Skip to main content
NCBI home page
Molecular Biology of the Cell logoLink to Molecular Biology of the Cell
. 2025 Sep 17;36(11):br30. doi: 10.1091/mbc.E25-05-0214

Robust CENP-A incorporation in human cells is independent of transcription and cohesin components

Reito Watanabe a, Carlos Perea-Resa b, Michael D Blower a,*
Editor: Sarah Wignallc
PMCID: PMC12562020  PMID: 40961235

Abstract

Centromeres are essential chromosomal components that ensure proper cell division by serving as assembly sites for kinetochores, which connect chromosomes to spindle microtubules. Centromeres are marked by the evolutionarily conserved centromere-specific histone H3 variant, CENP-A, which is deposited into centromere nucleosomes during G1 in human cells. Centromeres retain cohesin, a ring-like protein complex, during mitosis, protecting sister chromatid cohesion and centromere transcription to prevent chromosome missegregation. Previous work in Drosophila has suggested that centromere transcription and centromeric RNAs are important for CENP-A deposition in chromatin. During mitosis, centromeric cohesin is critical for centromere transcription. However, it is not clear how or whether centromeric transcription and cohesin contribute to CENP-A deposition in G1 in human cells. To address these questions, we combined a cell synchronization strategy with the Auxin Inducible Degron technology and transcription inhibition in human cells. In contrast with Drosophila cells, our results demonstrated that neither centromeric transcription nor cohesin is required for CENP-A deposition in human cells. Our data demonstrate clear differences in the CENP-A deposition mechanism between human and Drosophila cells. These findings provide deeper insights into the plasticity underlying centromere maintenance and highlight evolutionary divergence in centromere maintenance systems across species.

  • CENP-A is the epigenetic mark for centromeres and is deposited in a replication-independent manner in G1. The details of CENP-A chromatin deposition are not clear.

  • Centromeres are transcribed during mitosis in a cohesin-dependent manner. Centromere transcription has been proposed to promote CENP-A chromatin deposition in G1.

  • We find that centromere transcription and cohesin are not required for CENP-A deposition in G1 in human cells. Our results highlight evolutionary differences in CENP-A deposition pathways.

INTRODUCTION

Chromosomes are equally distributed to daughter cells during mitosis through attachment of sister chromatids to the spindle microtubules by the kinetochore, which is assembled on centromeric DNA (Fukagawa and Earnshaw, 2014; McKinley and Cheeseman, 2016). Centromeres are epigenetically defined by the presence of the evolutionarily conserved centromere-specific histone H3 variant, Centromere protein A, CENP-A, which is deposited into centromere nucleosomes during G1 in human cells (Earnshaw and Rothfield, 1985; Palmer et al., 1991; Meluh et al., 1998; Henikoff et al., 2000; Blower and Karpen, 2001; Régnier et al., 2003; Black et al., 2004; 2007; Foltz et al., 2006; Fujita et al., 2007; Jansen et al., 2007; Sekulic et al., 2010). Artificial tethering of CENP-A to noncentromeric chromatin induced de novo centromeres in many organisms, which were epigenetically maintained after the tethering was removed (Heun et al., 2006; Dunleavy et al., 2009; Foltz et al., 2009; Barnhart et al., 2011; Bassett et al., 2012; Chen et al., 2014; Hori et al., 2012). In addition, CENP-A is required for faithful chromosome segregation and for the proper localization of most kinetochore proteins to centromeres (Howman et al., 2000; Oegema et al., 2001; Hayashi et al., 2004; Foltz et al., 2006). Thus, a significant question is how CENP-A deposits into centromere nucleosomes. Previously, work showed that the Mis18 complex, composed of Mis18α, Mis18β, and M18BP1/KNL2(KNL2), recruits HJURP-CENP-A to centromeres in many vertebrates (Hayashi et al., 2004; Jansen et al., 2007; Maddox et al., 2007; Erhardt et al., 2008; Dunleavy et al., 2009; Foltz et al., 2009; Shuaib et al., 2010; Moree et al., 2011; Dambacher et al., 2012; Hori et al., 2017). The process is tightly regulated by phosphorylation during the cell cycle to ensure that CENP-A loading occurs in G1 (Silva et al., 2012; McKinley and Cheeseman, 2014; Müller et al., 2014; Wang et al., 2014; Yu et al., 2015; Pan et al., 2017; Stankovic et al., 2017; French and Straight, 2019a; Flores Servin et al., 2023). DNA replication dilutes chromatin-bound CENP-A, and these genomic sites are filled by placeholder conventional H3-containing nucleosomes. It is not yet clear how placeholder nucleosomes are removed from chromatin during CENP-A deposition in G1.

Transcription through centromeric chromatin has been proposed as a mechanism that could evict placeholder H3 nucleosomes from centromere chromatin. Recent work has demonstrated that centromeres are transcribed by RNA polymerase II (RNAP II) during the cell cycle in many different organisms (Wong et al., 2007; Li et al., 2008; Ferri et al., 2009; Choi et al., 2011; Ohkuni and Kitagawa, 2011; Chan et al., 2012; Chan and Wong, 2012; Rošić et al., 2014; Catania et al., 2015; Liu et al., 2015; Blower, 2016; McNulty et al., 2017; Perea-Resa et al., 2020). Centromere transcription is regulated by CENP-B, CENP-I, and CENP-C, which are constitutively associated with centromere chromatin (Bury et al., 2020; Chen et al., 2021; Hirai et al., 2022; Sikder et al., 2025). Centromeric RNAs are required for CENP-A maintenance, kinetochore assembly, and accurate chromosome segregation (Chan et al., 2012; Rošić et al., 2014; Liu et al., 2015; Blower, 2016; McNulty et al., 2017; Bobkov et al., 2018; Perea-Resa et al., 2020). Removal of H3K4me2 in human artificial chromosomes reduces local transcription, localization of HJURP, and CENP-A (Bergmann et al., 2011). In addition, the Facilitates Chromatin Transcription (FACT) complex is essential for maintaining CENP-A in chickens and flies (Okada et al., 2009; Deyter and Biggins, 2014; Chen et al., 2015). In addition, one group suggested centromere transcription is required for the proper CENP-A localization at centromeres (Quénet and Dalal, 2014). Collectively, these findings suggest that transcription may contribute to CENP-A maintenance or deposition. However, considering that centromere RNA mediates CENP-A incorporation and kinetochore formation, a short-term experimental system with specific transcription inhibition is needed to investigate the importance of transcription or chromatin remodeling itself in CENP-A incorporation. Work in Drosophila cells using transcription inhibitors has shown that transcription is vital for incorporating CID/dCENP-A into complete nucleosomes (Bobkov et al., 2018). On the other hand, a recent study suggested that transcription was not required for CENP-A incorporation during Drosophila embryogenesis (Ghosh and Lehner, 2022). From these conflicting observations, it is not clear whether transcription facilitates CENP-A incorporation at native centromeres.

