in the cellular interactions between M. truncatula and P. fluorescens. When expression of the 10 plant genes was compared in early stages of root colonization by mycorrhizal and rhizobial microsymbionts, Glomus mosseae activated all 10 genes, whereas Sinorhizobium meliloti only activated one and inhibited four others. None of the genes responded to inoculation by either microsymbiont in roots of the TRV25 mutant. The similar response of the M. truncatula genes to P. fluorescens and G. mosseae points to common molecular pathways in the perception of the microbial signals by plant roots.

Root exudates play an active role in the regulation of symbiotic and pathogenic interactions with microbes (Hirsch et al., 2003). Rhizosphere microorganisms in turn can have a decisive influence on plant health. The most commonly studied beneficial interactions are the arbuscular mycorrhizal (AM) symbiosis, between the majority of land plant families and fungi in the phylum Glomeromycota (Smith and Read, 1997; Schüssler et al., 2001), and the nodule symbiosis restricted to legumes and bacteria of the family Rhizobiaceae (Dénarié et al., 1992; Franssen et al., 1992; Perret et al., 2000). Several other genera of soil bacteria, including Pseudomonas and Bacillus species, can stimulate root proliferation or have antagonistic effects on pathogens in the rhizosphere (Kloepper and Schroth, 1978; Ellis et al., 2000; Whipps, 2001). Contrary to the AM and nodule symbioses, few investigations have focused on the molecular bases of plant responses to rhizobacteria such as Pseudomonas, and studies have mainly been concerned with elucidating the basis of induced systemic resistance by Pseudomonas species in Arabidopsis (Arabidopsis thaliana; Cartieaux et al., 2003; Verhagen et al., 2004; Wang et al., 2005).

The lack of information about plant gene expression during root colonization by Pseudomonas fluorescens prompted us to exploit suppressive subtractive hybridization (SSH; Diatchenko et al., 1996) to identify plant gene responses during early-stage colonization of Medicago truncatula Gaertn. roots by P. fluorescens strain C7R12. P. fluorescens strain C7R12 is a spontaneous rifampicin-resistant mutant of a wild-type strain C7 (Eparvier et al., 1991) previously isolated from the rhizosphere of flax cultivated in a soil that suppresses fusarium wilts (Lemanceau et al., 1988). This bacterial strain (1) improves the suppression of fusarium wilts caused by nonpathogenic Fusarium oxysporum (Lemanceau and Alabouvette, 1991), (2) is rhizosphere competent (Eparvier et al., 1991), and (3) colonizes M. truncatula rhizosphere and root tissues (Sanchez et al., 2004). M. truncatula was chosen in order to compare root responses to P. fluorescens with interactions involving an AM fungus and a nitrogen-fixing bacterium. M. truncatula has become a model plant for molecular and genomic studies of mycorrhizal and nitrogen fixing symbioses because of its small diploid genome of about 500 megabases (Blondon et al., 1994), short generation time, prolific seed production, and large database resources (http://medicago.toulouse.inra.fr/ and http://www.tigr.org/). Mutants of M. truncatula resistant to mycorrhization and nodulation, obtained by ethyl methanesulfonate or γ ray mutagenesis, also provide an important tool to dissect mechanisms involved in the establishment of a functional symbiosis (Sagan et al., 1995; Catoira et al., 2000; Penmetsa and Cook, 2000).

Here, we report characterization of rhizospheric and endophytic colonization by P. fluorescens C7R12 of wild-type (J5, Myc+Nod+) or symbiosis-defective (TRV25, Myc−Nod−) M. truncatula genotypes (Catoira et al., 2000; Morandi et al., 2005), and identification of 58 plant genes activated during early stages of root colonization by the rhizobacterium. Detailed time-course expression analyses of a set of 10 genes associated with a putative signal transduction pathway during root colonization of the two M. truncatula genotypes showed that this signal transduction pathway is transiently activated in the wild-type plants and is dependent on the calcium and calmodulin-dependent protein kinase gene (DMI3, syn. MtSYM13; Lévy et al., 2004; Mitra et al., 2004) that is inactive in the TRV25 mutant. These observations prompted comparison of gene expression profiles in G. mosseae- or Sinorhizobium meliloti-inoculated roots in order to gain further insight into plant genes that may be common to the beneficial rhizosphere interactions in a legume species.

RESULTS

Root Colonization and Plant Growth

P. fluorescens C7R12 proliferated in the rhizosphere of M. truncatula to similar extents in the wild type (J5) and TRV25 mutant from 4 to 21 d after inoculation (dai; Fig. 1A). Internal root tissue colonization by the bacterium followed a similar pattern in both genotypes up to 8 dai and then slowed down in the mutant roots (Fig. 1B). No bacteria were isolated from noninoculated roots. Both light and electron microscopy confirmed that there were no differences in early colonization patterns of the rhizosphere and root tissues between the two plant genotypes. Semithin sections of inoculated M. truncatula roots showed a similar development of P. fluorescens colonies at the root surface and within root tissues of either the wild-type genotype (Fig. 2, A and B) or the TRV25 mutant (Fig. 2, D and E). Electron microscopy observations of the rhizoplane showed bacterial colonies to be also closely associated with sloughing root cap cells (Fig. 2, C and F).

Figure 1.

Figure 1.

Open in a new tab

Quantification of P. fluorescens C7R12 colonizing the rhizoplane (A) and internal root tissues (B) of wild type (J5, ♦) and a DMI3 mutant genotype (TRV25, □) of Medicago truncatula 4 to 21 dai. Suspensions of root washings and of macerated surface sterilized roots were plated on King B medium and the number of cfu quantified.

Figure 2.

Figure 2.

Open in a new tab

Light and electron micrographs of root colonization by P. fluorescens C7R12 (arrows) in wild-type (A–C) and DMI3 mutant (D–F) genotypes of M. truncatula. Sections of roots were fixed in glutaraldehyde and embedded in LR White resin, and observed directly (B, C, E, and F) or after reaction with a polyclonal P. fluorescens antibody (A and D). A and D, Immunolocalization of bacterial cells in the rhizoplane; B and E, bacteria within the root cortex; C and F, bacterial colonies between sloughing root tip cells. Bar = 10 μm.

A significant difference (P = 0.05) was observed between root fresh weights of M. truncatula plants that were inoculated or not with P. fluorescens. Increased root production occurred as early as 4 dai for the inoculated wild-type M. truncatula plants (Fig. 3A), whereas a lesser growth-promoting effect became evident much later (14 dai) for TRV25 root systems (Fig. 3B). Shoot fresh weight also increased in P. fluorescens-inoculated M. truncatula, and this was particularly pronounced 21 dai in wild-type plants (+32%) as compared to the mutant (+1%; data not shown).

Figure 3.

Figure 3.

Open in a new tab

Effect of P. fluorescens inoculation on root fresh weight of M. truncatula wild-type J5 (A) and DMI3 mutant genotype (TRV25; B) observed between inoculated (▪) and noninoculated (⋄) roots.

G. mosseae reached an average of 4.2 appressoria per cm root 5 dai of the wild-type genotype of M. truncatula (J5). Fungal development was slower on roots of the TRV25 mutant and needed 7 dai to reach a similar level of appressorium development (3.7 appressoria per cm root). Rhizospheric colonization of M. truncatula J5 and TRV25 plants by S. meliloti were evaluated as being, respectively, 3.108 and 2.108 colony forming units (cfu)/root system 4 dai, with no significant difference between the two plant genotypes (data not shown). No nodule or nodule primordia were observed at this stage of plant development.

Identification of P. fluorescens-Induced M. truncatula Genes

In order to target M. truncatula genes that are activated in the interaction with P. fluorescens C7R12, cDNA from noninoculated roots of the wild-type genotype J5 was used as driver and cDNA from inoculated roots of the same genotype as tester in PCR-based SSH. Material from 4 to 8 dai, chosen as the time point for early colonization of rhizosphere and root tissues by P. fluorescens (Fig. 1), was bulked. Inserts from 400 clones were screened using cDNA probes from M. truncatula J5 roots inoculated or not with P. fluorescens C7R12 to identify clones in the SSH library representing transcripts that accumulate during root colonization by the bacterium. Hybridization signal intensities were normalized using the Mtgap1 gene, which showed no differential expression in any of the root-P. fluorescens interactions (Fig. 4). Expressed sequence tags (ESTs) corresponding to genes that, in three different inoculation experiments, consistently showed at least a 2-fold increase in transcript accumulation in P. fluorescens-colonized roots of M. truncatula J5 compared to controls were sequence analyzed. This resulted in 63 ESTs (average 520 bp) corresponding to 58 genes that were up-regulated in P. fluorescens-inoculated M. truncatula J5 roots (Table I). Sequences were designated as MtPfEs (M. truncatula P. fluorescens Early stage) and deposited in the EMBL database (accession nos. AJ864402–AJ864459). All the genes presented a basal expression in noninoculated roots. The isolated clones corresponded to four singletons and 54 tentative consensus sequences from The Institute for Genomic Research (TIGR) database. Results of BlastN analyses gave 14 ESTs that encoded putative proteins showing significant similarity with proteins of unknown function in the TIGR database (Table I). The most represented gene categories coded for putative proteins related to primary metabolism (n = 14) and gene expression/RNA metabolism (n = 11).

