Abstract
LN19183 is a proprietary blend containing Citrus aurantifolia fruit rind and Theobroma cacao seed extracts in a 2:1 ratio. Recently, LN19183 was found to improve serum glucagon-like peptide-1 (GLP-1) levels after 16 weeks of intake in overweight adults. However, its specific mechanisms remain unknown. Therefore, the present study evaluated whether LN19183 acts through the bitter taste receptor-phospholipase C (PLC)-calcium signaling pathway in the human enteroendocrine L-cell line NCI-H716. The results showed that LN19183 dose-dependently increased relative GLP-1 secretion and reached statistical significance at 50 µg/mL (P<0.05). At the same dose, LN19183 selectively amplified the mRNA expression of bitter taste receptors (hTAS2R3, hTAS2R45, and most strongly, hTAS2R46) and concurrently increased the mRNA expression of α-gustducin. In addition, LN19183 upregulated the mRNA expression of proglucagon and prohormone convertase 1/3. To determine its mechanisms, cells were treated with U73122 (a PLC inhibitor) and 2-aminoethoxydiphenyl borate (an inositol 1,4,5-trisphosphate receptor inhibitor). These treatments inhibited the mRNA expression of proglucagon and secretion of GLP-1. Collectively, these findings indicate that LN19183 activates hTAS2R46-α-gustducin-PLC signaling to stimulate the biosynthesis and secretion of GLP-1. These data provide a molecular rationale for the increase in GLP-1 observed in previous animal and human studies of LN19183, thereby positioning this botanical as a promising adjunct for the prevention or comanagement of obesity and related metabolic diseases.
Keywords: Citrus aurantifolia, glucagon-like peptide-1, hTAS2R, LN19183, Theobroma cacao
INTRODUCTION
Obesity is one of the most pressing health issues worldwide. According to the World Health Organization, over two billion adults (nearly 43% of the global population) are overweight (Boutari and Mantzoros, 2022). Obesity’s high prevalence is related to chronic diseases, including diabetes, cancers, cardiovascular diseases, and liver disorders (Hakkak and Bell, 2016). Obesity results from complex interactions among genetic, environmental, and endocrine factors, including the dysregulation of appetite-regulating hormones (Barness et al., 2007; Chearskul et al., 2012). Among these factors, hormonal imbalance plays an important role in obesity development. Therefore, hormone-based therapies may be a promising treatment strategy for this disease.
Glucagon-like peptide-1 (GLP-1) is an incretin hormone that is released from intestinal L-cells after nutrient intake. It helps decrease blood glucose by enhancing insulin secretion in a glucose-dependent manner, reducing appetite, and promoting weight loss (Shah and Vella, 2014). Because of these effects, GLP-1 is an important target for the treatment of type 2 diabetes and obesity (Heppner and Perez-Tilve, 2015).
According to recent studies, TAS2Rs, which are known for detecting bitterness on the tongue, are also expressed in intestinal L-cells and may trigger the secretion of GLP-1 in response to specific bitter stimuli (Jensterle et al., 2021). Upon activation, hTAS2Rs initiate a signaling cascade involving G protein subunits, especially G α-gustducin. This process triggers the activation of phospholipase C-β (PLCβ), leading to the production of inositol trisphosphate (IP3) and release of calcium ions (Ca2+) from intracellular stores. The resulting increase in intracellular Ca2+ stimulates the exocytosis and secretion of GLP-1 from L-cells. This pathway can be disrupted by inhibiting key signaling molecules (e.g., PLCβ or IP3), thereby reducing GLP-1 secretion. This mechanism highlights TAS2Rs as potential therapeutic targets in the treatment of obesity and metabolic disorders (Jang et al., 2007; Kim et al., 2014).