During mitosis, centromere transcription is mediated by the retention of cohesin, a ring-like protein complex that protects physical cohesion between sister chromatids (Peters et al., 2008; Perea-Resa et al., 2020). Interestingly, a recent paper showed that centromere transcription also mediated mitotic cohesion, suggesting a positive feedback mechanism between cohesin and transcription (Chen et al., 2021). Cohesin is a multiprotein complex comprising core subunits Smc1, Smc3, and Rad21, and either STAG1 or STAG2 (Losada et al., 2000; Peters et al., 2008; Arruda et al., 2020; Casa et al., 2020; Horsfield, 2023). Cohesin is important for extruding DNA into loops and may promote transcription through regulating enhancer-promoter contacts. Because cohesin promotes mitotic centromere transcription, it is possible that cohesin is involved in CENP-A loading in G1. In this work, focusing on human cells, we examine the functional importance of cohesin and transcription in CENP-A deposition with specific transcription inhibitors and a rapid protein degradation system.

RESULTS AND DISCUSSION

Rapid depletion of cohesin components does not affect newly synthesized CENP-A localization to centromeres in human cells

To examine the importance of cohesin components for newly synthesized CENP-A localization in human cells, we combined the pulse chase CENP-A labeling assay with auxin-inducible degron 2 (AID2) system targeting cohesin components and M18BP1/KNL2 (KNL2) (Jansen et al., 2007; Nishimura et al., 2009; Yesbolatova et al., 2020), which is an essential factor of CENP-A recruitment (Supplemental Figure S1, A and B). In brief, cells were synchronized at the G1–S boundary by a thymidine block for 24 h, and SNAP-Cell Block quenched nucleosomal CENP-A. Then, cells were released into nocodazole, and newly synthesized cytoplasmic CENP-A-SNAP was labeled with SNAP-TMR. We then removed SNAP-TMR and triggered protein degradation using the addition of 5-Ph-IAA, followed by measurement of centromeric CENP-A-SNAP-TMR in G1 cells. Rapid KNL2 depletion during mitosis to the G1 phase caused defects in the CENP-A localization consistent with previous reports (Figure 1, A and B; Supplemental Figure S1D).

FIGURE 1:

FIGURE 1:

Open in a new tab

Cohesin components are not required for newly synthesized CENP-A localization in cells. (A) Schematic representation of the experiment (left). The protein levels of endogenous KNL2, Rad21, STAG1, and STAG2, which were tagged with AID and GFP in human DLD1 cells constitutively expressing TIR1-F74G (middle). AID-tagged protein was conditionally depleted by 5-Ph-IAA (IAA) addition. The bar graph indicates the mean of signal intensity of AID-tagged protein with SD from an average of two replicates (right). (B) Schematic representation of the experiment (top). Localization of GFP-fused KNL2 (green) and newly deposited CENP-A-SNAP labeled with SNAP-TMR (red) during G1 phase 3 h after the IAA addition. Centromeres were stained by CREST as a marker (blue). Images are max-projected from z-stacks. GFP and TMR signals on centromeres were quantified. Each dot indicates a signal from one centromere. The bar graph indicates the mean with SD from an average of three replicates. (C) Schematic representation of the experiment (top). Localization of GFP-fused Rad21 or STAG1/2 (green) and newly deposited CENP-A-SNAP was stained with SNAP-TMR (red) during G1 phase at 3 h after the IAA addition or a combination of 6 h of α-amanitin with IAA for 3 h (IAA/α-amanitin). Centromeres were stained by CREST as a marker (blue). Images are max-projected from z-stacks. TMR signals on centromeres were quantified. Each dot indicates a signal from one centromere. The bar graph indicates the mean with SD from an average of three replicates.

Although Rad21 is a cohesin core component critical for DNA looping (Jeppsson et al., 2022), newly synthesized CENP-A was correctly localized onto centromeres in Rad21-depleted cells (Figure 1, A and C; Supplemental Figure S1, A, B, and D). This indicates that cohesin DNA-binding and looping activity were not required for newly synthesized CENP-A localization. The cohesin components, STAG1 or STAG2, stabilize transcription and R-loops independently of cohesin function (Porter et al., 2023). Thus, STAG proteins could mediate chromatin remodeling for CENP-A loading. Depletion of STAG1 or STAG2 alone did not show growth defects, consistent with previous papers (Mondal et al., 2019; Lelij et al., 2020) (Supplemental Figure S1, C and D). Therefore, we established STAG1 and STAG2 AID-tagged cells for rapid double depletion, which resulted in a severe growth defect (Figure 1A; Supplemental Figure S1, A, B, and D). Double depletion of STAG 1 and 2 did not alter CENP-A localization (Figure 1C), demonstrating that cohesin and cohesin-mediated chromatin remodeling were not required for newly synthesized CENP-A localization in human cells.

We then examined the function of transcription-dependent chromatin remodeling in the CENP-A loading context in human cells. Recent work in Drosophila cells and the early embryo showed that inhibition of transcription did not impair centromere localization of CID/dCENP-A and CAL1, the CENP-A loading machinery (Bobkov et al., 2018; Ghosh and Lehner, 2022). We established an AID-based CENP-A loading system in human cells expressing AID-green fluorescent protein (GFP)–tagged CENP-A from one endogenous allele. Cells were incubated in IAA for 2 d to remove chromatin-bound CENP-A-GFP before the thymidine block. Following thymidine washout, CENP-A-AID-GFP was newly synthesized and localized in the G1, but not during mitosis (Figure 2A; Supplemental Figure S2, A and B). We established this system as an alternative to the CENP-A-SNAP loading system because it has a much higher signal-to-noise ratio in G1 cells. A recent paper indicated that α-amanitin, but not triptolide, inhibits centromere transcription in human cells (Chen et al., 2021). Thus, cells were treated with triptolide or α-amanitin, which both decreased RNA pol II CTD phospho-Ser2 (Supplemental Figure S3A). To confirm that both drugs effectively inhibited centromere transcription, we labeled and purified nascent RNAs in G1 using the addition of 4-thio-Uridine. In our RT-qPCR combined with cell synchronization, nascent α-satellite RNA levels during G1 phase were reduced by both drugs, which differs from the previous report but may be due to differences in cell cycle phase or cell types (Supplemental Figure S3B). Despite the reduction in α-satellite transcription in each drug treatment, they did not alter CENP-A localization (Figure 2A). We also analyzed KNL2 and CENP-A in cells expressing KNL2-AID-GFP and CENP-A-SNAP, which were treated with transcription inhibitors. Transcription inhibition did not affect the localization of CENP-A-SNAP or KNL2 to centromeres in G1, consistent with data from Drosophila (Figure 2B). We conclude that chromatin remodeling mediated by transcription is not required for CENP-A and KNL2 localization in human cells.

FIGURE 2:

FIGURE 2:

Open in a new tab

KNL2 and newly synthesized CENP-A localization do not depend on transcription in human cells. (A) Schematic representation of the experiment (top). Localization of newly deposited CENP-A-AID-GFP (green) during G1 phase at 6 h after Triptolide (TRP) or α-amanitin, or 3 h after the IAA addition in HeLa cells. DNA was stained with DAPI (blue). Centromeres were stained by CREST as a marker (red). Images are max-projected from z-stacks. GFP signals on centromeres were quantified. Each dot indicates a signal from one centromere. The Bar graph indicates the mean with SD from an average of three replicates. (B) Schematic representation of the experiment (top). Localization of newly deposited CENP-A-SNAP (red) and GFP-AID-KNL2 (green) during G1 phase at 6 h after Triptolide (TRP) or α-amanitin, or 3 h after the IAA addition in DLD1 cells. Centromeres were stained by CREST as a marker (blue). Images are max-projected from z-stacks. GFP and TMR signals on centromeres were quantified. Each dot indicates a signal from one centromere. The bar graph indicates the mean with SD from an average of three replicates.