Figure 4.

Figure 4.

Open in a new tab

Expression analyses by RT-PCR of the Mtgap1 gene in M. truncatula roots. Amplification signals of cDNA from roots of wild-type (J5) and DMI3 mutant (TRV25) genotypes were quantified and compared between noninoculated roots (NI) and roots inoculated with P. fluorescens, G. mosseae, or S. meliloti.

Table I.

Sequence analysis of M. truncatula ESTs corresponding to plant genes up-regulated at least 2-fold by P. fluorescens colonization of roots

EST Accession No. Putative Function Best Matching E Value (BlastN)
Signal transduction
    MtPfEs385 AJ864402 14.3.3-like protein TC76573 1.9e-83
    MtPfEs229 AJ864403 Casein kinase II MtC10898_GC 3.8e-130
    MtPfEs165 AJ864404 Protease inhibitor MtC00028_GC 6.9e-164
    MtPfEs166 AJ864405 Small GTP-binding protein TC85468 2.2e-99
    MtPfEs434 AJ864406 Receptor-like protein kinase TC88607 6.3e-73
Gene expression and RNA metabolism
    MtPfEs147 AJ864407 Putative helicase MtC00459_GC 9.0e-180
    MtPfEs228 AJ864408 Peptidase M41; AAA ATPase MtD04577_GC 9.7e-27
    MtPfEs252 AJ864409 HMG-I and HMG-Y DNA-binding domain MtD16214_GC 1.3e-09
    MtPfEs307 AJ864410 TFIIB MtC20194_GC 9.2e-97
    MtPfEs313 AJ864411 TFIIS MtD26667_GC 2.7e-91
    MtPfEs369 AJ864412 bZIP transcription factor TC77784 5.6e-64
    MtPfEs380 AJ864413 Pre-mRNA splicing factor PRP8 MtC90795_GC 1.5e-60
    MtPfEs387 AJ864414 Homeodomain LZ TC77101 7.6e-108
    MtPfEs425 AJ864415 29-kD ribonucleoprotein A chloroplast precursor TC76948 3.8e-82
    MtPfEs452 AJ864416 EF-1α TC85208 1.3e-171
    MtPfEs361/404 AJ864417 Protein hydrolase nuclease MtC91421_GC 1.4e-105
Protein synthesis
    MtPfEs413 AJ864418 60S ribosomal protein L26 MtC00414_GC 7.9e-91
    MtPfEs431 AJ864419 40S ribosomal protein S3 TC85151 1.7e-153
    MtPfEs279/291/294 AJ864420 Ribosomal protein L18P/L5E MtD18175_GC 3.8e-70
Primary metabolism
    MtPfEs225 AJ864421 β-Glucosidase-like protein TC76723 1.1e-90
    MtPfEs118 AJ864422 Inorganic pyrophosphatase (EC 3.6.1.1) TC86896 7.5e-109
    MtPfEs149 AJ864423 Phosphogluconate dehydrogenase (EC 1.1.1.44) TC85656 3.7e-78
    MtPfEs224 AJ864424 Putative heme oxygenase 1 precursor TC85984 7.4e-136
    MtPfEs301 AJ864425 3-Dehydroquinate dehydratase/shikimate 5-dehydrogenase TC90303 1.2e-47
    MtPfEs311 AJ864426 Cytochrome P450 MtD00884_GC 5.6e-124
    MtPfEs370 AJ864427 Homocysteine methyltransferase (EC 2.1.1.14) TC85287 3.2e-171
    MtPfEs419 AJ864428 Glycine hydroxymethyltransferase (EC 2.1.2.1) TC76788 9.3e-164
    MtPfEs454 AJ864429 Phosphoenolpyruvate carboxylase (EC 4.1.1.31) TC77967 1.0e-180
    MtPfEs473 AJ864430 Arg methyltransferase-like protein TC88110 3.8e-114
    MtPfEs232/353 AJ864431 Phytocyanin plastocyanin-like; Pro-rich region MtD00173_GC 6.1e-80
    MtPfEs282/290 AJ864432 Phosphoethanolamine N-methyltransferase TC88096 2.9e-123
    MtPfEs120 AJ864433 Cyclic nucleotide-binding domain; Acyl-CoA thioesterase MtD00307_GC 1.1e-70
    MtPfEs122 AJ864434 UDP-Glc:anthocyanin 5-O-glucosyltransferase TC78695 3.5e-114
Membrane transport
    MtPfEs348 AJ864435 ABC transporter TC77058 2.0e-112
    MtPfEs410 AJ864436 Aquaporin protein PIP1.1 TC76601 1.0e-170
Cell division
    MtPfEs347 AJ864437 Putative DNA-binding protein TC90213 3.1e-113
    MtPfEs378 AJ864438 ATPase; cell division protein 48 MtD01558_GC 7.9e-70
Cytoskeleton
    MtPfEs102 AJ864439 F-actin capping protein, α-subunit MtC93226_GC 8.2e-73
Abiotic stimuli
    MtPfEs277 AJ864440 ARG10 TC85670 3.5e-127
    MtPfEs343 AJ864441 GH3-like protein TC77367 1.8e-143
    MtPfEs386 AJ864442 Pro-rich protein auxin-induced, alfalfa TC85238 2.8e-53
Defense
    MtPfEs205 AJ864443 Pprg2 protein TC76638 1.9e-156
    MtPfEs399 AJ864444 β-1,3-Glucanase-like protein TC79296 4.1e-81
Unknown function
    MtPfEs97 AJ864445 Probable transmembrane protein MtC10280_GC 1.7e-79
    MtPfEs151 AJ864446 Unknown function MtC30206_GC 4.1e-119
    MtPfEs172 AJ864447 Putative protein MtC90638_GC 1.9e-86
    MtPfEs191 AJ864448 Unknown function MtC62315_GC 4.4e-119
    MtPfEs310 AJ864449 Unknown function TC76316 1.9e-115
    MtPfEs327 AJ864450 Putative protein MtC30302_GC 6.6e-101
    MtPfEs365 AJ864451 Epsin N-terminal homology MtD20346_GC 4.6e-102
    MtPfEs373 AJ864452 Putative protein MtC90833_GC 1.8e-59
    MtPfEs376 AJ864453 Putative φ-1-like phosphate-induced protein TC76773 2.3e-126
    MtPfEs432 AJ864454 Unknown protein TC87103 8.5e-98
    MtPfEs475 AJ864455 Probable Glu-rich protein MtC91126_GC 4.5e-53
    MtPfEs477 AJ864456 Unknown protein TC84737 4.9e-73
    MtPfEs478 AJ864457 Pro-rich region MtC90739_GC 3.3e-80
    MtPfEs226 AJ864458 Hypothetical 214.8-kD protein ycf1 TC76532 4.3e-87
    MtPfEs283 AJ864459 Unknown function MtC62385_GC 7.8e-95
Open in a new tab

Expression Analysis of Selected Genes in Wild-Type (J5) and TRV25 Mutant Roots of M. truncatula

Ten genes that could be related to a signal transduction pathway (Sibéril et al., 2001) were selected for more detailed investigation. The genes coded proteins with putative functions in signal transduction (14.3.3-like protein, casein kinase II [CK2], protease inhibitor, small GTP-binding protein, and receptor-like kinase), in gene expression/RNA metabolism (TFIIS transcription factor, bZIP transcription factor, and homeodomain Leu zipper [LZ]), in membrane transport (ATP-binding cassette [ABC] transporter), and in abiotic stimuli responses and development (GH3-like protein). Transcript profiling in M. truncatula roots at 4, 6, 8, 14, and 21 dai with P. fluorescens was performed by semiquantitative reverse transcriptase (RT)-PCR using primers deduced from EST sequences and the Mtgap1 gene as reference (Table II). Contrary to northern analyses, semiquantitative RT-PCR not only enables specific detection of a gene family member but is also sufficiently sensitive to detect transcripts in limited amounts of tissues like those in early stages of root colonization. Replicate RNA samples from roots from three new batches of P. fluorescens-inoculated and noninoculated M. truncatula plants were used. For each gene, the quantified signals from RT-PCR products were normalized by values for the Mtgap gene in the same sample. Results, expressed as the relative transcript abundance in inoculated and noninoculated roots, are presented in Figure 5A. Significant activation (P = 0.05) was confirmed for all the genes in roots of the M. truncatula J5 genotype between 4 and 8 dai with P. fluorescens. Most of the genes were up-regulated at 4 and 6 dai: receptor-like kinase, CK2, small GTP-binding protein, protease inhibitor, 14.3.3-like protein, transcription factor TFIIS, and GH3-like protein. The ABC transporter gene was only activated at 4 dai, the homeodomain LZ gene was activated up to 8 dai, and the bZIP transcription factor gene up to 14 dai. All the genes were down-regulated from 8 to 21 dai in the later stages of root colonization by P. fluorescens.