Citrus aurantifolia fruit rind and Theobroma cacao seed contain polyphenols and alkaloids that are responsible for bitterness and exhibit various pharmacological effects (Ammatalli et al., 2024). C. aurantifolia is abundant in hesperidin and naringin, which promote fatty acid oxidation and inhibit fat accumulation (Sui et al., 2018; Liao et al., 2023). Meanwhile, T. cacao contains theobromine and epicatechin, which are known to enhance lipase activity and stimulate thermogenesis (Loizzo et al., 2012; Castellanos et al., 2018). According to recent studies, the combination of C. aurantifolia and T. cacao extracts (LN19183) decreased body weight and improved body composition in overweight adults after 16 weeks of intake, including an increase in serum GLP-1 levels (Chadalavada et al., 2025). However, the mechanisms specifically related to GLP-1 secretion induced by LN19183 remain unclear and warrant further investigation.
To the best of our knowledge, this study is the first to demonstrate that LN19183 enhances GLP-1 secretion by activating specific human bitter taste receptors in enteroendocrine L-cells. Moreover, we investigated whether LN19183 stimulates GLP-1 secretion via the hTAS2R-G α-gustducin-PLC-IP3/Ca2+ signaling pathway. The present study provides insights into the mechanisms underlying LN19183-mediated GLP-1 secretion and suggests that LN19183 is a promising nutraceutical for the management of obesity and metabolic disorders.
MATERIALS AND METHODS
Test material
LN19183 (also referred to as CL19183 or TheolimTM) was prepared as previously described (Chadalavada et al., 2025). Dried C. aurantifolia was pulverized and extracted with 50% aqueous ethanol at 50°C-60°C for approximately 14-16 h. Dried T. cacao was extracted with water at 50°C-55°C for 9 h. The extracts were concentrated to either thick paste or dry powder under vacuum and blended at a 2:1 ratio. The final product contained 80% herbal blend and 20% excipients (18% GLUCIDEX and 2% SYLOID) (Dodda et al., 2024).
Reagents
Roswell Park Memorial Institute (RPMI) 1640 Medium and fetal bovine serum (FBS) were obtained from Gibco, and antibiotic-antimycotic (AA) was purchased from GenDEPOT (Barker). U73122, 2-aminoethoxydiphenyl borate (2-APB), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-[2H]-tetrazolium bromide (MTT) was obtained from Invitrogen. The RNeasy Mini Kit and GLP-1 ELISA Kit were purchased from Qiagen and Abcam, respectively.
Cell culture
The human enteroendocrine L-cell line NCI-H716 was obtained from the Korean Cell Line Bank. NCI-H716 cells were cultured in suspension at 37°C in a humidified 5% CO2 incubator in RPMI 1640 Medium supplemented with 10% FBS and 1% AA (Gagnon et al., 2015). To perform the NCI-H716 cell experiments, the culture plates (Corning) were first coated with Matrigel and seeded with the appropriate cell density. After two days, the medium was removed and replaced with RPMI 1640 Medium containing 0.5% FBS and 1% AA solution to induce serum starvation. Then, the cells were treated with the test samples.
MTT assay
To assess cell viability, NCI-H716 cells were seeded into 96-well plates at a density of 1×104 cells/well. After 48 h of incubation at 37°C in 5% CO2, the cells were treated with LN19183 (1, 2.5, 5, 10, and 50 µg/mL) and cultured for an additional 16 h. Subsequently, each well was added with MTT reagent (0.5 mg/mL) and incubated for 4 h. After removing the medium, the resulting formazan crystals were fully dissolved in DMSO, and the absorbance was measured at 540 nm using an EpochTM microplate reader (BioTek Instruments).
GLP-1 kit assay
NCI-H716 cells were seeded at a density of 1×106 cells/well into Matrigel-coated six-well plates to determine whether LN19183 induces GLP-1 secretion through the PLC pathway. After a starvation period, the cells were treated with either LN19183 alone (5, 10, or 50 µg/mL), LN19183 (50 µg/mL) plus the PLC inhibitor U73122 (10 µM), or LN19183 (50 µg/mL) plus the IP3-receptor blocker 2-APB (10 µM) for 1 h (Jin et al., 1994; Bootman et al., 2002). The supernatants were collected, and GLP-1 levels were quantified using a GLP-1 ELISA Kit.