Transcription inhibition blocked CENP-A incorporation into centromere nucleosomes in Drosophila cells, but not CENP-A localization to centromeres, implying that CENP-A incorporation into nucleosomes depends on transcription-coupled chromatin remodeling (Bobkov et al., 2018). We hypothesized that chromatin remodeling, depending on DNA looping by cohesin, might be required for CENP-A incorporation in conditions where transcription is silenced. However, depletion of cohesin components, combined with α-amanitin, did not affect CENP-A localization, suggesting chromatin remodeling by both cohesin and transcription was not required for CENP-A localization (Figure 1C).

Centromeric localization of CENP-A and KNL2 is stable following a combination of transcriptional inhibition and preextraction

A previous Drosophila study showed that transcription stabilized CENP-A in nucleosomes by removing unincorporated CENP-A on nucleosomes with high salt treatment before fixing cells (Bobkov et al., 2018). It is well established that treatment of cells with high salt concentrations, such as 0.5 M NaCl, before fixation results in the dissociation of proteins with weak DNA-binding affinity. To evaluate whether the CENP-A loading mechanism in flies is conserved in human cells, newly synthesized CENP-A localization was examined in human cells treated with 0.5 M NaCl or 0.5% Triton-X in the absence or presence of triptolide or α-amanitin (Figure 3A; Supplemental Figure S4). Under any conditions, CENP-A localization was not impaired, suggesting that CENP-A was incorporated into nucleosomes even when transcription is silenced in human cells. To further investigate the stability of the upstream factor of CENP-A incorporation under transcription inhibition, both CENP-A and KNL2-GFP signals were analyzed with 0.5 M NaCl under transcription inhibition. Salt treatment combined with transcription inhibition did not evict CENP-A or KNL2 localization in human cells (Figure 3B), indicating that KNL2 is tightly bound to centromere chromatin. This contrasts with Drosophila CAL1, which was excluded from chromatin by salt treatment (Bobkov et al., 2018).

FIGURE 3:

FIGURE 3:

Open in a new tab

CENP-A deposition and KNL2 localization are stable in salt extraction and detergent treatment in prefixed cells incubated with transcription inhibitors. (A) Localization of newly deposited CENP-A-AID-GFP (green) during G1 phase at 6 h after Triptolide (TRP) or α-amanitin, or 3 h after the IAA addition in HeLa cells, as shown in the schematic representation of the experiment in Figure 2A. Cells were fixed in formaldehyde after 30 min of 0.5 M NaCl-PBS salt extraction (top) or 60 s 0.5% Triton-X-PBS treatment (bottom). DNA was stained with DAPI (blue). Centromeres were stained by CREST as a marker (red). Images are max-projected from z-stacks. GFP signals on centromeres were quantified. Each dot indicates a signal from one centromere. The Bar graph indicates the mean with SD from an average of three replicates. (B) Localization of newly deposited CENP-A-SNAP (red) and GFP-AID-KNL2 (green) during G1 phase at 6 h after Triptolide (TRP) or α-amanitin, or 3 h after the IAA addition in DLD1 cells, as shown in the schematic representation of the experiment in Figure 2B. Cells were fixed in formaldehyde after 30 min of 0.5 M NaCl-PBS salt extraction. Centromeres were stained by CREST as a marker (blue). Images are max-projected from z-stacks. GFP and TMR signals on centromeres were quantified. Each dot indicates a signal from one centromere. The bar graph indicates the mean with SD from an average of three replicates.

CENP-A incorporation into the nucleosome did not depend on transcription

KNL2 is known to bind to centromeres via CENP-C and function as a scaffold for the incorporation of newly synthesized CENP-A by interacting with the Mis18α/β-HJURP-CENP-A complex (Shuaib et al., 2010; Tachiwana et al., 2015; Pan et al., 2019; Cao et al., 2024; Thamkachy et al., 2024). Our results indicated that KNL2 and newly synthesized CENP-A were stably bound to nucleosomes without transcription. However, this did not address whether KNL2 could tether CENP-A via the Mis18-HJURP complex to centromere chromatin in the absence of transcription-coupled chromatin incorporation (Figure 4A). To test whether KNL2 is tethering CENP-A to chromatin in the absence of transcription, we examined the effects of KNL2 depletion on CENP-A centromere localization following transcription inhibition. (Figure 4A). Mitotic cells are released into the G1 phase with α-amanitin for 2 h, then cells are incubated with IAA for 1 h to degrade KNL2 rapidly. If KNL2 is tethering CENP-A to chromatin in the absence of transcription, we predicted that CENP-A localization would be lost following KNL2 depletion. CENP-A was localized to centromeres after KNL2 degradation in control cells, demonstrating that release from nocodazole for 2 h was sufficient for CENP-A recruitment onto centromeres (Figure 4, A and B). CENP-A also localized normally in KNL2-depleted cells in which transcription is inhibited. Collectively, these data suggest that transcription is not required for stable CENP-A incorporation into chromatin in G1.

FIGURE 4:

FIGURE 4:

Open in a new tab

CENP-A was deposited into nucleosomes even in the presence of transcription inhibitors and became independent of KNL2. (A) Schematic representation of the experiment (top). Schematic representation of the model for transcription inhibitor blocks CENP-A deposition into nucleosomes that depends on KNL2. (B) Localization of newly deposited CENP-A-SNAP (red) and GFP-AID-KNL2 (green) during G1 phase presence or absence of α-amanitin for 6 h, and 3 h after the IAA addition. Centromeres were stained by CREST as a marker (blue). Images are max-projected from z-stacks. TMR signals on centromeres were quantified. Each dot indicates a signal from one centromere. The bar graph indicates the mean with SD from an average of three replicates.

Here, we demonstrated that human CENP-A localization and chromatin incorporation did not require cohesin or transcription. Our observations suggest that the CENP-A deposition mechanism in human cells is distinct from that of Drosophila, which relies on transcription. In Drosophila, CID/dCENP-A directly binds to CAL1, which interacts with the constitutive centromere protein, CENP-C (Schittenhelm et al., 2010; Phansalkar et al., 2012; Unhavaithaya and Orr-Weaver, 2013; Chen et al., 2014). In contrast, human CENP-A interacts with CENP-C through M18BP1/KNL2 and HJURP in the Mis18α/β complex (Shuaib et al., 2010; Tachiwana et al., 2015; Pan et al., 2019; Cao et al., 2024; Thamkachy et al., 2024). Furthermore, studies using human cells and Xenopus egg extracts have demonstrated that condensin is involved in CENP-A incorporation (Bernad et al., 2011; Barnhart-Dailey et al., 2017). The varied requirement for transcription in CENP-A incorporation between different species might reflect differences in protein structure of the CENP-A loading machinery, the cell-cycle stage of CENP-A loading, or differences in the protein composition of the centromere/kinetochore complex (Barnhart et al., 2011; McKinley and Cheeseman, 2014; Barnhart-Dailey et al., 2017; Hu et al., 2023; Parashara et al., 2024).