Table II.

Oligonucleotide primer sequences, PCR conditions, and number of cycles used for gene expression analyses by semi-quantitative RT-PCR

Gene (Accession No.) Primers PCR Annealing Temperature Cycle Sample No.
°C
Receptor-like protein kinase (AJ864406) 5′ TACATTTAGTTGGTGGTCC 3′ 56 30
5′ ACCTCAGGAGCACGGTAGCC 3′
Casein kinase II (AJ864403) 5′ CAAGCGGAGTTTTCGC 3′ 52 28
5′ GAGGTGTTTGAAGGC 3′
Small GTP-binding protein (AJ864405) 5′ TACTGCTGGGATACTGCTGGAC 3′ 58 30
5′ ATGTGAATGATACAGCCTCCG 3′
Protease inhibitor (AJ864404) 5′ TTCAATACCATCACCAACAGC 3′ 56 30
5′ CACCGGTGTATTTCTCTGC 3′
14.3.3-like protein (AJ864402) 5′ TCGGAGCACGACGTGCTTCGTGGC 3′ 58 24
5′ ACGATATGATTACTGCTCATCGG 3′
bZIP transcription factor (AJ864412) 5′ ACAAGAACCACTTGTAGGAC 3′ 56 26
5′ CTCTTTGGGCATCAAGACC 3′
Homeodomain Leu zipper (AJ864414) 5′ AGCATGGAGGAAGGCTCAAAGAGG 3′ 58 24
5′ ACCAATTCAGTGCCTCTCCC 3′
TFIIS (AJ864411) 5′ TGCTACAGTAGAGCGGTGTGG 3′ 56 30
5′ TTGTTCGACTGTGAGCG 3′
ABC transporter (AJ864435) 5′ GGTAAAGCCCAGGTGATGCC 3′ 56 26
5′ CTGGTCACTTTCTGATCAGC 3′
GH3-like protein (AJ864441) 5′ TGGATGTTATTGTGACTGG 3′ 56 26
5′ ACATCACCAACTCGGTAACGG 3′
Mtgap1 5′ TGAGGTTGGAGCTGATTACG 3′ 56 20
5′AGCCTTGGCAGCTCCAGTGC 3′
Open in a new tab

Figure 5.

Figure 5.

Open in a new tab

Relative abundance of transcripts of 10 M. truncatula genes from P. fluorescens-inoculated (black bars) and noninoculated (white bars) roots obtained by semiquantitative RT-PCR in wild-type J5 (A) and DMI3 mutant genotype TRV25 (B) from 4 to 21 dai.

Expression of the 10 genes was also studied in the DMI3-mutated genotype of M. truncatula (TRV25) affected in mycorrhization and nodulation (Myc−Nod− phenotype). RT-PCR profiles at 4 to 21 dai are shown in Figure 5B. Nine of the genes showed no significant change in expression in roots of the mutant at 4 and 6 dai with P. fluorescens C7R12. Only one gene, encoding the homeodomain LZ, was significantly up-regulated (P = 0.05) in the P. fluorescens-inoculated mutant roots at 6 and 8 dai. The 14.3.3-like protein, bZIP transcription factor, homeodomain LZ, and ABC transporter genes did not vary in expression throughout colonization of the mutant roots, while the five remaining genes were down-regulated in later stages of root colonization (21 dai), as in the wild-type genotype of M. truncatula.

Comparison of Plant Gene Expression Profiles in G. mosseae- and S. meliloti-Root Interactions

In order to investigate plant gene responses during early stages of different beneficial root interactions, expression profiles of the 10 M. truncatula genes were also analyzed 5 dai with the mycorrhizal fungus G. mosseae or 4 dai with the fixing nitrogen bacterium S. meliloti in the wild-type (J5) and DMI3-mutated (TRV25) genotypes. Resulting data are presented in Figure 6. A significant (P = 0.05) increase in transcript abundance was detected for all the genes in wild-type M. truncatula roots inoculated with G. mosseae, while no response to the mycorrhizal fungus was observed in roots of the mutant (Fig. 6A). This confirms previous observations that the DMI3 gene is required for activation of early molecular responses to G. mosseae in M. truncatula roots (Weidmann et al., 2004). Only one gene encoding a small GTP-binding protein was up-regulated in M. truncatula wild-type (J5) roots, 4 dai with S. meliloti. Among the remaining nine genes, four (receptor-like kinase, GH3-like protein, protease inhibitor, and 14.3.3 protein) were down-regulated by the N2 fixing bacterium, and the remaining five showed no modified expression (Fig. 6B). In the plant genotype mutated for the DMI3 gene, no significant modification in expression was observed 4 dai with S. meliloti (Fig. 6B).

Figure 6.

Figure 6.

Open in a new tab

Relative abundance of transcripts of 10 M. truncatula genes from noninoculated (white bars) roots and roots inoculated with G. mosseae (A) or S. meliloti (B) obtained by semiquantitative RT-PCR in wild-type J5 (black bars) and DMI3 mutant genotype TRV25 (hatched bars).

DISCUSSION

The Nod−Myc− M. truncatula Genotype Is “Pseu+”

P. fluorescens colonizes both the rhizosphere and root tissues of wild-type (J5) and mutant (TRV25) M. truncatula. These results provide new insights on the characterization of this DMI3 M. truncatula mutant that is unable to develop mycorrhiza and nodule symbioses (Sagan et al., 1995; Catoira et al., 2000). It has been reported to be infected by a root pathogenic fungus (Morandi et al., 2002), and its phenotype can now also be termed “Pseu+,” which pleads in favor of the terminology MtSYM13 rather than DMI3 to describe the corresponding plant gene (Morandi et al., 2004).

The P. fluorescens strain C7R12 improves the suppression of fusarium wilts caused by nonpathogenic Fusarium oxysporum (Lemanceau and Alabouvette, 1991), but its effect on M. truncatula had not been previously investigated. This data on root and shoot fresh weights of uninoculated and inoculated material in the two M. truncatula genotypes clearly show growth promotion by the rhizobacteria, the extent of which is dependent on the plant genotype. Plant growth promotion was greater and evident earlier in the wild-type (J5) genotype as compared to the TRV25 mutant. The physiological basis of this difference in growth stimulation by P. fluorescens C7R12 is not known. Plant growth-promoting rhizobacteria (Kloepper and Schroth, 1978) can exert positive effects on plant growth indirectly through bioprotective activities (Sivan and Chet, 1992; Thomashow et al., 1996), or directly by solubilizing phosphate (Subba Rao, 1982) or producing plant hormones (Xie et al., 1996). Indole-acetic-acid production by different species of Pseudomonas has been demonstrated (Patten and Glick, 2002) and has been related to plant growth promotion (Gamalero et al., 2003). In this context, the P. fluorescens strain C7R12 can produce indole-acetic-acid (L. Sanchez, unpublished data), and this may explain the growth-promoting effect observed on M. truncatula following inoculation of the rhizobacterium.

Root Colonization by P. fluorescens Triggers Enhanced Expression of M. truncatula Genes

The SSH technique exploited in this study has proved useful in a wide range of analyses of plant responses to abiotic and biotic stresses, including changes in gene expression in different plant-microbe interactions (Beyer et al., 2001, 2002; Requena et al., 2002; Wulf et al., 2003; Brechenmacher et al., 2004; Weidmann et al., 2004). One of the main advantages is that it allows detection of low abundance, differentially accumulated mRNA (von Stein et al., 1997), which may characterize early responses of root tissues to microbial cells. Using SSH, we were able to identify 58 M. truncatula genes that are up-regulated in the early stage of root interactions with P. fluorescens C7R12. When compared to data obtained from two recent microarray analyses of root responses to Pseudomonas, these results underline the interest of the SSH approach. In fact, when Cartieaux et al. (2003) screened 14,300 genes of Arabidopsis for responses to the rhizobacterium Pseudomonas thivervalensis strain MLG45, which induces systemic resistance against Pseudomonas syringae pv tomato DC3000, few changes in gene expression were observed in colonized roots, no transcript increased, and the level of only nine transcripts was reduced in root tissues relative to noninoculated controls. In the second study, surveying transcriptional responses of more than 8,000 Arabidopsis genes during rhizobacteria-mediated induced systemic resistance, Verhagen et al. (2004) found that P. fluorescens WCS417r bacteria elicited a substantial change in the expression of 97 genes in roots.