Real-time polymerase chain reaction (PCR)
NCI-H716 cells were seeded at a density of 1×106 cells/well in Matrigel-coated six-well plates. After a starvation period, the cells were treated with LN19183 (5, 10, or 50 µg/mL) for 1 h. After treatment, the supernatants were removed, and total RNA was isolated using the RNeasy kit. The RNA concentrations were measured using a Nanodrop spectrophotometer (BioTek Instruments), and cDNA was synthesized using a PCR master mix (Toyobo) at 45°C for 60 min, followed by 95°C for 5 min. Gene expression was quantified on a real-time PCR system (Bio-Rad) using SYBR Green Master Mix (Toyobo). Table 1 shows the primer sequences.
Table 1.
Primers for 21 hTAS2Rs, α-gustducin, GCG, and PC1/3
| Gene | Forward/reverse | Sequence | Expected amplicon (bp) |
|---|---|---|---|
| hTAS2R1 | Forward | GCCCCATGCCTTTATTGTTA | 130 |
| Reverse | GAGGTGAGACTCTAGCATTT | ||
| hTAS2R3 | Forward | AGTGAGGAGATTCTATGTAT | 140 |
| Reverse | TGACCAGAATTCCCAGTGTG | ||
| hTAS2R5 | Forward | TCGCTTGAAGACAGATTACG | 161 |
| Reverse | GAGAAATTCAACCACTGCCA | ||
| hTAS2R8 | Forward | TTAACCTGTTTGCAATTGTC | 140 |
| Reverse | TGGCTCTCACATGAACTTCT | ||
| hTAS2R9 | Forward | CTGTCATTTTCCCATCAAGC | 120 |
| Reverse | GGTCTCTATGGAACAAAAGGC | ||
| hTAS2R10 | Forward | CATTTCCCTTTGGAGACACA | 76 |
| Reverse | ATGAGCTTCTGTGTTGGAGT | ||
| hTAS2R14 | Forward | CCTCACTGCTTTGGCAATCT | 66 |
| Reverse | ACACACACCAGCTTCCGAAT | ||
| hTAS2R19 | Forward | CGAACCATTTCAGCATGTGG | 108 |
| Reverse | CCCCAACAGTATCACCAGAA | ||
| hTAS2R20 | Forward | AGATGCGACCAAAAGAAATT | 120 |
| Reverse | CACCTGCCACAAAACTGAAA | ||
| hTAS2R30 | Forward | TTCAGCTATCCTTCAACCCA | 124 |
| Reverse | GCCCCTCTTGTGAATCTATG | ||
| hTAS2R31 | Forward | CAGCACCAAGGTCCACATAA | 66 |
| Reverse | GTAAACGGCACATAACAAGA | ||
| hTAS2R38 | Forward | TGGCAACCAGGTCTTTAGAT | 120 |
| Reverse | ACTCCAGGACTGAAATGAAC | ||
| hTAS2R39 | Forward | ATTACTGGATTGATACCCTGGC | 147 |
| Reverse | TGTTTTCTTAGTGGAGTTGGAGG | ||
| hTAS2R40 | Forward | TGCCGGCCACTCAGTACAA | 60 |
| Reverse | ACCGCTTCCAGGCTCTTCTC | ||
| hTAS2R41 | Forward | CCATGCAGAACGACTTTTAC | 92 |
| Reverse | TTGAGGTTGCTGAAGATGAG | ||
| hTAS2R42 | Forward | ACTGGTAAACTGCTCTGAAGG | 102 |
| Reverse | ATGTGAAGCAAGTCCCACTAG | ||
| hTAS2R43 | Forward | GACCACGAACCCACCTG | 123 |
| Reverse | ACAAATGTAACCACTACCAG | ||
| hTAS2R45 | Forward | CCTTTGCTGACCAAATTGTCACT | 72 |
| Reverse | TAATAATAACACCCAGAGCAAACCAA | ||
| hTAS2R46 | Forward | CAAAGGATCTCAAGATCCCAGCATG | 122 |
| Reverse | CCAGACTCTCAAAACTCCAAACTGAC | ||
| hTAS2R50 | Forward | GTTGTCATGGTTAGCAAGGC | 124 |
| Reverse | GAGTTGAGAGTTTCAGGTCT | ||
| hTAS2R60 | Forward | ACGGAGCTACTGTGAGAAAT | 123 |
| Reverse | CGGAATCCTGAGGTTGTAAG | ||
| GAPDH | Forward | GGAGCGAGATCCCTCCAAAAT | 197 |
| Reverse | GGCTGTTGTCATACTTCTCATGG | ||
| GNAT3 | Forward | AGAGCAAGGAGTCAGCCAAAAG | 66 |
| Reverse | CGCTCAGCATCCTCCTGAA | ||
| GCG | Forward | GAGGAAGGCGAGATTTCCCAG | 66 |
| Reverse | GAACCATCAGCATGTCTGCG | ||
| PC1/3 | Forward | CAGAAGGCTTTTGAATATGGTGT | 123 |
| Reverse | GGAGGCACTGCTGATGGAGAT |
GCG, proglucagon; PC1/3, prohormone convertase-1/3; GNAT, G protein α-gustducin.