It is noteworthy that transcription or its dependent chromatin remodeling is required for CENP-A maintenance in many organisms and several biological contexts. The functional disruption of transcription-associated chaperone FACT showed defective CENP-A assembly in chickens and flies (Okada et al., 2009; Chen et al., 2015). Active transcription transiently expels centromere histones, and Spt6 serves to replace CENP-A evicted by transcription (Bobkov et al., 2020). Centromeric transcription destabilized centromere nucleosomes in the prophase I-arrested starfish oocyte, to allow gradual replacement of new CENP-A, but was not required for canonical CENP-A recruitment in G1 (Swartz et al., 2019). Taken together, our data and published works demonstrate that canonical CENP-A deposition in G1 does not depend on transcription in many organisms. However, centromeric transcription allows the replacement of CENP-A, which is crucial for maintaining the proper CENP-A amount in quiescent cells or in some specific organisms. Our findings highlight evolutionary divergence in centromere maintenance systems in different cell types and across species.

MATERIALS AND METHODS

Request a protocol through Bio-protocol

Cell culture

DLD-1 cells were cultured in RPMI-1640 (Sigma) + 10% FBS (Cytivia) + Pen/Strep. HeLa cells were cultured in DMEM (Sigma) + 10% FBS (Cytivia) + Pen/Strep. To induce AID-tagged protein degradation, cells were treated with 1 µM 5-Ph-IAA for the indicated hours in the figures. DLD-1 cells and HeLa cells were treated with 2 mM thymidine in complete medium for 24 h, washed twice in complete medium, and released in complete medium for the indicated hours in the figures, followed by the addition of nocodazole to a final concentration of 100 ng/ml, and shaken off mitotic cells and washed out by complete medium three times and cultured on collagen covered cover grass for indicated hours in the figures. SNAP-Cell Block (NEB) and SNAP-TMR (NEB) were used at 2 µM for 30 min. Triptolide was used at 1 µM for the indicated times. α-amanitin was used at 10 µg/ml for the indicated times. For drug selection, the transfected DLD-1 and HeLa cells were selected in medium containing 10 µg/ml Blasticidin S HCl, 100 µg/ml Zeocin, 500 µg/ml G418, 1 µg/ml puromycin, or 200 µg/ml Hygromycin B.

Cell lines

As shown in Supplemental Figure S1A, to constitutively express TIR1-F74G in DLD-1 or HeLa cells at the AAVS1 locus, pMB1398 (EF1-a promoter-TIR1-F74G-P2A-Blasticidin resistant gene) and pMB1422 (Cas9-D10A targeting AAVS locus) were transfected by Lipofectamine 3000 (Thermo Fisher Scientific). Each plasmid DNA (2.5 µg) and Lipofectamine 3000 were incubated in 500 µl of Opti-MEM at room temperature for 20 min and then added to the cells incubated in—Pen/Strep medium. Cells were selected with the proper drug for 2 wk, 72 h after transfection. Then, pMB1405 (CENP-A C-Terminal HR with SNAP, PGK promoter-Zeocin resistant gene) and pMB1329 (Cas9 targeting CENP-A C-Terminus) were transfected into DLD-1 cells expressing TIR1-F74G. After selection, we got DLD-1 cells expressing CENP-A-SNAP from a single allele, to express Rad21-mAID-GFP under control of the endogenous promoter, pMB 1446 (Rad21 C-Terminal HR with mAID-GFP-P2A-Neomycin resistant gene), and pMB1153 (Cas9 targeting Rad21 C-Terminus), were transfected. As with Rad21, to express STAG1 or STAG2 tagged with mAID-GFP, pMB1461 (STAG1 C-Terminal HR with mAID-GFP-P2A-Neomycin resistant gene) and pMB1353 (Cas9 targeting STAG1 C-Terminus), or pMB1440 (STAG2 C-Terminal HR with mAID-GFP-P2A-Neomycin resistant gene) and pMB1354 (Cas9 targeting STAG2 C-Terminus) were transfected. To express GFP-mAID-KNL2 under the control of the endogenous promoter, pMB1481 (KNL2 N-Terminal HR with Hygromycin resistant gene-P2A-GFP-mAID) and pMB1486 (Cas9 targeting KNL2 N-Terminus) were transfected. And to degrade both STAG1 and STAG2, pMB1506 (STAG2 C-Terminal HR with mAID-GFP-P2A-Puromycin resistant gene) and pMB1354 (Cas9 targeting STAG2 C-Terminus) were transfected into DLD-1 cells expressing STAG1-mAID-GFP. To express CENP-A-mAID-GFP in HeLa cells, pMB1408 (CENP-A C-Terminal HR with mAID-GFP, PGK promoter-Zeocin–resistant gene) and pMB1329 (Cas9 targeting CENP-A C-Terminus) were transfected, and single allele knocking-in cells were selected. Knocking-in in all cell lines was confirmed by genome PCR and immunoblotting.

Plasmid constructions

All plasmid constructs were created using Infusion cloning. We designed 500 to 750 bp homology regions flanking the target stop codon of Rad21, STAG1, STA2, CENP-A, and fused these to the mAID-GFP selection cassette using Infusion cloning. For the KNL2 N-Terminal knocking-in plasmid, we thank Dr. Aaron Straight for providing the plasmid, including the homology regions flanking the target start codon of KNL2 (French and Straight, 2019b). We inserted the Hygromycin resistance cassette and P2A into the plasmid by infusion cloning. All plasmid sequences were confirmed by whole plasmid sequencing.

Genotyping PCR

DLD-1 cells or HeLa cells were trypsinized and harvested, washed with PBS. Genome was provided and amplified by Platinum Direct PCR Universal Master Mix (Thermo Fisher Scientific, A44647100). The following are the PCR primers: For the AAVS locus, forward primer GCTAGTCTTCTTCCTCCAACCC, reverse primer CAAGCTCTCCCTCCCAGGATC. For the KNL2 locus, forward primer CACCGAAGAATTTACTTACCTCCAG, reverse primer AAACCTGGAGGTAAGTAAATTCTTC. For the Rad21 locus, forward primer CAAGCTATTGAGCTGACACAGG, reverse primer CCAGTGTTACTGATGGAAAGAAGTG. For the STAG1 locus, forward primer GAAGGGACATAATTCAGCCCGTAAC, reverse primer ATGCTCCTCTTCTGTCACTGC. For the STAG2 locus, CAAGGGAGAGTTGCTCCATTCATC, reverse primer TATTCAGGCAAACAAAACTGCC. For the CENP-A locus, forward primer ACCACCTATTTTCCACTGAACTTACC, reverse primer GTAACCAGAACATCAAAGCTTACAGG.