The data obtained from SSH provide new insights into root responses to P. fluorescens interactions during early events of colonization. The large size of the EST fragments (average of 520 bp) explains the similarities that were obtained for all the M. truncatula genes that were activated by P. fluorescens C7R12. Three of the P. fluorescens-induced M. truncatula genes encode transcription factors (a bZIP, TFIIB, and TFIIS), and five are involved in signal transduction (receptor-like kinase, CK2, small GTP-binding protein, protease inhibitor, and 14.3.3-like protein). The remaining encoded proteins are associated with primary metabolism (14), membrane transport (aquaporin PIP1.1, ABC transporter), cell division and cytoskeleton (putative DNA-binding protein, cell division protein 48, and F-actin capping protein), response to abiotic stimuli (ARG10, GH3-like protein, and auxin-induced Pro-rich protein) and defense (Pprg2 protein, beta glucosidase-like protein), and 14 genes code for proteins with unknown function. Although these genes are present in databases for M. truncatula, their role in plant-microbe interactions is largely unknown. Ten M. truncatula genes with putative functions in signal transduction (receptor-like kinase, CK2, small GTP-binding protein, protease inhibitor, and 14.3.3-like protein), in gene expression/RNA metabolism (bZIP transcription factor, homeodomain LZ, and TFIIS), in membrane transport (ABC transporter), and in abiotic stimuli responses and development (GH3-like protein) were investigated in more detail by semiquantitative RT-PCR. All the genes were significantly up-regulated during early colonization by P. fluorescens in wild-type M. truncatula roots, whereas, in the TRV25 genotype mutated for the DMI3 gene, only one gene (homeodomain LZ) showed enhanced expression in presence of the rhizobacteria. The DMI3 (syn. MtSYM13) gene of M. truncatula has recently been shown to encode a protein with high (approximately 73%) similarity to a calcium/calmodulin-dependent protein kinase (Lévy et al., 2004). The lack of plant gene response to P. fluorescens when the DMI3 gene is inactivated in the TRV25 mutant indicates a role for calcium in the cellular interactions between M. truncatula and the rhizobacterium.

Seven of the 10 M. truncatula genes activated by P. fluorescens are candidates for a signal transduction pathway, in which bacterial signal molecules may be perceived by receptor-like kinase and which requires the DMI3 gene. Among signal transduction-related genes up-regulated by P. fluorescens, small GTP-binding proteins, also termed G-proteins or GTPases, are important molecular regulators in the signal transduction chains of all eukaryotic cells. The small GTPase superfamily is divided into at least five families, including Ras, Rho, Rab, Arf, and Ran (Bischoff et al., 1999; Takai et al., 2001). The Rab, Arf, and Ran families are conserved in eukaryotes and directly participate in the regulation of eukaryotic hallmark cellular processes (Takai et al., 2001). The Ran proteins constitute a distinct branch of the small GTP-binding proteins (Valencia et al., 1991) of importance for regulation of several processes in cell nuclei (Dasso et al., 1994). Plant homologs have been identified in tomato (Lycopersicon esculentum; Ach and Gruissem, 1994), tobacco (Nicotiana tabacum; Merkle et al., 1994), Lotus japonicus (Borg et al., 1997), and Arabidopsis (Vernoud et al., 2003). The M. truncatula small GTP-binding protein identified in our study presents a strong sequence homology (90%) with Ljran1B (Z73960) isolated from nodules of L. japonicus (Borg et al., 1997), indicating that this small gene family may play a role in the establishment of different plant-microbe interactions.

CK2 is a ubiquitous Ser/Thr calcium-dependent protein kinase with a heterotetrameric structure composed by two catalytic (α or α′) and two regulatory (β) subunits, and is present in the cytoplasm and the nucleus of eukaryotic cells (Pinna, 1990; Allende and Allende, 1995). At present, more than 160 proteins have been recognized as endogenous substrates for CK2, including enzymes that control DNA and RNA synthesis, transcription and translation factors, and other proteins crucial for cell growth, proliferation, and differentiation (Allende and Allende, 1995). Possible candidates for target proteins of CK2 activity are TGA transcription factors like the bZIP transcription factor. Analyses using PFAM and SMART motif search engines revealed the presence of a CK2 phosphorylation site ([ST]-X(2)-[DE]; PS00006) not only for the bZIP transcription factor activated by P. fluorescens but also the 14.3.3-like protein of M. truncatula. Plant 14.3.3 proteins have been found associated with proteins of the G-box-binding complex (de Vetten et al., 1992; Lu et al., 1992), and phosphorylation of some G-box-binding factors stimulates DNA binding (Klimczak et al., 1992; Dröge-Laser et al., 1997). On numerous occasions, 14.3.3 proteins have been reported to interact with other proteins and protein kinases (Ferl, 1996; Morrison, 1994). For example, Camoni et al. (1998) showed that 14.3.3 proteins bind and activate a plant calcium-dependent protein kinase.

The GH3 gene identified in our study as up-regulated by P. fluorescens in wild-type M. truncatula is part of a small multigene family in soybean (Glycine max; Hagen et al., 1991), and related genes exist in Arabidopsis (Guilfoyle et al., 1993). It belongs to early auxin-responsive genes that are rapidly activated at the transcriptional level by auxin-related compounds (Hagen and Guilfoyle, 1985; McClure et al., 1989; Koshiba et al., 1995). No response of this gene was observed in the TRV25 mutant. This result is in agreement with the fact that a close relationship exists between calcium/calmodulin-mediated signaling and auxin-mediated signal transduction (Yang and Poovaiah, 2000). Proteins that are known to interact with the promoter of GH3 gene in plants include those belonging to the bZIP class of DNA-binding proteins (Landschultz et al., 1988). In this context, the TGA-box-like element of the bZIP transcription factor and the Hex-like element in the homeodomain LZ protein have been suggested to play some role in the regulation of the GH3 promoter. Homeodomain LZ proteins, found exclusively in plants (Ruberti et al., 1991; Lee and Chun, 1998; Söderman et al., 1999), are thought to be involved in regulating developmental processes associated with the response of plants to environmental conditions (Schena and Davis, 1992; Carabelli et al., 1993; Chan et al., 1998).

Common Molecular Events between Mycorrhiza- and P. fluorescens-Root Interactions

Sanchez et al. (2004) described activation of seven mycorrhiza-related genes in M. truncatula roots colonized by P. fluorescens 3 weeks after inoculation, none of which correspond to those reported here. When expression profiles of the 10 selected genes were analyzed during early stages of root colonization by G. mosseae or S. meliloti, the mycorrhizal fungus activated all the genes, whereas the N2-fixing bacterium only activated one and inhibited four others. None of the genes responded to inoculation by either microsymbiont in roots of the TRV25 mutant. The homeodomain LZ gene activated by P. fluorescens is up-regulated when appressoria of G. mosseae form on roots but down-regulated in roots inoculated S. meliloti in wild-type M. truncatula (J5). This observation is in agreement with data reported by El Yahyaoui et al. (2004), who showed that a homeobox LZ protein (MtC30157), presenting 78% similarity with LZ identified in our study, is down-regulated in young nodules of M. truncatula. Interestingly, activation by P. fluorescens of the LZ gene does not require the DMI3 gene but the latter is necessary for response to G. mosseae or S. meliloti, indicating different regulatory events in plant roots regarding the microorganisms. Likewise, the gene encoding a 14.3.3 protein is up-regulated by P. fluorescens and the AM fungus and down-regulated by S. meliloti in wild-type (J5) M. truncatula. This gene presents 75% similarity with a 14.3.3 gene (MtC10022) previously reported as down-regulated in early stages of the symbiotic interaction between M. truncatula and S. meliloti (El Yahyaoui et al., 2004). The GH3 gene identified in our study is also up-regulated by P. fluorescens and G. mosseae but down-regulated by S. meliloti. It has been shown that Nod factors can inhibit polar auxin transport prior to nodule formation (Mathésius et al., 1998), which may explain inhibition of the GH3 gene by S. meliloti. Moreover, it has previously been reported that G. mosseae, like P. fluorescens, can produce auxin (Barea and Azcon-Aguilar, 1982). Auxin may be translocated by the ABC transporter up-regulated by these microorganisms (Sidler et al., 1998). Only one gene, encoding a small GTP-binding protein (AJ864405), was shown to be activated by all three microorganisms during early interactions with roots of wild-type (J5) M. truncatula.

Do Common Molecular Events Relate to Host Range?

These data provide evidence for the existence of common molecular responses in M. truncatula to root colonization by the rhizobacterium P. fluorescens and the AM fungus G. mosseae, and pleads for different pathways for perception of S. meliloti signals. They reinforce conclusions of shared plant cell programs from a previous study showing greater similarity between root responses of M. truncatula to P. fluorescens and G. mosseae than to S. meliloti, at a later stage of root colonization 3 weeks after inoculation (Sanchez et al., 2004), and provide additional molecular markers for the fungal interaction. Although molecular and genetic similarities in cell programs involved in mycorrhizal- and nitrogen-fixing symbioses have previously been underlined (Albrecht et al., 1999; Kistner and Parniske, 2002) and some plant genes controlling symbiotic responses have been identified (Endre et al., 2002; Stracke et al., 2002; Ané et al., 2004; Lévy et al., 2004), differences obviously exist. Certain glycoproteins present in the infection thread matrix around bacteroids are not synthesized during mycorrhization (Gianinazzi-Pearson et al., 1990; Perotto et al., 1994), and the regulation of some plant genes is consistently different during mycorrhization and nodulation processes (Frühling et al., 1997; Uchiumi et al., 2002; Sanchez et al., 2004; Weidmann et al., 2004). Moreover, comparisons between mycorrhiza- and S. meliloti-induced M. truncatula genes identified on the basis of DNA arrays indicate that the overlap between the two root symbioses is probably limited (El Yahyaoui et al., 2004).