Statistical analysis
All in vitro experiments were performed in duplicate and independently repeated thrice. Data are presented as the mean±standard error of the mean, and the standard deviation was also reported. Statistical analyses were performed using ordinary one-way analysis of variance, followed by Dunnett’s or Tukey’s multiple comparisons tests. Statistical significance was considered at P<0.05, and P<0.01 and <0.001 were considered highly significant.
RESULTS AND DISCUSSION
Effects of LN19183 on GLP-1 secretion
The cytotoxicity of LN19183 was measured using MTT assay in NCI-H716 cells. LN19183 exhibited no cytotoxicity up to 50 µg/mL, maintaining cell viability >93% of the control (NT) (Fig. 1). Based on these data, the relative GLP-1 release after LN19183 treatment at 5, 10, and 50 µg/mL was measured using the GLP-1 ELISA Kit. GLP-1 secretion increased with a significant elevation at 50 µg/mL compared with NT (P<0.05) (Fig. 2). PLC and IP3 are important components of the bitter-taste-receptor-mediated signaling cascade in enteroendocrine L-cells (Bootman et al., 2002; Wang et al., 2025). The PLC inhibitor U73122 prevents the hydrolysis of phosphatidylinositol 4,5-bisphosphate into diacylglycerol and IP3, thereby blocking downstream calcium mobilization. Likewise, 2-APB antagonizes IP3Rs, inhibiting IP3-induced release of calcium from the endoplasmic reticulum. In the present study, cotreatment of NCI-H716 cells with LN19183 and either U73122 or 2-APB abolished the LN19183-induced enhancement of GLP-1 release, decreasing the secretion to NT levels (Fig. 2). This complete reversal indicates that the stimulatory action of LN19183 on GLP-1 secretion strictly depends on PLCβ activation and subsequent IP3-mediated intracellular calcium signaling.
Fig. 1.

Effects of LN19183 on the viability of NCI-H716 cells. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-[2H]-tetrazolium bromide assay was assessed after 16 h exposure to 1-50 µg/mL of LN19183. All experiments were performed in triplicate, and the data are presented as the mean±standard error of the mean. NT, control.
Fig. 2.

Increase in the secretion of glucagon-like peptide-1 (GLP-1) following LN19183 treatment. Secreted GLP-1 levels after treatment with 5, 10, and 50 µg/mL of LN19183 were quantified by colorimetric enzyme-linked immunosorbent assay (ab184857, Abcam). Phospholipase C-β (PLCβ) blockade abolishes LN19183-induced upregulation of GLP-1 by treatment with 10 µM U73122 or 10 µM 2-aminoethoxydiphenyl borate (2-APB). Values with different superscript letters (a-c) in a column are significantly different (P<0.05), as determined by one-way analysis of variance followed by Tukey’s post hoc test. NT, control.