Immunoblotting

DLD-1 cells were trypsinized and harvested, washed with PBS, and suspended in 1× Laemmli sample buffer (LSB; final 2 × 10^4 cells/µl) followed by sonication and heating for 5 min at 96°C. Proteins were separated on a 7.5% SDS–PAGE gel, handmade and transferred to Immobilon (Millipore) by Trans-Blot Turbo (BIORAD) with 2.5 A for 12 min. Membranes were washed with PBS + 2 vol/vol% Tween 20 and blocked with PBS + 2 vol/vol% Tween 20 supplemented with 5% skim milk for 20 min at room temperature. Then, membranes were washed with PBS + 2 vol/vol% Tween 20 for 5 min three times and incubated with primary antibody in Western Blocker and Signal Enhancer (MP) overnight at 4°C. Then, membranes were washed with PBS + 2 vol/vol% Tween 20 for 5 min three times and incubated with secondary antibody in Western Blocker and Signal Enhancer (MP) for 1 h at room temperature. Then, membranes were washed with PBS + 2 vol/vol% Tween 20 for 5 min three times and incubated with Immobilon ECL Ultra Western horse radish peroxidase (HRP) Substrate (Millipore) for 5 min, then scanned in a Chemidoc MP imager (Bio-Rad). For the primary antibodies, 1/1000 of anti-Rad21 from rabbit (Abcam, ab922), 1/1000 of anti-STAG1 from rabbit (Proteintech, 14015-1-AP), 1/1000 of anti-STAG2 from rabbit (Proteintech, 19837-1-AP), 1/1000 of anti-STAG2 from rabbit (Proteintech, 19837-1-AP), 1/1000 of anti-M18BP1/KNL2 from rabbit (Proteintech, 26264-1-AP), 1/10,000 of anti–α-Tubulin from mouse (Sigma, 9026). For secondary antibody, HRP-conjugated antibodies were used.

Cell counting

To count the number of DLD-1 cells, the culture medium was removed using an aspirator. Then, 2.5 g/l of Trypsin 1 mmol/l EDTA solution (Life Technologies) was added and incubated for 5 min at 37°C. The same amount of complete culture medium as Trypsin was added to stop trypsinization. The cell solution was mixed with the same volume of 0.4 wt/vol% Trypan Blue Solution, and cell numbers were counted using Countess II.

Cell fixation and immunofluorescence

Cells were fixed with 4% PFA (Electron Microscopy Services) in PBS for 10 min at room temperature. For salt preextraction, cells were incubated with 0.5 M NaCl for 30 min at room temperature, then the buffer was removed and the cells were washed with PBS and fixed with PFA. For detergent preextraction, cells were incubated with PBS + 0.5 vol/vol% Triton X-100 for 60 s at room temperature, then the buffer was removed, washed with PBS, and fixed with PFA.

Fixed cells were permeabilized by incubation in PBS + 0.5 vol/vol% Triton X-100 for 15 min at room temperature, then cells were washed with PBS + 2 vol/vol% Tween 20. The following antibodies were used for immunofluorescence: human anti-CREST (Immunovision HCT-100) and rabbit anti-RNA polymerase II CTD repeat YSPTSPS (phospho S2) (Abcam, ab5095). Cells were incubated with the primary antibody for 1 h at 37°C. Cells were washed 3 × 5 min with PBS + 2 vol/vol% Tween 20 and then incubated with secondary antibody for 1 h. Cells were washed 3 × 5 min with PBS + 2 vol/vol% Tween 20. Cells were postfixed with 4% PFA in PBS for 10 min at room temperature. 5EU-RNA was detected essentially as described (Sharp et al., 2020).

Image acquisition and analysis

All images were acquired using a Nikon A1R confocal microscope equipped with a 60 × 1.4NA Vc lens and laser lines at 405, 488, 562, and 647 nm. Images were collected using a scan zoom of 2× or 4× (140 or 70 nm/pixel) using a galvano scanner. Images were acquired as Z stacks spaced 0.2 µm apart. Each experiment was repeated in three biological replicates. The fluorescence intensity of RNA Pol II PS2, CENP-A-SNAP-TMR, or GFP-AID-KNL2 signal was measured in the nucleus of each cell using a script in Fiji. For centromere signals, Images were first subjected to maximum intensity projection, and nuclei were identified using the thresholding of the DAPI staining channel. CREST channel signals present within the nuclear regions were then masked, and the signal intensities of KNL2 or CENP-A were measured in each masked area of the CREST channel. For RNA Pol II analysis, one dot indicated one cell's signal intensity in each nuclear area. For CENP-A or KNL2 analysis, one dot indicated one centromere's signal intensity per centromere area. For each experiment, fluorescence intensity was normalized to the average intensity of untreated control cells. Data are shown as mean ± SD of three independent assays. A two-tailed unpaired t test with the mean of the experiment was used to compare conditions.

RT-qPCR

DLD-1 cells were synchronized by thymidine and nocodazole and released into G1 phase, incubated with 4-thiouridine (4SU) as indicated in the figure. Total RNAs from G1 cells were collected and purified by TRizol (Invitrogen) following the protocol. 4SU-labeled nascent RNAs were biotinylated by MTSEA biotin (Biotium) in 10 mM HEPES, 1 mM EDTA pH 8.0, for 2 h at room temperature. Biotinylated RNAs were washed with RNA Clean and Concentrator Kits (Zymo Research). RNAs were incubated with Dynabeads MyOne Streptavidin T1 (Invitrogen) for 1 h at room temperature and washed with 100 mM Tris-HCl pH 7.4, 10 mM EDTA, 1M NaCl three times and eluted by 5 vol/vol% 2-Mercaptoethanol. RNAs were purified by Ethanol precipitation and reverse transcribed by the Verso cDNA Synthesis Kit (Invitrogen). RT-qPCR was performed by Luna Universal qPCR (NEB) and was analyzed using CFX Opus Real-Time PCR Systems (Bio-Rad). For the chromosome 7 α-satellite, forward primer AGCGATTTGAGGACAATTGCAG, reverse primer GTGAGTTGAACGCACACATCAC. For the chromosome 17 α-satellite, forward primer GGAAACGGGATAATTTCAGCTGAC, reverse primer CACAGAGTGGTCCAAATATCCAC. For the GAPDH, forward primer CTCATGACCACAGTCCATGCC, reverse primer GCCATCCACAGTCTTCTGGGT. For the E2F2, forward primer CTCTCTGAGCTTCAAGCACCTG, reverse primer CTTGACGGCAATCACTGTCTGC.

Supporting information

mbc-36-br30-s001.pdf (358.4KB, pdf)

ACKNOWLEDGMENTS

We thank the members of the Blower laboratory for their suggestions and contributions to this paper. We also thank Dr. Aaron Straight for providing the KNL2-tagging plasmid. This work was supported by funding from the NIH/National Institute of General Medical Sciences to M.D.B. (5RO1-GM122893), the Overseas Research Fellowships of the JSPS/Japan Society for the Promotion of Science to R.W., and the Overseas postdoctoral fellowships of the Uehara Memorial Foundation to R.W.

Abbreviations used:

AID

auxin inducible degron

CAL1

chromosome alignment defect 1

CENP-A

centromere protein-A

CID

centromere identifier

CREST

CREST syndrome centromere antibodies

DAPI

4′,6-diamidino-2-phenylindole

FACT

facilitates chromatin transcription

GFP

green fluorescent protein

HJURP

holliday junction recognition protein

HRP

horseradish peroxidase

IAA

indole-3-acetic acid

KNL2

kinetochore null 2

RNAP II

RNA polymerase II

SD

standard deviation

SNAP

SNAP-tag

STAG

stromalin antigen

TMR

tetramethylrhodamine

TRP

triptolide.