The differences observed between responses of M. truncatula to the three beneficial rhizospheric microorganisms may be linked to their degree of host specificity. While G. mosseae and P. fluorescens colonize the roots of a wide range of plants (Kloepper, 1994; Smith and Read, 1997), S. meliloti is the only microsymbiont showing host specificity (Dénarié et al., 1992; Perret et al., 2000). Pseudomonas encompasses arguably the most diverse and ecologically significant group of bacteria on the planet. Members of the genus are found in large numbers in all of the major natural environments (terrestrial, freshwater, and marine) and also form intimate associations with plants and animals. This universal distribution suggests a remarkable degree of physiological and genetic adaptability during evolution (Spiers et al., 2000), which probably also applies to AM fungi. In fact, the AM symbiosis is formed by the large majority of plant families and represents a much more ancient symbiosis than nodulation. Several lines of evidence suggest that AM originated 400 to 500 million years ago, together with terrestrial plants, while the legume-rhizobia symbiosis is more recent, originating 60 to 70 million years ago when the major angiosperm families diverged (Doyle and Doyle, 1997). Mycorrhizal fungi like G. mosseae are promiscuous, and form symbiosis with diverse groups of terrestrial plants including mosses, liverworts (Conocephalum conicum), pteridophytes, gymnosperms, and angiosperms (Read et al., 2000). The legume-rhizobia symbiosis, on the contrary, is frequently highly specific and different rhizobia nodulate taxonomically defined plant groups (Dénarié et al., 1992). The fact that fewer similarities exist in root responses of M. truncatula to S. meliloti than to G. mosseae and P. fluorescens may also be partly linked to the fact that root colonization by S. meliloti results in profound cellular reorganization of host-root tissues and in nodule formation while the two other symbionts colonize tissues endophytically without causing gross changes in root organization.

CONCLUSION

Root colonization by P. fluorescens C7R12 of two M. truncatula genotypes and early molecular responses to the beneficial rhizobacterium have been characterized. Plant genotype had little effect on root colonization profiles by the rhizobacterium while plant growth responses varied. Data on M. truncatula gene expression point to the activation of a plant signal transduction pathway that is linked to early sensing of P. fluorescens by root tissues. The similar response of the M. truncatula genes to G. mosseae provides evidence for common cell processes in the perception of microbial signals by plant roots in P. fluorescens and mycorrhizal interactions. This work reveals a key role of the DMI3 gene in P. fluorescens-M. truncatula interactions, indicating a role for calcium in recognition events triggered by the rhizobacterium, and opens new perspectives for understanding the molecular bases of beneficial plant-microbe associations.

MATERIALS AND METHODS

Microorganisms and Plants

Inoculum of Pseudomonas fluorescens strain C7R12 was prepared from cultures grown for 48 h at 25°C on King B medium (King et al., 1954). Bacteria were harvested, suspended in sterile distilled water, collected by centrifugation (9,875g, 20 min), and washed twice in sterile distilled water. The bacterial density was determined by measuring absorbance (A600).

Seeds of Medicago truncatula Gaertn. cv Jemalong wild-type line J5 and its mutant genotype TRV25 (DMI3) were surface sterilized for 6 min in 98% sulfuric acid, 5 min in 96% ethanol, 10 min in 3% calcium hypochlorite, and rinsed in sterile distilled water. Seeds were germinated on 0.7% Bactoagar (Difco Laboratories) at 25°C in the dark during 48 h. Terragreen (OilDri-US special grade) and Epoisses soil were sterilized for 4 h at 180°C, and 180 g of a Terragreen:soil mix (2:1, v/v) was placed in glass jars (750 mL) and then autoclaved twice at 24-h intervals. Five germinated seeds were transplanted per jar, and half the jars were inoculated with a bacterial suspension (106 g−1 dry substrate) in 70 mL of Long Ashton solution (Hewitt, 1966) enriched in iron (sequestrene 1 g L−1). The remaining half served as controls and received 70 mL of the modified Long Ashton solution. Plants were grown under constant conditions; 16/8-h photoperiod at 350 μmol m−2 s−1 (LI-189 LI-COR Radiations sensors) and 18°C/24°C night/day. Four, 6, 8, 14, and 21 dai with P. fluorescens, plants were harvested, weighed, and roots immediately stored in liquid nitrogen.

Seedlings of M. truncatula J5 and TRV25 were inoculated with Glomus mosseae isolate BEG12 or Sinorhizobium meliloti strain RC2011 as described by Weidmann et al. (2004). Inoculated plants and corresponding noninoculated controls were grown under the environmental conditions indicated above and harvested 5 dai for G. mosseae and 4 dai for S. meliloti.

Evaluation of Root Colonization

Appressorium formation in roots by G. mosseae was quantified microscopically 5 dai after staining root systems of three plants per experiment overnight in 0.05% trypan blue in glycerol (Weidmann et al., 2004). Root systems of 10 replicate inoculated plants and four noninoculated plants were sampled 4, 6, 8, 14, and 21 dai with P. fluorescens. To evaluate rhizoplane colonization, root systems were vortexed for 1 min in a sterile glass tube containing 5 mL of sterile distilled water. Bacteria density in the rhizosphere suspension was evaluated after incubation for 48 h at 25°C by quantification of cfu after plating serial dilutions of rhizosphere suspensions on King B agar. Rhizosphere colonization by S. meliloti was estimated 4 dai using the same protocol.

Vortexed root systems were recovered and disinfected for 10 min in 0.48% NaOCl, followed by four rinses in sterile distilled water. They were then vortexed again for 1 min in a sterile glass tube containing 1 mL of sterile distilled water. Disinfection was controlled by quantifying cfu after plating serial dilutions of this suspension on King B agar. Disinfected root systems were macerated in 1 mL of sterile distilled water with a sterile pestle and mortar. Macerates were vortexed for 30 s in sterile glass test tubes and 200 μL were spread on King B agar with sterile glass beads. After incubation for 48 h at 25°C, the numbers of cfu were determined to estimate endophytic bacteria colonization within roots.

Microscopy Observations of Root Colonization by P. fluorescens C7R12

Seedlings of M. truncatula J5 and TRV25 were grown in petri dishes on 1% water agar from seeds surface sterilized as described above. The petri dishes were sealed with Parafilm, placed at an angle of 60°, and incubated in the dark for 4 d at 25°C. Root tips were then spot inoculated with 1 μL of a suspension of 106 cells mL−1 of P. fluorescens C7R12, or 1 μL of sterile water as the control. Petri dishes were sealed again with Parafilm and incubated for another 4 d in the dark at 25°C.

Five-millimeter-long pieces of roots from the newly formed root tips of five separate M. truncatula J5 and TRV25 seedlings were sampled for microscopy. Root pieces were fixed in glutaraldehyde and embedded in LR White resin (London Resin) according to Gianinazzi and Gianinazzi-Pearson (1992). Semithin sections (0.5 μm) were cut with glass knives on an ultramichrotome (Reichert-Jung) and either stained with 0.1% toluidine blue for light microscopy observations or immunolabeled with P. fluorescens C7R12 polyclonal antibody using the silver-enhanced immunogold technique described by Gianinazzi and Gianinazzi-Pearson (1992). Ultrathin sections (0.1 μm) for transmission electron microscopy were cut with a diamond knife, collected on collodion carbon-coated gold grids, and stained with 2% uranyl acetate. Sections were examined in a Hitachi 7500 transmission electron microscope operating at 80 kV.

Total RNA Extraction and Deoxyribonuclease Treatment

Total RNA was isolated from M. truncatula roots, inoculated or not with a beneficial microorganism, according to the method of Franken and Gnädinger (1994), and treated with deoxyribonuclease (DNase) for 30 min at 37°C (25 μg total RNA, 40 units ribonuclease [RNase] inhibitor, 3 units RNase-free DNase, 6 μL 10× buffer, and diethyl pyrocarbonate [DEPC] water to 60 μL). The DNase was removed by phenol/chloroform/isoamyl alcohol (25:24:1) extraction, and RNA was precipitated overnight at −20°C (1/10 volume 3 m sodium acetate, 2.5 volume 95% ethanol) and then resuspended in DEPC water. RNA concentration was obtained from absorption values at A260 and A280.

SSH Library Construction

SSH was used to construct a cDNA library representing genes with increased expression during colonization of M. truncatula J5 roots by P. fluorescens C7R12. RNA extracted from 4-, 6-, and 8-d-old roots inoculated with P. fluorescens was mixed together (w/w/w), and RNA from noninoculated roots was similarly prepared. SSH was performed using Clontech's PCR select cDNA subtraction kit with 2 μg of control (from noninoculated roots) and tester mRNA (from inoculated roots), according to the instructions supplied by the manufacturer (CLONTECH). The resulting subtracted cDNA was cloned into the pGEM-T vector (Promega pGEM-T cloning kit) and transformed into competent JM-109 cells (Promega).