Profiling of hTAS2R gene expression
We examined the mRNA expression levels of 21 human bitter taste receptor genes using real-time quantitative PCR to investigate the expression of hTAS2R genes in differentiated NCI-H716 cells treated with LN19183 (Fig. 3). The results revealed a significant expression of hTAS2R3, hTAS2R45, and hTAS2R46, with hTAS2R46 being the most abundantly expressed. Thus, hTAS2R46 emerges as the most likely target receptor for LN19183. LN19183 contains various polyphenols and alkaloids, including hesperidin and theobromine (Zheng et al., 2004; Chadalavada et al., 2025), whose bitter taste properties may activate hTAS2R46. Considering that bitter taste receptor signaling involves the G protein α-gustducin (GNAT3), we next quantified GNAT3 expression (Jang et al., 2007). LN19183 markedly increased the mRNA expression of GNAT3 (P<0.001), suggesting the activation of the taste receptor pathway (Fig. 4).
Fig. 3.
mRNA expression profiling of hTAS2Rs in differentiated NCI-H716 cells treated with 50 µg/mL of LN19183 for 1 h. The expression levels of all 21 hTAS2Rs were normalized to that of GAPDH. All experiments were performed in triplicate. Statistical analysis was performed using one-way analysis of variance followed by Dunnett’s post hoc test. Values are expressed as the mean±standard error of the mean. ***P<0.001 and *P<0.05 vs. NT. NT, control.
Fig. 4.

Expression of G protein α-gustducin gene (GNAT3) in differentiated NCI-H716 cells treated with 5, 10, and 50 µg/mL of LN19183 for 1 h. The expression levels of GNAT3 were normalized to that of GAPDH. All experiments were performed in triplicate. Statistical analysis was performed using one-way analysis of variance followed by Dunnett’s post hoc test. Values are expressed as the mean±standard error of the mean. ***P<0.001 vs. NT. NT, control.
TAS2R46 responds to a broad spectrum of bitter substances, including sesquiterpene lactones, diterpenes, strychnine, and denatonium benzoate (Brockhoff et al., 2007). Tangeretin and nobiletin, which are present in C. aurantifolia peel (Permadi et al., 2024; Wani et al., 2024), have also been associated with TAS2R46 activation (Kuroda et al., 2016). According to a recent study, the activation of intestinal TAS2R46 may attenuate metabolic disorders by regulating the production of liver lipoproteins, suggesting a possible therapeutic use against obesity and metabolic syndrome (Ding et al., 2025). Although an animal study supported the antiobesity effects of TAS2R46 activation, the findings in the present study highlight TAS2R46 as a potential target for LN19183-mediated weight management.
LN19183 stimulates the secretion of proglucagon (GCG)-encoding GLP-1
We analyzed the mRNA levels of GCG and prohormone convertase-1/3 (PC1/3) by real-time PCR to clarify the molecular basis of GLP-1 release. LN19183 treatment at 50 µg/mL significantly upregulated GCG expression (P<0.05), whereas PC1/3 showed an upward trend (Fig. 5A and 5B). When PLC signaling was blocked with U73122 or 2-APB, the LN19183-induced increase in GCG mRNA expression was completely abolished (Fig. 5C). These results confirmed that LN19183-induced GLP-1 secretion occurs through the PLC-IP3R pathway, which is essential for GCG gene transcription and hormone secretion (Huang et al., 2022; Lee et al., 2023). This mechanistic insight aligns with previous findings that quercetin and other phytochemicals promote the release of GLP-1 through TAS2R-mediated activation of PLC (Wang et al., 2025).
Fig. 5.
Dose-dependent expression of (A) proglucagon gene (GCG) and (B) prohormone convertase-1/3 gene (PC1/3) in differentiated NCI-H716 cells treated with 5, 10, and 50 µg/mL of LN19183 for 1 h. (C) Phospholipase C-β blockade abolishes the LN19183-induced upregulation of proglucagon mRNA by treatment with 10 µM U73122 or 10 µM 2-aminoethoxydiphenyl borate (2-APB). The expression levels of GCG and PC1/3 were normalized to that of GAPDH. All experiments were performed in triplicate. Values are expressed as the mean±standard error of the mean. Statistical analyses for (A) and (B) were performed using one-way analysis of variance followed by Dunnett’s post hoc test (***P<0.001 vs. NT). For (C), one-way analysis of variance followed by Tukey’s post hoc test was performed. Values with different superscript letters (a-c) within a column are significantly different (P<0.05). NT, control.