Footnotes

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E25-05-0214) on September 17, 2025.

REFERENCES

  1. Arruda NL, Carico ZM, Justice M, Liu YF, Zhou J, Stefan HC, Dowen JM (2020). Distinct and overlapping roles of STAG1 and STAG2 in cohesin localization and gene expression in embryonic stem cells. Epigenet Chromatin, 13, 32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barnhart MC, Kuich PHJL, Stellfox ME, Ward JA, Bassett EA, Black BE, Foltz DR (2011). HJURP is a CENP-A chromatin assembly factor sufficient to form a functional de novo kinetochore. J Cell Biol, 194, 229–243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barnhart-Dailey MC, Trivedi P, Stukenberg PT, Foltz DR (2017). HJURP interaction with the condensin II complex during G1 promotes CENP-A deposition. Mol Biol Cell, 28, 54–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barnhart-Dailey MC, Trivedi P, Stukenberg PT, Foltz DR (2017). HJURP interaction with the condensin II complex during G1 promotes CENP-A deposition. Mol Biol Cell, 28, 54–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bassett EA, DeNizio J, Barnhart-Dailey MC, Panchenko T, Sekulic N, Rogers DJ, Foltz DR, Black BE (2012). HJURP uses distinct CENP-A surfaces to recognize and to stabilize CENP-A/histone H4 for centromere assembly. Dev Cell, 22, 749–762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bergmann JH, Rodríguez MG, Martins NMC, Kimura H, Kelly DA, Masumoto H, Larionov V, Jansen LET, Earnshaw WC (2011). Epigenetic engineering shows H3K4me2 is required for HJURP targeting and CENP-A assembly on a synthetic human kinetochore. EMBO J, 30, 328–340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bernad R, Sánchez P, Rivera T, Rodríguez-Corsino M, Boyarchuk E, Vassias I, Ray-Gallet D, Arnaoutov A, Dasso M, Almouzni G, Losada A (2011). Xenopus HJURP and condensin II are required for CENP-A assembly. J Cell Biol, 192, 569–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Black BE, Brock MA, Bédard S, Woods VL, Cleveland DW (2007). An epigenetic mark generated by the incorporation of CENP-A into centromeric nucleosomes. Proc Natl Acad Sci USA, 104, 5008–5013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Black BE, Foltz DR, Chakravarthy S, Luger K, Woods VL, Cleveland DW (2004). Structural determinants for generating centromeric chromatin. Nature, 430, 578–582. [DOI] [PubMed] [Google Scholar]
  10. Blower MD (2016). Centromeric transcription regulates aurora-B localization and activation. Cell Rep, 15, 1624–1633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Blower MD, Karpen GH (2001). The role of Drosophila CID in kinetochore formation, cell-cycle progression, and heterochromatin interactions. Nat Cell Biol, 3, 730–739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bobkov GOM, Gilbert N, Heun P (2018). Centromere transcription allows CENP-A to transit from chromatin association to stable incorporation. J Cell Biol, 217, 1957–1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Bobkov GOM, Huang A, van den Berg SJW, Mitra S, Anselm E, Lazou V, Schunter S, Feederle R, Imhof A, Lusser A, et al. (2020). Spt6 is a maintenance factor for centromeric CENP-A. Nat Commun, 11, 2919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Bury L, Moodie B, Ly J, McKay LS, Miga KH, Cheeseman IM (2020). Alpha-satellite RNA transcripts are repressed by centromere—nucleolus associations. ELife, 9, e59770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cao J, Hori T, Ariyoshi M, Fukagawa T (2024). Artificial tethering of constitutive centromere-associated network proteins induces CENP-A deposition without Knl2 in DT40 cells. J Cell Sci, 137, jcs261639. [DOI] [PubMed] [Google Scholar]
  16. Casa V, Gines MM, Gusmao EG, Slotman JA, Zirkel A, Josipovic N, Oole E, IJcken WFJv, Houtsmuller AB, Papantonis A, Wendt KS. (2020). Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcriptional control. Genome Res, 30, 515–527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Catania S, Pidoux AL, Allshire RC (2015). Sequence features and transcriptional stalling within centromere DNA promote establishment of CENP-A chromatin. PLoS Genet, 11, e1004986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Chan FL, Marshall OJ, Saffery R, Won Kim B, Earle E, Choo KHA, Wong LH (2012). Active transcription and essential role of RNA polymerase II at the centromere during mitosis. Proc Natl Acad Sci USA, 109, 1979–1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Chan FL, Wong LH (2012). Transcription in the maintenance of centromere chromatin identity. Nucleic Acids Res, 40, 11178–11188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Chen C-C, Bowers S, Lipinszki Z, Palladino J, Trusiak S, Bettini E, Rosin L, Przewloka MR, Glover DM, O'Neill RJ, Mellone BG (2015). Establishment of centromeric chromatin by the CENP-A assembly factor CAL1 requires FACT-mediated transcription. Dev Cell, 34, 73–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Chen C-C, Dechassa ML, Bettini E, Ledoux MB, Belisario C, Heun P, Luger K, Mellone BG (2014). CAL1 is the Drosophila CENP-A assembly factor. J Cell Biol, 204, 313–329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Chen Y, Zhang Q, Teng Z, Liu H (2021). Centromeric transcription maintains centromeric cohesion in human cells. J Cell Biol, 220, e202008146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Choi ES, Strålfors A, Castillo AG, Durand-Dubief M, Ekwall K, Allshire RC (2011). Identification of noncoding transcripts from within CENP-A chromatin at fission yeast centromeres*. J Biol Chem, 286, 23600–23607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Dambacher S, Deng W, Hahn M, Sadic D, Fröhlich J, Nuber A, Hoischen C, Diekmann S, Leonhardt H, Schotta G (2012). CENP-C facilitates the recruitment of M18BP1 to centromeric chromatin. Nucleus, 3, 101–110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Deyter GMR, Biggins S (2014). The FACT complex interacts with the E3 ubiquitin ligase Psh1 to prevent ectopic localization of CENP-A. Genes Dev, 28, 1815–1826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Dunleavy EM, Roche D, Tagami H, Lacoste N, Ray-Gallet D, Nakamura Y, Daigo Y, Nakatani Y, Almouzni-Pettinotti G (2009). HJURP is a cell-cycle-dependent maintenance and deposition factor of CENP-A at centromeres. Cell, 137, 485–497. [DOI] [PubMed] [Google Scholar]
  27. Earnshaw WC, Rothfield N (1985). Identification of a family of human centromere proteins using autoimmune sera from patients with scleroderma. Chromosoma, 91, 313–321. [DOI] [PubMed] [Google Scholar]