Reverse Northern Hybridization and EST Sequencing

The cDNA inserts from the SSH library clones were amplified by PCR using primers 18.1for (GTC ACG ACG TTG TAA AAC G) and 18.2rev (AGC TAT GAC CAT GAT TAC G) that are specific for the pGEM-T vector. PCR products were then loaded in duplicate onto 1.2% agarose gels, separated by gel electrophoresis, transferred to a Hybond-XL membrane (Amersham Bioscience) by capillarity blotting (Sambrook et al., 1989), and fixed under UV light (70,000 μJ cm−2). Reverse northern hybridization was performed with 32P-labeled cDNA probes obtained by RT-PCR from M. truncatula roots inoculated or not with P. fluorescens using Moloney murine leukemia virus (MMLV) RT. Total RNA (2.5 μg) was added to 1.5 μg oligodT15, deoxynucleoside triphosphate (2.5 mm adenosine, guanosine, thymidine, and 100 μm cytosine) and made up to a final volume of 11.5 μL with DEPC water. RNA was denatured for 5 min at 70°C, placed on ice and 5 μL MMLV 5× reaction buffer, 300 units MMLV RT, 80 units RNase inhibitor, and 50 μCi 32P deoxycitidine triphosphate were added. First-strand cDNA was synthesized by incubating for 15 min at 25°C, followed by 50 min at 42°C and 2 min at 96°C. The 32P-labeled cDNA was purified on ProbeQuant G-50 microcolumns (Amersham Bioscience) before denaturing for 5 min at 95°C. Membranes were hybridized and washed at 60°C as described by Church and Gilbert (1984). Hybridization signals were quantified in a Storm 860 phosphorimager with ImageQuant software (Molecular Dynamics, Amersham Bioscience) and normalized using hybridization signals obtained for the Mtgap1 gene (MtC00030_GC) encoding a glyceraldehyde phosphate dehydrogenase.

ESTs corresponding to genes giving a 2-fold greater hybridization signal with probes from P. fluorescens-inoculated than noninoculated roots were sequenced using T7 and SP6 primers (MWG-Biotech). Sequences of cDNA (accession nos. AJ864402–AJ864459) were compared using BlastN and BlastX algorithms with sequences in the TIGR M. truncatula gene index database (http://www.tigr.org/tdb/tgi/ntgi) to identify similarities at nucleic and amino acid levels.

Semiquantitative RT-PCR

Semiquantitative RT-PCR was performed according to Taylor and Harrier (2003). cDNA was prepared from 1 μg total RNA added to 1.5 μg oligodT15, dNTP (2.5 mm each), and made up to a final volume of 11.5 μL with sterile distilled water. RNA was denatured for 5 min at 70°C, placed on ice and 5 μL MMLV 5× reaction buffer, 300 units MMLV RT, and 80 units RNase inhibitor were added. First-strand cDNA was synthesized at 25°C for 15 min, followed by 50 min at 42°C and 2 min at 96°C. Gene-specific fragments were amplified by PCR using the primers, annealing temperature, and number of cycles described in Table II. Amplification was 95°C for 5 min, 93°C for 45 s, annealing for 45 s, 72°C for 1 min, and a final extension at 72°C for 5 min. Amplification products were analyzed by 1.2% agarose gel electrophoresis, stained with ethidium bromide, and quantified in a Storm 860 phosphorimager with ImageQuant software (Molecular Dynamics, Amersham Bioscience).

The Mtgap1 gene was used as an active reference control for equivalent RT to cDNA and equivalent amplification in the PCR. Constitutive levels of expression were checked by semiquantitative PCR of transcripts on cDNA synthesized from RNA of M. truncatula roots inoculated or not with one of the beneficial microorganisms as described above. PCR was performed on RT products at 18, 20, and 22 cycles using specific primers of the Mtgap1 gene (Table II) designed from the consensus sequence of the Mtgap1 cluster MtC00030_GC (http://medicago.toulouse.inra.fr/Mt/EST:DOC/MtB.html). PCR was performed as described above except at an annealing temperature of 56°C. Amplification products were analyzed and quantified as described above.

Statistical Analyses

Data from growth parameters, quantification of cfu, and semiquantitative PCR evaluations of gene expression of replicate RNA batches from three independent pools of plants were statistically compared between noninoculated and treatments, using the Student's t test.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AJ864402 to AJ864459.

Acknowledgments

The authors are grateful to G. Duc (URLEG-INRA, Dijon, France) for seeds of M. truncatula and to P. Lemanceau (MGS-INRA, Dijon, France) for P. fluorescens starter cultures and antibodies.

1

This work was supported by the Institut National de Recherche Agronomique and the Burgundy Regional Council, France.

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.067603.