Collectively, our findings demonstrated that LN19183 stimulated GLP-1 secretion via the hTAS2R-α-gustducin-PLC-IP3/Ca2+ signaling cascade in intestinal L-cells (Fig. 6). The current data provide a molecular explanation for the GLP-1 secretion observed in 16-week human studies with LN19183. In addition, according to a previous animal study, LN19183-induced GLP-1 secretion enhanced peripheral GLP-1 signaling and upregulated GLP-1 receptors in target tissues, including the liver (Chadalavada et al., 2025). The present study corroborated those observations and substantiated LN19183 as a safe (Dodda et al., 2024) and potent adjunct for preventing or comanaging obesity and its associated metabolic disorders.
Fig. 6.

Proposed mechanism behind the effects of LN19183 in stimulating glucagon-like peptide-1 (GLP-1) secretion via the hTAS2R-α-gustducin-phospholipase C (PLC)-IP3/Ca2+ signaling cascade in human enteroendocrine L-cells. 2-APB, 2-aminoethoxydiphenyl borate; PC1/3, prohormone convertase-1/3; ER, endoplasmic reticulum; GCG, proglucagon.
ACKNOWLEDGEMENTS
The authors thank Laila Nutraceuticals, Vijayawada, India for providing the LN19183 in this study.
Footnotes
FUNDING
None.
AUTHOR DISCLOSURE STATEMENT
The authors declare no conflict of interest.
AUTHOR CONTRIBUTIONS
Concept and design: YKS. Analysis and interpretation: HK. Data collection: HK. Writing the article: HK, SP, HSA, CN, YKS. Critical revision of the article: YKS. Final approval of the article: All authors. Statistical analysis: HK. Obtained funding: None. Overall responsibility: YKS.
References
- 1.Ammatalli NKR, Kuricheti SSSK, Veeramachaneni S, Koo YK, Ramanathan G, Yalamanchi A. A combination of Citrus aurantifolia fruit rind and Theobroma cacao seed extracts supplementation enhances metabolic rates in overweight subjects: a randomized, placebo-controlled, cross-over study. Food Nutr Res. 2024. 68:10745. https://doi.org/10.29219/fnr.v68.10745 10.29219/fnr.v68.10745 [DOI] [PMC free article] [PubMed]
- 2.Barness LA, Opitz JM, Gilbert-Barness E. Obesity: genetic, molecular, and environmental aspects. Am J Med Genet A. 2007. 143A:3016-3034. https://doi.org/10.1002/ajmg.a.32035 10.1002/ajmg.a.32035 [DOI] [PubMed]
- 3.Bootman MD, Collins TJ, Mackenzie L, Roderick HL, Berridge MJ, Peppiatt CM. 2-Aminoethoxydiphenyl borate (2-APB) is a reliable blocker of store-operated Ca2+ entry but an inconsistent inhibitor of InsP3-induced Ca2+ release. FASEB J. 2002. 16: 1145-1150. https://doi.org/10.1096/fj.02-0037rev 10.1096/fj.02-0037rev [DOI] [PubMed]
- 4.Boutari C, Mantzoros CS. A 2022 update on the epidemiology of obesity and a call to action: as its twin COVID-19 pandemic appears to be receding, the obesity and dysmetabolism pandemic continues to rage on. Metabolism. 2022. 133:155217. https://doi.org/10.1016/j.metabol.2022.155217 10.1016/j.metabol.2022.155217 [DOI] [PMC free article] [PubMed]
- 5.Brockhoff A, Behrens M, Massarotti A, Appendino G, Meyerhof W. Broad tuning of the human bitter taste receptor hTAS2R46 to various sesquiterpene lactones, clerodane and labdane diterpenoids, strychnine, and denatonium. J Agric Food Chem. 2007. 55:6236-6243. https://doi.org/10.1021/jf070503p 10.1021/jf070503p [DOI] [PubMed]