  28. Erhardt S, Mellone BG, Betts CM, Zhang W, Karpen GH, Straight AF (2008). Genome-wide analysis reveals a cell-cycle–dependent mechanism controlling centromere propagation. J Cell Biol, 183, 805–818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ferri F, Bouzinba-Segard H, Velasco G, Hubé F, Francastel C (2009). Noncoding murine centromeric transcripts associate with and potentiate Aurora B kinase. Nucleic Acids Res, 37, 5071–5080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Flores Servin JC, Brown RR, Straight AF (2023). Repression of CENP-A assembly in metaphase requires HJURP phosphorylation and inhibition by M18BP1. J Cell Biol, 222, e202110124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Foltz DR, Jansen LET, Bailey AO, Yates JR, Bassett EA, Wood S, Black BE, Cleveland DW (2009). Centromere-specific assembly of CENP-A nucleosomes is mediated by HJURP. Cell, 137, 472–484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Foltz DR, Jansen LET, Black BE, Bailey AO, Yates JR, Cleveland DW (2006). The human CENP-A centromeric nucleosome-associated complex. Nat Cell Biol, 8, 458–469. [DOI] [PubMed] [Google Scholar]
  33. French BT, Straight AF (2019a). CDK phosphorylation of Xenopus laevis M18BP1 promotes its metaphase centromere localization. EMBO J, 38, e100093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. French BT, Straight AF (2019b). CDK phosphorylation of Xenopus laevis M18BP1 promotes its metaphase centromere localization. EMBO J. 10.15252/embj.2018100093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Fujita Y, Hayashi T, Kiyomitsu T, Toyoda Y, Kokubu A, Obuse C, Yanagida M (2007). Priming of centromere for CENP-A recruitment by human hMis18α, hMis18β, and M18BP1. Dev Cell, 12, 17–30. [DOI] [PubMed] [Google Scholar]
  36. Fukagawa T, Earnshaw WC (2014). The centromere: Chromatin foundation for the kinetochore machinery. Dev Cell, 30, 496–508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ghosh S, Lehner CF (2022). Incorporation of CENP-A/CID into centromeres during early Drosophila embryogenesis does not require RNA polymerase II–mediated transcription. Chromosoma, 131, 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Hayashi T, Fujita Y, Iwasaki O, Adachi Y, Takahashi K, Yanagida M (2004). Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres. Cell, 118, 715–729. [DOI] [PubMed] [Google Scholar]
  39. Henikoff S, Ahmad K, Platero JS, van Steensel B (2000). Heterochromatic deposition of centromeric histone H3-like proteins. Proc Natl Acad Sci USA, 97, 716–721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Heun P, Erhardt S, Blower MD, Weiss S, Skora AD, Karpen GH (2006). Mislocalization of the Drosophila centromere-specific histone CID promotes formation of functional ectopic kinetochores. Dev Cell, 10, 303–315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Hirai H, Shogaki Y, Sato M (2022). The Mis6 inner kinetochore subcomplex maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosis. Commun Biol, 5, 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Hori T, Shang W-H, Hara M, Ariyoshi M, Arimura Y, Fujita R, Kurumizaka H, Fukagawa T (2017). Association of M18BP1/KNL2 with CENP-A nucleosome is essential for centromere formation in non-mammalian vertebrates. Dev Cell, 42, 181–189.e3. [DOI] [PubMed] [Google Scholar]
  43. Hori T, Shang W-H, Takeuchi K, Fukagawa T (2012). The CCAN recruits CENP-A to the centromere and forms the structural core for kinetochore assembly. J Cell Biol, 200, 45–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Horsfield JA (2023). Full circle: A brief history of cohesin and the regulation of gene expression. FEBS J, 290, 1670–1687. [DOI] [PubMed] [Google Scholar]
  45. Howman EV, Fowler KJ, Newson AJ, Redward S, MacDonald AC, Kalitsis P, Choo KHA (2000). Early disruption of centromeric chromatin organization in centromere protein A (Cenpa) null mice. Proc Natl Acad Sci USA, 97, 1148–1153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Hu L, Zhao C, Liu M, Liu S, Ye J, Wang K, Shi J, Tian W, He X (2023). CENP-I directly targets centromeric DNA to support CENP-A deposition and centromere maintenance. Proc Natl Acad Sci USA, 120, e2219170120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Jansen LET, Black BE, Foltz DR, Cleveland DW (2007). Propagation of centromeric chromatin requires exit from mitosis. J Cell Biol, 176, 795–805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Jeppsson K, Sakata T, Nakato R, Milanova S, Shirahige K, Björkegren C (2022). Cohesin-dependent chromosome loop extrusion is limited by transcription and stalled replication forks. Sci Adv, 8, eabn7063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. van der Lelij P, Newman JA, Lieb S, Jude J, Katis V, Hoffmann T, Hinterndorfer M, Bader G, Kraut N, Pearson MA, et al. (2020). STAG1 vulnerabilities for exploiting cohesin synthetic lethality in STAG2-deficient cancers. Life Sci Alliance, 3, e202000725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Li F, Sonbuchner L, Kyes SA, Epp C, Deitsch KW (2008). Nuclear non-coding RNAs are transcribed from the centromeres of Plasmodium falciparum and are associated with centromeric chromatin*. J Biol Chem, 283, 5692–5698. [DOI] [PubMed] [Google Scholar]
  51. Liu H, Qu Q, Warrington R, Rice A, Cheng N, Yu H (2015). Mitotic transcription installs Sgo1 at centromeres to coordinate chromosome segregation. Mol Cell, 59, 426–436. [DOI] [PubMed] [Google Scholar]
  52. Losada A, Yokochi T, Kobayashi R, Hirano T (2000). Identification and characterization of Sa/Scc3p subunits in the xenopus and human cohesin complexes. J Cell Biol, 150, 405–416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Maddox PS, Hyndman F, Monen J, Oegema K, Desai A (2007). Functional genomics identifies a Myb domain–containing protein family required for assembly of CENP-A chromatin. J Cell Biol, 176, 757–763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. McKinley KL, Cheeseman IM (2014). Polo-like kinase 1 licenses CENP-A deposition at centromeres. Cell, 158, 397–411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. McKinley KL, Cheeseman IM (2016). The molecular basis for centromere identity and function. Nat Rev Mol Cell Biol, 17, 16–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. McNulty SM, Sullivan LL, Sullivan BA (2017). Human centromeres produce chromosome-specific and array-specific alpha satellite transcripts that are complexed with CENP-A and CENP-C. Dev Cell, 42, 226–240.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Meluh PB, Yang P, Glowczewski L, Koshland D, Smith MM (1998). Cse4p is a component of the core centromere of Saccharomyces cerevisiae. Cell, 94, 607–613. [DOI] [PubMed] [Google Scholar]
  58. Mondal G, Stevers M, Goode B, Ashworth A, Solomon DA (2019). A requirement for STAG2 in replication fork progression creates a targetable synthetic lethality in cohesin-mutant cancers. Nat Commun, 10, 1686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Moree B, Meyer CB, Fuller CJ, Straight AF (2011). CENP-C recruits M18BP1 to centromeres to promote CENP-A chromatin assembly. J Cell Biol, 194, 855–871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Müller S, Montes de Oca R, Lacoste N, Dingli F, Loew D, Almouzni G (2014). Phosphorylation and DNA binding of HJURP determine its centromeric recruitment and function in CenH3CENP-A loading. Cell Rep, 8, 190–203. [DOI] [PubMed] [Google Scholar]
  61. Nishimura K, Fukagawa T, Takisawa H, Kakimoto T, Kanemaki M (2009). An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat Methods, 6, 917–922. [DOI] [PubMed] [Google Scholar]