References

  1. Ach RA, Gruissem W (1994) A small nuclear GTP-binding protein from tomato suppresses a Schizosaccharomyces pombe cell-cycle mutant. Proc Natl Acad Sci USA 91: 5863–5867 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Albrecht C, Geurts R, Bisseling T (1999) Legume nodulation and mycorrhizae formation: two extremes in host specificity meet. EMBO J 18: 281–288 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Allende JE, Allende CC (1995) Protein kinase CK2: an enzyme with multiple substrates and puzzling regulation. FASEB J 9: 313–323 [DOI] [PubMed] [Google Scholar]
  4. Ané JM, Kiss GB, Riely BK, Pensmetsa RV, Oldroyd GED, Ayax C, Lévy J, Debellé F, Baek JM, Kalo P, et al (2004) Medicago truncatula DMI1 required for bacterial and fungal symbioses in legumes. Science 303: 1364–1367 [DOI] [PubMed] [Google Scholar]
  5. Barea JM, Azcon-Aguilar C (1982) Production of plant growth-regulating substances by the vesicular-arbuscular mycorrhizal fungus Glomus mosseae. Appl Environ Microbiol 43: 810–813 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Beyer K, Binder A, Boller T, Collinge M (2001) Identification of potato genes induced during colonization by Phytophthora infestans. Mol Plant Pathol 2: 125–134 [DOI] [PubMed] [Google Scholar]
  7. Beyer K, Jimenez SJ, Randall TA, Lam S, Binder A, Boller T, Collinge M (2002) Characterization of Phytophthora infestans genes regulated during the interaction with potato. Mol Plant Pathol 3: 473–485 [DOI] [PubMed] [Google Scholar]
  8. Bischoff F, Molendijk A, Rajendrakumal CS, Palme K (1999) GTP-binding proteins in plants. Cell Mol Life Sci 55: 233–256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Blondon F, Marie D, Brown S, Kondorosi A (1994) Genome size and base composition in Medicago sativa and Medicago truncatula species. Genome 37: 264–270 [DOI] [PubMed] [Google Scholar]
  10. Borg S, Brandstrup B, Jensen TJ, Poulsen C (1997) Identification of new protein species among 33 different small GTP-binding proteins encoded by cDNAs from Lotus japonicus, and expression of corresponding mRNAs in developing root nodules. Plant J 11: 237–250 [DOI] [PubMed] [Google Scholar]
  11. Brechenmacher L, Weidmann S, Van Tuinen D, Chatagnier O, Gianinazzi S, Franken P, Gianinazzi-Pearson V (2004) Expression profiling of up-regulated plant and fungal genes in early and late stages of Medicago truncatula-Glomus mosseae interactions. Mycorrhiza 14: 253–262 [DOI] [PubMed] [Google Scholar]
  12. Camoni L, Harper JF, Palmgren MG (1998) 14-3-3 proteins activate a plant calcium-dependent protein kinase (CDPK). FEBS Lett 430: 381–384 [DOI] [PubMed] [Google Scholar]
  13. Carabelli M, Sessa G, Baima S, Morelli G, Ruberti I (1993) The Arabidopsis Athb-2 and -4 genes are strongly induced by far-red-rich light. Plant J 4: 469–479 [DOI] [PubMed] [Google Scholar]
  14. Cartieaux F, Thibaud MC, Zimmerli L, Lessard P, Sarrobert C, David P, Gerbaud A, Robaglia C, Somerville S, Nussaume L (2003) Transcriptome analysis of Arabidopsis colonized by a plant-growth promoting rhizobacterium reveals a general effect on disease resistance. Plant J 36: 177–188 [DOI] [PubMed] [Google Scholar]
  15. Catoira R, Galera R, de Billy F, Penmetsa V, Journet EP, Mailler F, Rosenberg C, Cook D, Gough C, Dénarié J (2000) Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway. Plant Cell 12: 1647–1665 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Chan RL, Gago GM, Palena CM, Gonzalez DH (1998) Homeoboxes in plant development. Biochim Biophys Acta 23: 1–19 [DOI] [PubMed] [Google Scholar]
  17. Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81: 1991–1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dasso M, Seki T, Azuma Y, Ohba T, Nishimoto T (1994) A mutant form of the Ran/TC4 protein disrupts nuclear function in Xenopus laevis egg extracts by inhibiting the RCC1 protein, a regulator of chromosome condensation. EMBO J 13: 5732–5744 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dénarié J, Debellé F, Rosenberg C (1992) Signaling and host range variation in nodulation. Annu Rev Microbiol 46: 497–531 [DOI] [PubMed] [Google Scholar]
  20. de Vetten NC, Lu G, Ferl RJ (1992) A maize protein associated with the G-box binding complex has homology to brain regulatory proteins. Plant Cell 4: 1295–1307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93: 6025–6030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Doyle JJ, Doyle JL (1997) Phylogenetic perspectives on the origins and evolution of nodulation in the legumes and allies. In A Legocki, H Bothe, A Puhler, eds, Biological Fixation of Nitrogen for Ecology and Sustainable Agriculture. Springer-Verlag, Berlin/Heidelberg, pp 307–312
  23. Dröge-Laser W, Kaiser A, Lindsay W, Halkier BA, Loake GJ, Doerner P, Dixon RA, Lamb C (1997) Rapid stimulation of a soybean protein-serine kinase that phosphorylates a novel bZIP DNA-binding protein, G/HBF-1, during the induction of early transcription-dependent defences. EMBO J 16: 726–738 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ellis RJ, Timms-Wilson TM, Bailey MJ (2000) Identification of conserved traits in fluorescent pseudomonads with antifungal activity. Environ Microbiol 2: 274–284 [DOI] [PubMed] [Google Scholar]
  25. El Yahyaoui F, Küster H, Ben Amor B, Hohnjec N, Pühler A, Becker A, Gouzy J, Vernié T, Gough C, Niebel A, et al (2004) Expression profiling in Medicago truncatula identifies more than 750 genes differentially expressed during nodulation, including many potential regulators of the symbiotic program. Plant Physiol 136: 3159–3176 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Endre G, Kereszt A, Kevei Z, Mihacea S, Kalo P, Kiss GB (2002) A receptor kinase gene regulating symbiotic nodule development. Nature 417: 962–966 [DOI] [PubMed] [Google Scholar]
  27. Eparvier A, Lemanceau P, Alabouvette C (1991) Population dynamics of non-pathogenic Fusarium and fluorescent Pseudomonas strains in rockwool, a substratum for soilless culture. FEMS Microbiol Ecol 86: 177–184 [Google Scholar]
  28. Ferl RJ (1996) 14-3-3 proteins and signal transduction. Annu Rev Plant Physiol Plant Mol Biol 47: 49–73 [DOI] [PubMed] [Google Scholar]
  29. Franken P, Gnädinger F (1994) Analysis of parsley arbuscular endomycorrhiza: infection development and mRNA levels of defense-related genes. Mol Plant Microbe Interact 7: 612–620 [Google Scholar]
  30. Franssen HJ, Vijn I, Yang WC, Bisseling T (1992) Developmental aspects of the Rhizobium-legume symbiosis. Plant Mol Biol 19: 89–107 [DOI] [PubMed] [Google Scholar]
  31. Frühling M, Roussel H, Gianinazzi-Pearson V, Pühler A, Perlick AM (1997) The Vicia faba leghemoglobin gene VfLb29 is induced in root nodules and in roots colonized by the arbuscular mycorrhizal fungus Glomus fasciculatum. Mol Plant Microbe Interact 10: 124–131 [DOI] [PubMed] [Google Scholar]
  32. Gamalero E, Fracchia L, Cavaletto M, Garbaye J, Frey-Klett P, Varese GC, Martinotti MG (2003) Characterization of functional traits of two fluorescent pseudomonads isolated from basidiomes of ectomycorrhizal fungi. Soil Biol Biochem 35: 55–65 [Google Scholar]
  33. Gianinazzi-Pearson V, Gianinazzi S, Brewin NJ (1990) Immunocytochemical localization on antigenic sites in the perisymbiotic membrane of vesicular-arbuscular endomycorrhiza using monoclonal antibodies reacting against the peribacteroid membrane of nodules. In P Nardon, V Gianinazzi-Pearson, AM Grenier, L Margulis, DC Smith, eds, Endocytobiology IV. Institut National de la Recherche Agronomique, Paris, pp 127–131
  34. Gianinazzi S, Gianinazzi-Pearson V (1992) Cytology, histochemistry and immunocytochemistry as tools for studying structure and function of endomycorrhiza. Methods Microbiol 24: 109–139 [Google Scholar]
  35. Guilfoyle TJ, Hagen G, Li Y, Ulmasov T, Liu ZB, Strabala T, Gee MA (1993) Auxin-regulated transcription. Aust J Plant Physiol 20: 489–502 [Google Scholar]
  36. Hagen G, Guilfoyle TJ (1985) Rapid induction of selective transcription by auxins. Mol Cell Biol 5: 1197–1203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Hagen G, Martin G, Li Y, Guilfoyle TJ (1991) Auxin-induced expressed of the soybean gh3 promoter in transgenic tobacco plants. Plant Mol Biol 17: 567–579 [DOI] [PubMed] [Google Scholar]
  38. Hewitt EJ (1966) Sand and Water Culture Methods Used in Studies of Plant Nutrition. Commonwealth Agricultural Bureau, London
  39. Hirsch AM, Bauer WD, Bird DM, Cullimore J, Tyler B, Yoder JI (2003) Molecular signals and receptors: controlling rhizosphere interactions between plants and other organisms. Ecology 84: 858–868 [Google Scholar]
  40. King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of pyocianin and fluorescin. J Lab Clin Med 44: 301–307 [PubMed] [Google Scholar]
  41. Kistner C, Parniske M (2002) Evolution of signal transduction in intracellular symbiosis. Trends Plant Sci 7: 511–518 [DOI] [PubMed] [Google Scholar]
  42. Klimczak LJ, Schindler U, Cashmore AR (1992) DNA binding activity of the Arabidopsis G-box binding factor GBF1 is stimulated by phosphorylation by casein kinase II from broccoli. Plant Cell 4: 87–98 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Kloepper JW (1994) Plant growth-promoting rhizobacteria (other systems). In Y Okon, ed, Azospirillum/Plant Associations. CRC Press, Boca Raton, FL, pp 111–118
  44. Kloepper JW, Schroth MN (1978) Plant growth-promoting rhizobacteria in radish. In Proceedings of the 4th International Conference on Plant Pathogenic Bacteria, Vol 2. INRA, Angers, France, pp 879–882
  45. Koshiba T, Ballas N, Wong LM, Theologis A (1995) Transcriptional regulation of PS-IAA4/5 and PS-IAA6 early gene expression by indoleacetic acid and protein synthesis inhibitors in pea (Pisum sativum). J Mol Biol 253: 396–413 [DOI] [PubMed] [Google Scholar]
  46. Landschultz WH, Johnson PF, McKnight SL (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240: 1759–1764 [DOI] [PubMed] [Google Scholar]
  47. Lee YH, Chun JY (1998) A new homeodomain-leucine zipper gene from Arabidopsis thaliana induced by water stress and abscisic acid treatment. Plant Mol Biol 37: 377–384 [DOI] [PubMed] [Google Scholar]