- 6.Castellanos JM, Quintero CS, Carreno R. Changes on chemical composition of cocoa beans due to combined convection and infrared radiation on a rotary dryer. IOP Conf Ser Mater Sci Eng. 2018. 437:012011. https://doi.org/10.1088/1757-899X/437/1/012011 10.1088/1757-899X/437/1/012011 [DOI]
- 7.Chadalavada A, Koo YK, Kim S, Veeramachaneni S, Ramanathan G, Yalamanchi A. A thermogenic botanical composition containing Citrus aurantifolia fruit rind and Theobroma cacao seed extracts improves body composition in overweight adults: a clinical investigation. Food Nutr Res. 2025. 69:12159. http://dx.doi.org/10.29219/fnr.v69.12159 10.29219/fnr.v69.12159 [DOI] [PMC free article] [PubMed]
- 8.Chearskul S, Kooptiwut S, Pummoung S, Vongsaiyat S, Churintaraphan M, Semprasert N, et al. Obesity and appetite-related hormones. J Med Assoc Thai. 2012. 95:1472-1479. [PubMed]
- 9.Ding C, Ruan J, Huang J, Liu L, Li Y, Du Y, et al. Nuciferine activates intestinal TAS2R46 to attenuate metabolic disorders and hyperlipidemia via hepatic VLDL regulation. Phytomedicine. 2025. 142:156800. https://doi.org/10.1016/j.phymed.2025.156800 10.1016/j.phymed.2025.156800 [DOI] [PubMed]
- 10.Dodda S, Polavarapu S, Alluri KV, Golakoti T, Sengupta K. Acute, subchronic, and genetic toxicity assessments of a composition of Citrus aurantifolia fruit rind and Theobroma cacao seed extracts. J Toxicol. 2024. 2024:4239607. https://doi.org/10.1155/jt/4239607 10.1155/jt/4239607 [DOI] [PMC free article] [PubMed]
- 11.Gagnon J, Brubaker PL. NCI-H716 cells. In: Verhoeckx K, Cotter P, López-Expósito I, Kleiveland C, Lea T, Mackie A, et al, editors. The Impact of Food Bioactives on Health: In Vitro and Ex Vivo Models. Springer. 2015. p 221-228. 10.1007/978-3-319-16104-4_20 [DOI] [PubMed]
- 12.Hakkak R, Bell A. Obesity and the link to chronic disease development. J Obes Chronic Dis. 2016. 1:1-3. https://doi.org/10.17756/jocd.2016-001 10.17756/jocd.2016-001 [DOI]
- 13.Heppner KM, Perez-Tilve D. GLP-1 based therapeutics: simultaneously combating T2DM and obesity. Front Neurosci. 2015. 9:92. https://doi.org/10.3389/fnins.2015.00092 10.3389/fnins.2015.00092 [DOI] [PMC free article] [PubMed]
- 14.Huang TT, Gu PP, Zheng T, Gou LS, Liu YW. Piperine, as a TAS2R14 agonist, stimulates the secretion of glucagon-like peptide-1 in the human enteroendocrine cell line Caco-2. Food Funct. 2022. 13:242-254. https://doi.org/10.1039/d1fo02932k 10.1039/D1FO02932K [DOI] [PubMed]
- 15.Jang HJ, Kokrashvili Z, Theodorakis MJ, Carlson OD, Kim BJ, Zhou J, et al. Gut-expressed gustducin and taste receptors regulate secretion of glucagon-like peptide-1. Proc Natl Acad Sci U S A. 2007. 104:15069-15074. https://doi.org/10.1073/pnas.0706890104 10.1073/pnas.0706890104 [DOI] [PMC free article] [PubMed]
- 16.Jensterle M, Rizzo M, Janez A. Glucagon-like peptide 1 and taste perception: From molecular mechanisms to potential clinical implications. Int J Mol Sci. 2021. 22:902. https://doi.org/10.3390/ijms22020902 10.3390/ijms22020902 [DOI] [PMC free article] [PubMed]
- 17.Jin W, Lo TM, Loh HH, Thayer SA. U73122 inhibits phospholipase C-dependent calcium mobilization in neuronal cells. Brain Res. 1994. 642:237-243. https://doi.org/10.1016/0006-8993(94)90927-x 10.1016/0006-8993(94)90927-X [DOI] [PubMed]
- 18.Kim KS, Egan JM, Jang HJ. Denatonium induces secretion of glucagon-like peptide-1 through activation of bitter taste receptor pathways. Diabetologia. 2014. 57:2117-2125. https://doi.org/10.1007/s00125-014-3326-5 10.1007/s00125-014-3326-5 [DOI] [PMC free article] [PubMed]
- 19.Kuroda Y, Ikeda R, Yamazaki T, Ito K, Uda K, Wakabayashi K, et al. Activation of human bitter taste receptors by polymethoxylated flavonoids. Biosci Biotechnol Biochem. 2016. 80: 2014-2017. https://doi.org/10.1080/09168451.2016.1184558 10.1080/09168451.2016.1184558 [DOI] [PubMed]
- 20.Lee SH, Ko HM, Jee W, Kim H, Chung WS, Jang HJ. Isosinensetin stimulates glucagon-like peptide-1 secretion via activation of hTAS2R50 and the Gβγ-mediated signaling pathway. Int J Mol Sci. 2023. 24:3682. https://doi.org/10.3390/ijms24043682 10.3390/ijms24043682 [DOI] [PMC free article] [PubMed]
- 21.Liao JT, Huang YW, Hou CY, Wang JJ, Wu CC, Hsieh SL. D-limonene promotes anti-obesity in 3T3-L1 adipocytes and high-calorie diet-induced obese rats by activating the AMPK signaling pathway. Nutrients. 2023. 15:267. https://doi.org/10.3390/nu15020267 10.3390/nu15020267 [DOI] [PMC free article] [PubMed]
- 22.Loizzo MR, Tundis R, Bonesi M, Menichini F, De Luca D, Colica C, et al. Evaluation of Citrus aurantifolia peel and leaves extracts for their chemical composition, antioxidant and anti-cholinesterase activities. J Sci Food Agric. 2012. 92:2960-2967. https://doi.org/10.1002/jsfa.5708 10.1002/jsfa.5708 [DOI] [PubMed]
- 23.Permadi N, Nurzaman M, Doni F, Julaeha E. Elucidation of the composition, antioxidant, and antimicrobial properties of essential oil and extract from Citrus aurantifolia (Christm.) Swingle peel. Saudi J Biol Sci. 2024. 31:103987. https://doi.org/10.1016/j.sjbs.2024.103987 10.1016/j.sjbs.2024.103987 [DOI] [PMC free article] [PubMed]
- 24.Shah M, Vella A. Effects of GLP-1 on appetite and weight. Rev Endocr Metab Disord. 2014. 15:181-187. https://doi.org/10.1007/s11154-014-9289-5 10.1007/s11154-014-9289-5 [DOI] [PMC free article] [PubMed]
- 25.Sui GG, Xiao HB, Lu XY, Sun ZL. Naringin activates AMPK resulting in altered expression of SREBPs, PCSK9, and LDLR to reduce body weight in obese C57BL/6J mice. J Agric Food Chem. 2018. 66:8983-8990. https://doi.org/10.1021/acs.jafc.8b02696 10.1021/acs.jafc.8b02696 [DOI] [PubMed]
- 26.Wang C, Zhou J, Liu X, Zhu F, Li J, Xu W, et al. Quercetin enhances GLP-1 secretion via TAS2R38-mediated PLC signaling in enteroendocrine L-cells. Mol Nutr Food Res. 2025. 69:e70109. https://doi.org/10.1002/mnfr.70109 10.1002/mnfr.70109 [DOI] [PubMed]
- 27.Wani I, Koppula S, Balda A, Thekkekkara D, Jamadagni A, Walse P, et al. An update on the potential of tangeretin in the management of neuroinflammation-mediated neurodegenerative disorders. Life (Basel). 2024. 14:504. https://doi.org/10.3390/life14040504 10.3390/life14040504 [DOI] [PMC free article] [PubMed]
- 28.Zheng XQ, Koyama Y, Nagai C, Ashihara H. Biosynthesis, accumulation and degradation of theobromine in developing Theobroma cacao fruits. J Plant Physiol. 2004. 161:363-369. https://doi.org/10.1078/0176-1617-01253 10.1078/0176-1617-01253 [DOI] [PubMed]