  62. Oegema K, Desai A, Rybina S, Kirkham M, Hyman AA (2001). Functional analysis of kinetochore assembly in Caenorhabditis elegans. J Cell Biol, 153, 1209–1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Ohkuni K, Kitagawa K (2011). Endogenous transcription at the centromere facilitates centromere activity in budding yeast. Curr Biol, 21, 1695–1703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Okada M, Okawa K, Isobe T, Fukagawa T (2009). CENP-H–containing complex facilitates centromere deposition of CENP-A in cooperation with FACT and CHD1. Mol Biol Cell, 20, 3986–3995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Palmer DK, O'Day K, Trong HL, Charbonneau H, Margolis RL (1991). Purification of the centromere-specific protein CENP-A and demonstration that it is a distinctive histone. Proc Natl Acad Sci USA, 88, 3734–3738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A (2017). CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. ELife, 6, e23352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Pan D, Walstein K, Take A, Bier D, Kaiser N, Musacchio A (2019). Mechanism of centromere recruitment of the CENP-A chaperone HJURP and its implications for centromere licensing. Nat Commun, 10, 4046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Parashara P, Medina-Pritchard B, Abad MA, Sotelo-Parrilla P, Thamkachy R, Grundei D, Zou J, Spanos C, Kumar CN, Basquin C, et al. (2024). PLK1-mediated phosphorylation cascade activates Mis18 complex to ensure centromere inheritance. Science, 385, 1098–1104. [DOI] [PubMed] [Google Scholar]
  69. Perea-Resa C, Bury L, Cheeseman IM, Blower MD (2020). Cohesin removal reprograms gene expression upon mitotic entry. Mol Cell, 78, 127–140.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Peters J-M, Tedeschi A, Schmitz J (2008). The cohesin complex and its roles in chromosome biology. Genes Dev, 22, 3089–3114. [DOI] [PubMed] [Google Scholar]
  71. Phansalkar R, Lapierre P, Mellone BG (2012). Evolutionary insights into the role of the essential centromere protein CAL1 in Drosophila. Chromosome Res, 20, 493–504. [DOI] [PubMed] [Google Scholar]
  72. Porter H, Li Y, Neguembor MV, Beltran M, Varsally W, Martin L, Cornejo MT, Pezić D, Bhamra A, Surinova S, et al. (2023). Cohesin-independent STAG proteins interact with RNA and R-loops and promote complex loading. ELife, 12, e79386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Quénet D, Dalal Y (2014). A long noncoding RNA is required for targeting centromeric protein A to the human centromere. ELife, 3, e26016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Régnier V, Novelli J, Fukagawa T, Vagnarelli P, Brown W (2003). Characterization of chicken CENP-A and comparative sequence analysis of vertebrate centromere-specific histone H3-like proteins. Gene, 316, 39–46. [DOI] [PubMed] [Google Scholar]
  75. Rošić S, Köhler F, Erhardt S (2014). Repetitive centromeric satellite RNA is essential for kinetochore formation and cell division. J Cell Biol, 207, 335–349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Schittenhelm RB, Althoff F, Heidmann S, Lehner CF (2010). Detrimental incorporation of excess Cenp-A/Cid and Cenp-C into Drosophila centromeres is prevented by limiting amounts of the bridging factor Cal1. J Cell Sci, 123, 3768–3779. [DOI] [PubMed] [Google Scholar]
  77. Sekulic N, Bassett EA, Rogers DJ, Black BE (2010). The structure of (CENP-A–H4)2 reveals physical features that mark centromeres. Nature, 467, 347–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Sharp JA, Perea-Resa C, Wang W, Blower MD (2020). Cell division requires RNA eviction from condensing chromosomes. J Cell Biol 219(11), 10.1083/jcb.201910148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Shuaib M, Ouararhni K, Dimitrov S, Hamiche A (2010). HJURP binds CENP-A via a highly conserved N-terminal domain and mediates its deposition at centromeres. Proc Natl Acad Sci USA, 107, 1349–1354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Sikder S, Baek S, McNeil T, Dalal Y (2025). Centromere inactivation during aging can be rescued in human cells. Mol Cell, 85, 692–707.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Silva MCC, Bodor DL, Stellfox ME, Martins NMC, Hochegger H, Foltz DR, Jansen LET (2012). Cdk activity couples epigenetic centromere inheritance to cell-cycle progression. Dev Cell, 22, 52–63. [DOI] [PubMed] [Google Scholar]
  82. Stankovic A, Guo LY, Mata JF, Bodor DL, Cao X-J, Bailey AO, Shabanowitz J, Hunt DF, Garcia BA, Black BE, Jansen LET (2017). A dual inhibitory mechanism sufficient to maintain cell-cycle–restricted CENP-A assembly. Mol Cell, 65, 231–246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Swartz SZ, McKay LS, Su K-C, Bury L, Padeganeh A, Maddox PS, Knouse KA, Cheeseman IM (2019). Quiescent cells actively replenish CENP-A nucleosomes to maintain centromere identity and proliferative potential. Dev Cell, 51, 35–48.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Tachiwana H, Müller S, Blümer J, Klare K, Musacchio A, Almouzni G (2015). HJURP involvement in de novo CenH3CENP-A and CENP-C recruitment. Cell Rep, 11, 22–32. [DOI] [PubMed] [Google Scholar]
  85. Thamkachy R, Medina-Pritchard B, Park SH, Chiodi CG, Zou J, de la Torre-Barranco M, Shimanaka K, Abad MA, Gallego Páramo C, Feederle R, et al. (2024). Structural basis for Mis18 complex assembly and its implications for centromere maintenance. EMBO Rep, 25, 3348–3372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Unhavaithaya Y, Orr-Weaver TL (2013). Centromere proteins CENP-C and CAL1 functionally interact in meiosis for centromere clustering, pairing, and chromosome segregation. Proc Natl Acad Sci USA, 110, 19878–19883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Wang J, Liu X, Dou Z, Chen L, Jiang H, Fu C, Fu G, Liu D, Zhang J, Zhu T, et al., (2014). Mitotic regulator Mis18β interacts with and specifies the centromeric assembly of molecular Chaperone Holliday junction recognition protein (HJURP)*. J Biol Chem, 289, 8326–8336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Wong LH, Brettingham-Moore KH, Chan L, Quach JM, Anderson MA, Northrop EL, Hannan R, Saffery R, Shaw ML, Williams E, Choo KHA (2007). Centromere RNA is a key component for the assembly of nucleoproteins at the nucleolus and centromere. Genome Res, 17, 1146–1160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Yesbolatova A, Saito Y, Kitamoto N, Makino-Itou H, Ajima R, Nakano R, Nakaoka H, Fukui K, Gamo K, Tominari Y, et al. (2020). The auxin-inducible degron 2 technology provides sharp degradation control in yeast, mammalian cells, and mice. Nat Commun, 11, 5701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Yu Z, Zhou X, Wang W, Deng W, Fang J, Hu H, Wang Z, Li S, Cui L, Shen J, et al., (2015). Dynamic phosphorylation of CENP-A at Ser68 orchestrates its cell-cycle–dependent deposition at centromeres. Dev Cell, 32, 68–81. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mbc-36-br30-s001.pdf (358.4KB, pdf)
mbc-36-br30-s001.pdf (358.4KB, pdf)

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology

RESOURCES