  48. Lemanceau P, Alabouvette C (1991) Biological control of fusarium diseases by fluorescent Pseudomonas and nonpathogenic Fusarium. Crop Prot 10: 279–286 [Google Scholar]
  49. Lemanceau P, Samson R, Alabouvette C (1988) Recherches sur la résistance des sols aux maladies. XV. Comparaison des populations de Pseudomonas fluorescents dans un sol résistant et un sol sensible aux fusarioses vasculaires. Agronomie (Paris) 8: 243–249 [Google Scholar]
  50. Lévy J, Bres C, Geurts R, Chalhoub B, Kulikova O, Duc G, Journet E-P, Ané J-M, Lauber E, Bisseling T, et al (2004) A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303: 1361–1364 [DOI] [PubMed] [Google Scholar]
  51. Lu G, DeLisle AJ, de Vetten NC, Ferl MJ (1992) Brain proteins in plants: an Arabidopsis homolog to neurotransmitter pathway activators is part of a DNA binding complex. Proc Natl Acad Sci USA 89: 11490–11494 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Mathésius U, Schlaman HRM, Spaink HP, Sautter C, Rolfe BG, Djordjevic MA (1998) Auxin transport inhibition precedes nodule formation in white clover roots and is regulated by flavonoids and derivatives of chitin oligosaccharides. Plant J 14: 23–34 [DOI] [PubMed] [Google Scholar]
  53. McClure BA, Hagen G, Brown CS, Gee MA, Guilfoyle TJ (1989) Transcription, organization, and sequence of an auxin-regulated gene cluster in soybean. Plant Cell 1: 229–239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Merkle T, Haizel T, Matsumoto T, Harter K, Dallmann G, Nagy F (1994) Phenotype of the fission yeast cell cycle regulatory mutant pim1-46 is suppressed by a tobacco cDNA encoding a small, Ran-like GTP-binding protein. Plant J 6: 555–565 [DOI] [PubMed] [Google Scholar]
  55. Mitra RM, Gleason CA, Edwards A, Hadfield J, Downie JA, Oldroyd GE, Long SR (2004) A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: gene identification by transcript-based cloning. Proc Natl Acad Sci USA 101: 4701–4705 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Morandi D, Gollotte A, Camporota P (2002) Influence of an arbuscular mycorrhizal fungus on the interaction of a binucleate Rhizoctonia species with Myc+ and Myc− pea roots. Mycorrhiza 12: 97–102 [DOI] [PubMed] [Google Scholar]
  57. Morandi D, Prado E, Sagan M, Duc G (2005) Characterisation of new symbiotic Medicago truncatula (Gaertn.) mutants, and phenotypic or genotypic complementary information on previously described mutants. Mycorrhiza 15: 283–289 [DOI] [PubMed] [Google Scholar]
  58. Morrison D (1994) 14-3-3: modulators of signaling proteins. Science 266: 56–57 [DOI] [PubMed] [Google Scholar]
  59. Patten CL, Glick BR (2002) Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Appl Environ Microbiol 68: 3795–3801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Penmetsa RV, Cook DR (2000) Production and characterization of diverse developmental mutants of Medicago truncatula. Plant Physiol 123: 1387–1397 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Perotto S, Brewin NJ, Bonfante P (1994) Colonization of pea roots by the mycorrhizal fungus Glomus versiforme and by Rhizobium bacteria: immunological comparison using monoclonal antibodies as probes for plant cell surface components. Mol Plant Microbe Interact 7: 91–98 [Google Scholar]
  62. Perret X, Staehelin C, Broughton WJ (2000) Molecular basis of symbiotic promiscuity. Microbiol Mol Biol Rev 64: 180–201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Pinna LA (1990) Casein kinase 2: an “eminence grise” in cellular regulation? Biochim Biophys Acta 1054: 267–284 [DOI] [PubMed] [Google Scholar]
  64. Read DJ, Duckett JG, Francis R, Ligrone R, Russel A (2000) Symbiotic fungal associations in “lower” land plants. Philos Trans R Soc Biol Sci 355: 815–831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Requena N, Mann P, Hampp R, Franken P (2002) Early developmentally regulated genes in the arbuscular mycorrhizal fungus Glomus mosseae: identification of GmGIN1, a novel gene with homology to the C-terminus of metazoan hedgehog proteins. Plant Soil 244: 129–139 [Google Scholar]
  66. Ruberti I, Sessa G, Lucchetti S, Morelli G (1991) A novel class of plant proteins containing a homeodomain with a closely linked leucine zipper motif. EMBO J 10: 1787–1791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Sagan M, Morandi D, Tarenghi E, Duc G (1995) Selection of nodulation and mycorrhizal mutants in the model plant Medicago truncatula (Gaertn) after gamma-ray mutagenesis. Plant Sci 111: 63–71 [Google Scholar]
  68. Sambrook J, Fritsch EJ, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  69. Sanchez L, Weidmann S, Brechenmacher L, Batoux M, van Tuinen D, Lemanceau P, Gianinazzi S, Gianinazzi-Pearson V (2004) Common gene expression in Medicago truncatula roots in response to Pseudomonas fluorescens colonization, mycorrhiza development and nodule formation. New Phytol 161: 855–863 [DOI] [PubMed] [Google Scholar]
  70. Schena M, Davis RW (1992) HD-Zip proteins: members of an Arabidopsis homeodomain protein superfamily. Proc Natl Acad Sci USA 89: 3894–3898 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Schüssler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol Res 105: 1413–1421 [Google Scholar]
  72. Sibéril Y, Doireau P, Gantet P (2001) Plant bZIP G-box binding factors: modular structure and activation mechanisms. Eur J Biochem 268: 5655–5666 [DOI] [PubMed] [Google Scholar]
  73. Sidler M, Hassa P, Hasan S, Ringli C, Dudler R (1998) Involvement of an ABC transporter in a developmental pathway regulating hypocotyl cell elongation in the light. Plant Cell 10: 1623–1636 [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Sivan A, Chet I (1992) Microbial control of plant diseases. In R Mitchell, ed, Environmental Microbiology. Wiley-Liss, New York, pp 335–354
  75. Smith SE, Read DJ (1997) Mycorrhiza Symbiosis, Ed 2. Academic Press, San Diego
  76. Söderman E, Hjellstrom M, Fahleson J, Engstrom P (1999) The HD-Zip gene ATHB6 in Arabidopsis is expressed in developing leaves, roots and carpels and up-regulated by water deficit conditions. Plant Mol Biol 40: 1073–1083 [DOI] [PubMed] [Google Scholar]
  77. Spiers AJ, Buckling A, Rainey PB (2000) The causes of Pseudomonas diversity. Microbiology 146: 2345–2350 [DOI] [PubMed] [Google Scholar]
  78. Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, Szczyglowski K, et al (2002) A plant receptor-like kinase required for both bacterial and fungal symbiosis. Nature 417: 959–962 [DOI] [PubMed] [Google Scholar]
  79. Subba Rao NS (1982) Advances in agricultural microbiology. In NS Subba Rao, ed, Studies in the Agricultural and Food Sciences. Butterworth Scientific, London, pp 295–303
  80. Takai Y, Sasaki T, Matozaki T (2001) Small GTP-binding proteins. Physiol Rev 81: 153–208 [DOI] [PubMed] [Google Scholar]
  81. Taylor J, Harrier L (2003) Expression studies of plant genes differentially expressed in leaf and root tissues of tomato colonised by the arbuscular mycorrhizal fungus Glomus mosseae. Plant Mol Biol 51: 619–629 [DOI] [PubMed] [Google Scholar]
  82. Thomashow LS, Bangera MG, Bonsall RF, Kim DS, Raaijmakers J, Weller DM (1996) 2,4-Diacetylphloroglucinol, a key antibiotic in soilborne pathogen suppression by fluorescent Pseudomonas spp. In G Stacey, B Mullin, PM Gresshoff, eds, Biology of Plant-Microbe Interactions. International Society for Molecular Plant-Microbe Interactions, St. Paul, pp 469–474
  83. Uchiumi T, Shimoda Y, Tsuruta T, Mukoyoshi Y, Suzuki A, Seeno K, Sato S, Kato T, Tabata S, Higashi S, et al (2002) Expression of symbiotic and nonsymbiotic globin genes responding to microsymbionts on Lotus japonicus. Plant Cell Physiol 43: 1351–1358 [DOI] [PubMed] [Google Scholar]
  84. Valencia A, Chardin P, Wittinghofer A, Sander C (1991) The ras protein family: evolutionary tree and role of conserved amino acids. Biochemistry 30: 4637–4648 [DOI] [PubMed] [Google Scholar]
  85. Verhagen BW, Glazebrook J, Zhu T, Chang HS, van Loon LC, Pieterse CM (2004) The transcriptome of rhizobacteria-induced systemic resistance in Arabidopsis. Mol Plant Microbe Interact 17: 895–908 [DOI] [PubMed] [Google Scholar]
  86. Vernoud V, Horton AC, Yang Z, Nielsen E (2003) Analysis of the small GTPase gene superfamily of Arabidopsis. Plant Physiol 131: 1191–1208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. von Stein OD, Thies WG, Hofmann M (1997) A high throughput screening for rarely transcribed differentially expressed genes. Nucleic Acids Res 25: 2598–2602 [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Wang Y, Ohara Y, Nakayashiki H, Tosa Y, Mayama S (2005) Microarray analysis of the gene expression profile induced by the endophytic plant growth-promoting rhizobacteria Pseudomonas fluorescens FPT9601-T5 in Arabidopsis. Mol Plant Microbe Interact 18: 385–396 [DOI] [PubMed] [Google Scholar]
  89. Weidmann S, Sanchez L, Descombin J, Chatagnier O, Gianinazzi S, Gianinazzi-Pearson V (2004) Fungal elicitation of signal transduction-related plant genes precedes mycorrhiza establishment and requires the dmi3 gene in Medicago truncatula. Mol Plant Microbe Interact 17: 1385–1393 [DOI] [PubMed] [Google Scholar]
  90. Whipps JM (2001) Microbial interactions and biocontrol in the rhizosphere. J Exp Bot 52: 487–511 [DOI] [PubMed] [Google Scholar]
  91. Wulf A, Manthey K, Doll J, Perlick AM, Linke B, Bekel T, Meyer F, Franken P, Küster H, Krajinsky F (2003) Transcriptional changes in response to arbuscular mycorrhiza development in the model plant Medicago truncatula. Mol Plant Microbe Interact 16: 306–314 [DOI] [PubMed] [Google Scholar]
  92. Xie H, Pasternak JJ, Glick BR (1996) Isolation and characterization of mutants of the plant growth-promoting rhizobacterium Pseudomonas putida GR12-2 that overproduce indole acetic acid. Curr Microbiol 32: 67–71 [Google Scholar]
  93. Yang T, Poovaiah BW (2000) Molecular and biochemical evidence for the involvement of calcium/calmodulin in auxin action. J Biol Chem 275: 3137–3143 [DOI] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES