Abstract
Enterococcus faecium, a multidrug-resistant (MDR), commensal human pathogen, frequently causes nosocomial infections and imposes serious threat to public health, which demanded more research for the development of alternative therapeutics against them. Bacteriophage therapy as an alternative to antibiotics has reappeared as therapeutics against MDR bacterial infections. Here, we isolated and characterized a novel lytic phage, RG1, from the Ganga River against E. faecium ATCC 35667 and checked their efficacy against several clinical isolates of E. faecium. Whole genome sequencing revealed that the RG1 belongs to genus Efemquintavirus, and has a dsDNA genome of 41,364 base pairs with 35.54% GC content, which encodes 65 putative open reading frames without any virulence, antibiotic resistance or lysogeny genes. Bacteriophage RG1 displayed high stability across different pH, temperatures and chloroform concentrations. The phage RG1 exhibited antibacterial and antibiofilm activity over both ATCC and clinical isolates of E. faecium likely due to its wider host range, which paves the way inside the precision phage therapy. Interestingly, the presence of ribose, maltose and trehalose sugars showed more suppression of bacterial growth of MDR E. faecium isolate in presence of the phage RG1, while sugar alcohols synergistically supported host lysis by this phage. These findings highlight the therapeutic potential of the phage RG1 against the MDR E. faecium under clinical setup.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-21701-3.
Keywords: Enterococci, Antibiotic resistance, Sugar molecules, Biofilm, Phage therapy
Subject terms: Antimicrobials, Bacteria, Bacteriophages, Biofilms, Phage biology, Virology
Introduction
Antimicrobial resistance (AMR) has been declared as one of the major global problems of the 21st century by the World Health Organization (WHO) that can have a serious impact on society, economy, public health and food safety1. Infections caused by antibiotic-resistant bacteria have increased the burden of both healthcare-associated and community-acquired infections, and have demanded coordinated actions at the global, national and sub-national levels for their control. The WHO in collaboration with the Department of Biotechnology, India, has prepared the ‘Indian Priority Pathogen List’ (IPPL) to guide research, discovery and development of new antibiotics in India2. According to IPPL, Enterococcus species resistant to vancomycin, cephalosporin, linezolid and daptomycin are kept in the high-priority category. Enterococci are Gram-positive, facultative anaerobe, gut commensals and opportunistic pathogens that can cause urinary tract infections (UTI), endocarditis, meningitis, neonatal and surgical wound infections, which comprises of 87 species of large groups1,3–5. Among these, E. faecalis and E. faecium are clinically important pathogens and are often linked with the emergence of multidrug resistance (MDR)6. They have evolved such resistance due to the plasticity of their genome and ability to acquire and transmit a plethora of antibiotic resistance factors7,8. Owing to the scarcity of effective medicines for treating MDR E. faecium infections, physicians frequently prescribe combinations of antibiotics that lead to serious adverse side effects, drug-drug interactions, dysbiosis, and the inability to cure the disease. It poses significant risks to society, economy, global public health, and food safety9–11. There are various alternatives to antibiotics, which include predatory bacteria, bacteriocins and phage therapy. Fascinatingly, these therapeutics increase the effectiveness of antibiotics by enhancing bacterial killing and reducing the prevalence of antibiotic resistance12.
Bacteriophages, viruses that specifically prey on bacteria, are being used as an excellent antibacterial agent against several pathogenic bacteria with minimal toxicity and less environmental impacts13. A primary difficulty in phage therapy is the identification of appropriate phages for therapeutic application14. This inability to identify suitable phages is prevalent and may obstruct fast advancements in phage therapy15,16. Although, phage therapy is significantly more specific to the targeted bacteria due to its narrow host-range than antibiotic therapy; therefore, unwanted consequences for non-targeted microorganisms are minor. However, these phages are less important when treating polymicrobial infections or during the onset of phage resistance in targeted bacteria17. In such cases, a bacteriophage with capability to infect more than one bacterial strain is always beneficial due to increased treatment success18. Lytic phages can naturally control bacterial populations, making them useful for treating multidrug-resistant pathogens in clinical settings19,20.
Currently, there are only 55 research publications on phage therapy for E. faecium in the NCBI PubMed (~ 70% in the last 5 years) with 43 sequenced E. faecium bacteriophage genome including the phage RG1 submitted to NCBI till March 2025, which is comparatively less studied than the phage therapy research against Staphylococcus aureus (719 publications) Pseudomonas aeruginosa (607 publications), and Klebsiella pneumoniae (320 publications)21. This disparity is particularly significant in light of growing therapeutic importance of E. faecium, which demands the characterization of more phages with wider host range for the development of more therapeutic options to treat MDR E. faecium. High level of sugars (primarily in urine) supported growth & biofilm formation by uropathogenic bacteria, weakened immune defense, increased adherence of pathogens and altered urinary tract function, and thus can contribute in development and progression of UTI22,23. Further, there are limited studies about the impacts of various monosaccharides and disaccharides on uropathogenic E. faecium and associated bacteriophages.
This article discusses the isolation and characterisation of a novel E. faecium phage RG1, highlighting the potential use in phage therapy. We employed the phage RG1 against several MDR clinical isolates of E. faecium to monitor its bacteriolytic and antibiofilm properties. We studied the impacts of several monosaccharides and disaccharides on bacterial growth and host-phage interaction. This study enhances the comprehension and management of urinary tract related bacterial infections and may serve as a basis for future phage therapy. An extensive collection of thoroughly characterized Enterococcus phages can be a valuable resource in combating MDR E. faecium infections.
Materials and methods
Bacterial strain and media conditions
E. faecium ATCC 35667 was used as a host strain for the isolation of bacteriophage. The host cells were cultured in Brain Heart Infusion (BHI) broth (3.5% w/v) for overnight at 150 rotations per minute (rpm) and 37 °C in an orbital shaker24. For isolation, purification, amplification, and characterization of Enterococcus Phage RG1, bacterial cells were sub-cultured in BHI media from the overnight grown primary culture, and allowed to grow till Optical Density (OD) of ~ 0.6. The lawn of E. faecium was prepared through double-layer agar plates method by pouring bottom agar with 1.75% w/v LB agar and top agar made of 0.8% w/v BHI agar containing a mixture of host culture and bacteriophage. These plates were incubated for overnight at 37 °C.
Isolation, purification and naming of RG1 phage
Twenty soil samples (named RS1 to RS10 and RG1 to RG10) were collected from various localities or streets near the drainage of ‘Ravidas Ghat’ of the Ganga River in Varanasi, India. Isolation of Enterococcus phage was carried out as detailed in the PhagesDB database with slight changes25. Each soil sample (~ 4–5 g) was mixed with 1 ml of phage buffer [10 mM Tris-HCl (pH 7.5), 10 mM MgSO4, 68.5 mM NaCl, and 1 mM CaCl2], 0.5 ml of E. faecium broth culture and 1 ml of BHI media, thereafter it was incubated with mixing at room temperature (RT) for overnight. The supernatant was collected after centrifugation at 10,000 rpm for 5 min at RT and filtered through a 0.22-µm syringe filter. The filtrate (0.1 ml) was mixed with 0.5 ml of mid-log phase E. faecium culture in BHI broth and incubated at 37 °C for 30 min followed by mixing with 5 ml of 0.8% w/v soft BHI agar for double-layer agar plating. Plates were incubated at 37 °C overnight for plaque formation. Any appeared plaques were scraped using a sterile plastic microtip, suspended in 1 ml of phage buffer for overnight at 4 °C and filtered across a 0.22-µm syringe filter after centrifugation of 5 min at 10,000 rpm and RT. Isolated phage was then amplified by infection of E. faecium ATCC 35667 using double agar plating method as mentioned above. After three consecutive rounds of phage purification from single plaque, bacteriophage was resuspended in a phage buffer having 0.1% (v/v) chloroform for storage at 4 °C. The phage RG1 was named for ‘Sant Ravidas Ghat’, one of the ancient ghats of the Ganga River present in Varanasi, U.P., India.
Host range determination
For host range determination apart from host E. faecium ATCC 35667, specificity of the RG1 was also tested toward several Gram-negative and Gram-positive bacterial species viz., Burkholderia cepacia, Pseudomonas aeruginosa, Proteus mirabilis, Klebsiella oxytoca, E. faecalis, Staphylococcus aureus, and Deinococcus radiodurans. In brief, 10 µl of phage lysate (10⁸ PFU/ml) was dropped onto the streaked bacterial culture, air-dried, and incubated overnight at 37 °C. Effect of the RG1 on the lawn of different bacterial hosts was imaged using a digital camera. In addition, we measured the efficiency of plating (EOP) by counting the phage titer (with 107 PFU/ml RG1 phage) against of 19 different clinical isolates of E. faecium and other bacterial species as mentioned above using double layer agar plating. The EOP was calculated as: PFU/ml of RG1 phage on test strain/species divided by the PFU/ml of RG1 phage on ATCC 35667 strain.
Transmission electron microscopy
The ultrastructure of E. faecium phage RG1 was studied using a transmission electron microscope (TEM)26. One drop of phage buffer containing high titer of the phage RG1 (108 PFU/ml) was dropped onto a carbon-coated copper grid and incubated for 1 min. After rinsing with sterile ultrapure water, the grid was negatively stained with 1% phosphotungstic acid for 1 min, and washed with sterile ultrapure water. The excess moisture was removed by air drying. The phage particles were visualized and imaged at an accelerating voltage of 80 kV by using TECNAI 200 kV TEM (Fei, Electron Optics) at SAIF Facility, AIIMS, New Delhi. Images were analysed using ImageJ 2.0 software.
Optimal multiplicity of infection (MOI) study
E. faecium ATCC 35667 was grown till the mid-exponential phase (OD600 0.6) in BHI broth at 37 °C and 150 rpm, and serially diluted with the same media by keeping the initial Colony Forming Unit (CFU) as ~ 1 × 107. A constant PFU of phage RG1 was added to vials containing 500 µl of serially diluted E. faecium cells in BHI media to achieve different MOIs viz. 10, 1, 0.1, 0.01, 0.001 and 0.0001. These host-phage mixtures were incubated at 37 °C with orbital shaking at 150 rpm for 12 h. The cell lysates were centrifuged at 10,000 rpm for 5 min at RT and supernatant was filtered through 0.22 μm filter syringe. The phage titer was determined for each MOI sample as defined above. The MOI at which maximum number of phage plaques reported was perceived as the optimal multiplicity of infection. The experiment was repeated three times for statistical significance.
One-step growth curve
It is used to study the replication dynamics of bacteriophages by analysing the phage lytic development. This provides necessary information about the latency period and burst size of phages. One-step growth for the RG1 was studied with slight modifications as described earlier27. Briefly, mid-exponential phase E. faecium cells (0.9 ml of 1 × 108 CFU/ml) were co-incubated with phage RG1 at an MOI of 0.001 (0.1 ml of 9 × 105 PFU/ml) and 37 °C with orbital shaking for 15 min. This mixture was centrifuged at 6,000 rpm for 10 min at 4 °C to remove the free/unattached phages. The cell pellet was resuspended in 10.0 ml of fresh BHI broth at 37 °C. The PFU was measured at intervals of 10 min up to 120 min. The burst size was calculated as a ratio of the phages produced during the rise period to the initial number of infected bacterial cells. Statistical analysis from three independent experiments was done using GraphPad Prism software (version 5.01).
Thermal, pH and chloroform stability
The viability of RG1 phage at different temperatures (4 °C, 15 °C, 25 °C, 37 °C, 45 °C, 55 °C, and 65 °C) was estimated by incubating the 0.1 ml of phage RG1 (~ 108 PFU/ml) for 1 h at each temperature. The bacteriophage titer was counted by double-layer agar plate technique28. For pH stability test, 0.1 ml of RG1 (~ 108 PFU/ml) in phage buffer was diluted in 0.9 ml of physiological saline (0.9% NaCl solution) having different pH ranges (2.0–13.0) and incubated at 37 °C for 1 h to ascertain the effect of pH on phage′s viability29. The double-layer agar plate technique was employed to estimate the phage titer from each sample. In addition, the stability of RG1 towards chloroform was determined by incubating 0.1 ml of phage RG1 (~ 108 PFU/ml) with different concentrations of chloroform (0%, 10%, 30%, 50%, and 90%) at 37 °C for 10 min. After centrifugation at 8000 rpm for 5 min at RT, the supernatant was used for the calculation of phage titer by the double-layer agar method. These experiments were carried out in triplicates to perform statistical analysis using GraphPad Prism software (version 5.01).
Genomic DNA isolation, sequencing and annotation
Genomic DNA of the phage RG1 was isolated by the phenol-chloroform-isoamyl (PCI)–sodium dodecyl sulfate (SDS) method as described previously30,31. Briefly, high titer RG1 phage was purified by double layer BHI agar method as described above, and incubated with DNase (8 µg/ml) and RNaseA (5 µg/ml) for 30 min at RT. Thereafter, SDS-proteinase K method was used to isolate the RG1 genomic DNA and then purified twice with the Phenol: Chloroform: Isoamyl alcohol (25:24:1). Before genome sequencing, the integrity of the genome was confirmed in 0.8% agarose gel through electrophoresis. The genome of phage RG1 was sequenced by utilizing the Illumina NovaSeq X series outsourced from Anuvanshiki (OPC) Pvt. Ltd., New Delhi. The raw reads were processed with FastQC (v.0.12.1) and MultiQC (v.1.21.1) to eliminate errors and were trimmed for quality assurance. De novo assembly methods with an average coverage of 100X were employed after quality evaluation, and the quality-trimmed reads were assembled into draft contigs with the help of MEGAHIT assembler32. A newly assembled genome was evaluated using CheckV and viralComplete33. Both of these tools assess the assembly based on complete viral genomes from both isolates and environmental samples. Genome annotation was performed by using Pharokka [34] which uses PHANOTATE, Prodigal and Prodigal-gv for gene prediction followed by functional annotation using HMMER3 (http://www.ebi.ac.uk/Tools/hmmer) and MMSeq2 utilizing the predicted CDS against the databases such as PHROGS, CARD and VFDB35. The annotated functional genes along with hypothetical proteins were confirmed from National Center for Biotechnology Information (NCBI) and PhagesDB database. The whole genome sequence of Enterococcus RG1phage was submitted to NCBI with GenBank accession number PQ586903.
Genome analysis
The genome of the RG1 bacteriophage was analysed using BLAST, and the fifteen phages with high percentage identity to RG1 were selected for further comparison. For synteny analysis, GenBank format files were downloaded for each of the selected bacteriophages. Gene products were categorized into major functional groups such as structural proteins, DNA replication and metabolism, host cell lysis, tail proteins, assembly proteins, additional proteins function, and hypothetical proteins. Then the BLASTN genome comparison was performed and the diagram was visualized with EasyFig v2.2.236. Average nucleotide identity (ANI) between the isolated RG1 and the fifteen most similar bacteriophages listed above were calculated using VIRIDIC v1.137. The analysis was conducted with default species and genus thresholds set at 95% and 70%, respectively.
To elucidate the evolution and relationship of phage RG1 with other E. faecium phages, the protein sequences of DNA polymerase, terminase small subunit, holin, and major tail protein of RG1 were compared with those of fifteen additional E. faecium phages (used for synteny analysis). We conducted BLASTP analyses through NCBI to identify homology with RG1. The phylogenetic tree was constructed using MEGA 11.0 software38.
Collection of clinical isolates, diagnostic PCR, biofilm formation ability and antimicrobial susceptibility test
Total 59 clinical isolates of E. faecium were obtained from urine samples of urinary tract infection (UTI) patients at Sir Sunderlal Hospital, Banaras Hindu University, Varanasi. These isolates were initially identified biochemically and further confirmed by diagnostic PCR using specific primers viz. forward primer 5’TTGAGGCAGACCAGATTGACG3’ and the reverse primer 5’TATGACAGCGACTCCGATTCC3’ targeting D-alanine-D-alanine ligases (ddl) of E. faecium39. The PCR amplicon of a specific 658 bps was confirmed by agarose gel electrophoresis (Fig. S1). These clinical isolates were screened for their biofilm formation ability, and grouped into non-biofilm former, weak-biofilm former, moderate-biofilm former and strong-biofilm former as described by Singh et al. (Table S1)40. The antimicrobial susceptibility testing (AST) of strong-biofilm forming clinical isolates was performed against the antibiotics including ampicillin, nitrofurantoin, vancomycin, linezolid, gentamicin and tetracycline using the disk diffusion method as per the guidelines of Clinical and Laboratory Standards Institute (CLSI)41. The zone of inhibition for each antibiotic was analysed, and isolates were categorized as sensitive (+) or resistant (-) according to the CLSI breakpoints as listed in (Table S2).
Bacterial growth Inhibition assay
The mid-exponential phase grown culture (0.1 ml) of E. faecium ATCC 35667 (OD600 0.6) with CFU adjusted to ~ 1 × 107 CFU/ml in BHI broth was diluted with either an equal volume of fresh BHI broth as a control or phage buffer containing different MOI of RG1 phage such as 0.01, 0.1, 1 and 10 in the 96-well microtiter plate. The bacterial growth kinetics were monitored in triplicates by measuring the absorbance at 600 nm for 4 h at 37 °C with orbital shaking using a Multi-Mode Microplate Reader (BioTek Synergy H1M). Additionally, bacterial growth rate at each MOI was calculated with the help of the formula (Nt = N0 * (1 + r)t) where Nt is absorbance at time t, N0 is absorbance at start of the growth, r is growth rate, and t is time passed as described in42.
We also monitored the bacteriolytic activity of RG1 phage on 19 different clinical isolates of E. faecium with strong biofilm forming ability obtained from urinary tract infection (UTI) patients in broth culture as described above. In brief, the mid-exponential phase bacterial culture with ~ 1 × 107 CFU in 0.1 ml of BHI broth was treated with RG1 phage at 0.1 MOI in 96 well microtiter plate, and growth kinetics were monitored for 4 h. The growth rate was calculated from the growth curve data and compared with untreated control bacterial isolates. The experiments were performed in triplicates for statistical analysis using GraphPad Prism software (version 5.01).
Bacterial stability study in presence of different sugar molecules
We checked the effect of different sugars such as ribose, glucose, fructose, maltose, sucrose, lactose, trehalose, sorbitol, and mannitol on bacterial growth in the absence and presence of RG1 phage. Various concentrations (0%, 0.1%, 0.2%, 0.5% and 1.0%) of each sugar in sterile ultrapure water were added in 0.1 ml of bacterial culture (~ 1 × 107 CFU) without and with RG1 phage at MOI of 0.1. The bacterial growth kinetics and growth rate were estimated as described above. The experiments were done in triplicates to calculate Mean ± SD and plotted as the growth rate (% per hour) vs. various concentrations of each sugar using GraphPad Prism software (version 5.01).
Biofilm Inhibition and disruption assay
Antibiofilm assay for RG1 phage was performed using the crystal violet (CV) staining as previously described with slight modifications43,44. In brief, 10 µl of E. faecium ATCC 35667 culture (4 × 108 CFU/ml) was inoculated into Tryptic Soy Broth (TSB) medium to a final volume of 200 µl in 96-wells microtiter plate, and incubated for 24 h at 37 °C. After 24 h, residual media were aspirated and biofilm was treated with 0.1 and 1 MOIs of phage RG1 in 0.1 ml phage buffer for 2 h and 4 h at 37 °C. For control, a similar volume of phage buffer was added. Similarly, for biofilm inhibition, RG1 coinfection with E. faecium was done at the time of experiment setup for 24 h. From the post-infection (PI) of 2 h & 4 h, and coinfection (CI) of 24 h, non-adherent bacteria were removed by washing three times with PBS buffer. The remaining adherent bacteria were heat-fixed at 59 °C for 60 min and stained for 30 min using 200 µl of 0.1% (w/v) CV. After staining, the wells were washed twice with distilled water and air-dried in an incubator. Subsequently, 200 µl of 33% acetic acid was used to dissolve the bound dye for 15 min, and the optical density of each well was measured at 545 nm using a multi-mode microplate reader (BioTek Synergy H1M).
We also estimated the antibiofilm activity of RG1 phage on 19 different clinical isolates of E. faecium with strong biofilm formation ability obtained from UTI patients. For this, 24 h grown bacterial biofilm in 96 well microtiter plates from each isolate were treated with the phage RG1 of titer 107 PFU/ml for 4 h at 37 °C with respect to control using phage buffer only. After 4 h, spent buffer solutions from treated and untreated wells were decanted, and wells were washed thrice with a PBS buffer. The CV assay for adhered biofilm was performed as described above. The assays were repeated three times independently, and the data were processed for statistical analysis and plotting using GraphPad Prism software (version 5.01).
Biocontrol assay
The potential of RG1 phage as a biocontrol tool against the multidrug-resistant clinical isolate of E. faecium 15166 was estimated as described in45. In detail, 10 ml of E. faecium 15166 was grown till mid-log phase in BHI broth at 37 °C to achieve a cell number of ~ 104 CFU/ml. To 0.5 ml of bacterial culture, 50 µl of RG1 phage was added at varying MOIs (0.1, 1, and 10), and incubated with slow shaking for 0, 4, 8 and 24 h at 37 °C. Bacterial cells were pelleted at each time point and total viable cells were counted by spreading on BHI agar plate. There were two biological and three technical replicates for each condition to perform statistical analysis using GraphPad Prism software (version 5.01)45.
Statistical analysis
All the experiments were executed at least three times to perform statistical analysis such as one-way ANOVA or t-test using GraphPad Prism software (version 5.01), and statistical significance was considered if the P < 0.05.
Results
Isolation of Enterococcus phage RG1, and determination of its host range and morphology
We used a non-pathogenic laboratory strain E. faecium ATCC 35667 as a host bacterium for isolation of a bacteriophage. We collected 20 moist soil samples (named RS1 to RS10 and RG1 to RG10) from different sites along the bank of the Ganga River in Varanasi and screened them for the availability of lytic phage against the selected host. We found a phage from the soil sample RG1 collected from the “Ravidas Ghat” near the bank of the Ganga River in Varanasi, with the geographical coordinates as “25.280000 N 83.010000 E” and named accordingly ‘RG1’. The clear plaques produced by RG1 on host E. faecium lawn in a double agar plate were analysed after 24 h of incubation at 37 °C. The average diameter of the phage RG1 plaques was found to be 2.1 ± 0.01 mm (Fig. 1A). Further, we monitored the host range and efficacy of RG1 phage against eight different Gram-negative and Gram-positive bacterial species including E. faecium on agar plate as described in methodology, and observed that RG1 forms a clear zone on streaked E. faecium but not on other bacterial species (Fig. 1B). This suggests that RG1 phage is specific to their host, and lyse them with high efficacy. In addition, the EOP analysis revealed that phage RG1 can infect 17 clinical isolates of E. faecium out of 19 (89.47%), propounding a wider host range of RG1 within E. faecium but failed to lyse other bacterial species. These observations underline its potential use in clinical conditions for phage therapy (Table 1; Supplementary Fig. S2).
Fig. 1.

Isolation and characterization of the phage RG1. (A) Formation of plaques with a diameter of 2.1 ± 0.3 mm on Enterococcus faecium ATCC 35667 lawn by the phage RG1 using the double agar method. (B) Host Range analysis of phage RG1 against (a) E. faecium ATCC 35667 (b) E. faecalis (c) Pseudomonas aeruginosa (d) Klebsiella oxytoca (e) Burkholderia cepacia (f) Deinococcus radiodurans (g) Proteus mirabilis (h) Staphylococcus aureus. (C) Transmission Electron Microscopy-based morphological analysis of the phage RG1 showing an icosahedral head with a diameter of 53.96 ± 1.56 nm and a non-contractile tail with a length of 196.0 ± 6.86 nm. (D) Effect of different temperatures (for 1 h), (E) pH (for 1 h) and (F) chloroform concentrations (for 10 min) on the stability and viability of the phage RG1 was measured using 0.1 ml of ~ 108 PFU/ml of phage in double agar method. The X-axis denotes various environmental conditions, and the Y-axis indicates titer (Log10 PFU/ml) of the bacteriophage RG1. ND means ‘not detected’. Statistical analysis from three independent experiments was performed using GraphPad Prism software (version 5.01). The p values less than 0.05 and 0.01 were indicated as (*) and (**), respectively.
Table 1.
Host range for phage RG1 using efficiency of plating (EOP) method.
| Strains/phage | Efficiency of plating (phage RG1) | |
|---|---|---|
| E. faecium | ATCC 35667 | 1 |
| 11273 | 0.204 | |
| 13380 | 0.244 | |
| 14342 | 0.289 | |
| 14787 | 0.332 | |
| 14865 | 0.343 | |
| 15166 | 0.403 | |
| 15415 | 0.454 | |
| 15576 | 0.105 | |
| 15658 | 0.467 | |
| 15690 | 0.499 | |
| 15768 | 0.004 | |
| 15934 | 0.178 | |
| 16870 | 0.212 | |
| 17889 | 0.223 | |
| 17926 | 0.167 | |
| 18413 | 0.211 | |
| 18685 | 0.278 | |
| 19028 | 0.301 | |
| 19185 | 0.006 | |
| E. faecalis | ATCC 29212 | No lysis |
| D. radiodurans | R1 | No lysis |
| S. aureus | MCC 2408 | No lysis |
| B. cepacia | MCC 2275 | No lysis |
| P. mirabilis | MCC 4207 | No lysis |
| P. aeruginosa | PAO1 | No lysis |
| K. pneumoniae | MCC 2452 | No lysis |
We visualized the bacteriophage morphology using the TEM at 80 kV after negative staining with 1% phosphotungstic acid. TEM investigation indicated that RG1 possesses a regular icosahedral head with a diameter of 53.96 ± 1.56 nm and a long, non-contractile tail with a length of 196.0 ± 6.86 nm (Fig. 1C). Following the norms of the International Committee on Taxonomy of Viruses, RG1 can be considered as a Siphovirus-like bacteriophage (genus Efemquintavirus).
Stability of RG1 phage towards the wide range of temperature, pH and chloroform concentrations
We monitored the stability of bacteriophage RG1 over a wide range of temperatures, pH and chloroform concentrations by measuring the changes in phage titer or plaque-forming units (PFU) under each condition. Thermal stability was assessed by incubating the phage at temperatures ranging from 4 °C to 65 °C for 1 h in the phage buffer before infection to the host bacterium. RG1 phage exhibited thermal stability of nearly 100% of its infectivity in the temperature range of 4 °C to 55 °C and retained the titer of ~ 108 PFU/ml with no significant change. However, on incubation at 65 °C, the phage titer dropped to ~ 106 PFU/ml with significant deviation for temperatures ≤ 55 °C (Fig. 1D). The pH stability of phage RG1 was assessed across a wide pH range of 2 to 13. We observed a nearly insignificant change in the stability of phage RG1 across the pH range of 4 to 11 with a phage titer of ~ 108 PFU/ml. The viability has significantly reduced to 10-fold at pH 3 with titer ~ 107 PFU/ml. Further, we did not observe any viable phage titer under extreme acidic (pH 2) or basic (pH 12 and 13) conditions (Fig. 1E). These observations have suggested that phage RG1 is stable across a wide acidic and basic pH range.
The stability analysis of RG1 in the presence of organic solvent chloroform revealed that RG1 is insensitive toward the different concentrations of chloroform (0%, 10%, 30%, 50%, and 90%) and maintains a phage titer of ~ 108 PFU/ml (Fig. 1F). Overall, Enterococcus phage RG1 showed excellent stability towards different environmental conditions, including a wide range of temperature, pH and chloroform solution, highlighting its potential for phage therapy.
Optimal multiplicity of infection and one-step growth curve of the phage RG1
The multiplicity of Infection (MOI) for bacteriophages represents the ratio of phage particles to their infection targets i.e. host bacterium. We measured the phage titer for different MOIs in the range of 10 to 0.0001, and reported the highest phage titer with 4 × 109 PFU/ml at an MOI of 0.1. This observation suggested that the optimum MOI of RG1 for E. faecium was 0.1, which denotes that one phage particle per ten bacterial cells can induce maximum progenies in the growth medium (Fig. 2A).
Fig. 2.

The multiplicity of infection and one-step growth curve analysis of the phage RG1. (A) Estimation of phage titer (Log10 PFU/ml) at different MOIs of the phage RG1 against E. faecium ATCC 35667 by the double agar method. (B) Measurement of Phage titer (Log10 PFU/ml) at different time points and MOI of 0.001 to develop the one-step growth curve for the phage RG1, which indicates the latent period and burst size of this bacteriophage with the host E. faecium ATCC 35667. The experiments were performed in triplicate to calculate the Mean ± SD, and plotted.
The life cycle of RG1 phage on the host E. faecium was investigated by a one-step growth curve test at a multiplicity of infection of 0.001 for 120 min, which revealed several molecular events that transpired during viral replication. The identified one-step growth curve comprises three unique phases: the latent period, the burst or rise period, and the plateau period27. The latent period for RG1 was approximated to be ~ 10 min, during which the phage titer remained nearly constant. The phage titer rapidly escalated from 10 to 90 min, indicating a duration of increase of 80 min. The burst size indicates the number of phage particles generated by the infection of a single cell, predicted to be 61 PFU of RG1 phage per infected E. faecium cell. After 90 min, the growth curve of RG1 reached the plateau phase, as the phage titer remained constant due to the complete lysis of the host cells by the bacteriophage (Fig. 2B).
Genomic features of the phage RG1
The genome sequencing data revealed that the genome of phage RG1 is a linear dsDNA molecule of 41,364 base pairs with a GC content of 36%. It harbours 65 putative open reading frames (ORFs) without any tRNA and antibiotic resistance genes. We did not report any temperate phage markers such as recombinases, integrases, excisionases and transposases in the genome of RG1, which indicates its potential for phage therapy. The majority of ORFs in phage RG1 genome are in the forward strand (+), while 27 genes are present in the reverse strand (-) (Fig. 3). Out of 65 putative ORFs, 38 ORFs were functionally annotated based on protein homology using BLASTP, phageDB database, NCBI, Uniprot and HHpred site while the remaining were classified as hypothetical proteins (Table S3). The whole genome sequence of phage RG1 can be accessed from the NCBI GenBank (Accession Number PQ586903). Based on functional analysis of annotated ORFs, the proteins encoded from the genome of phage RG1 can be categorized into the following groups as detailed below.
Fig. 3.
Mapping of the phage RG1 genomic DNA. The circular whole genome map of the phage RG1 comprises 41,364 base pairs of linear dsDNA visualized with the Proksee tool (http://stothard.afns.ualberta.ca/cgview_server/). Different Open reading frames (ORFs) were categorized into replication and DNA metabolism, Cell lysis, Structural proteins, Assembly proteins and Hypothetical proteins, are illustrated with different colors in the genome map.
The replication and DNA metabolism associated genes include DNA primase (CDS_0005), DNA helicase (CDS_0017), DNA polymerase (CDS_0034), endonuclease (CDS_0013), DNA methyltransferase (CDS_0035), and thymidylate kinase (CDS_0037). They are located in the forward strand (+) of the linear genome.
Structural genes of phage RG1 comprises of virion structural proteins (CDC_041), minor tail protein (CDC_042), distal tail protein Dit (CDC_043), tail length tape measure protein (CDC_044), tail tape measure chaperone (CDC_045), head-tail adaptor (CDS_0046), major tail protein (CDC_047), Type I neck protein head-tail adaptors (CDC_049), head closure Hc1 (CDC_050) head-tail adaptor Ad1 (CDC_051) and major head proteins (CDC_052).
Viral assembly and DNA packaging genes include tail terminator (CDS_0048), head maturation protease (CDS_0053), portal protein (CDS_0054), Terminase Large subunit (CDS_0056), Terminase small subunit (CDS_0057), HNH endonuclease (CDS_0023, CDS_0059, CDS_0060).
For cell lysis, the phage RG1 genome encodes a two-component lysis system made of a holin-endolysin system similar to the majority of Enterococcus bacteriophages. The phage RG1 expresses two distinct holin proteins (CDS_0039 as class II and CDS_0040 as class III) like bacteriophage (PBSX and SPP1) of Bacillus subtilis46,47, which can potentially work together with a single endolysin (CDS_0038) to lyse the bacterial cells during viral replication. The genes for these proteins are clustered together in the RG1 genome.
Additional function genes in the RG1 genome are transcriptional regulators (CDS_0002, CDS_0006), metal-dependent hydrolases (CDS_0024), ABC transporter substrate-binding protein (CDC_0012), Trichome birefringence-like N-terminal domain-containing protein (CDC_0019), Polyketone cyclase (CDC_0021), Thioredoxin domain protein (CDC_0036) and Sensor histidine kinase (CDC_0055).
Comparative genomics
The Adjusted Percentage of Nucleotide Identity (APNI) heat map obtained from VIRIDIC analysis with high similarity phages showed the highest intergenomic similarity of the phage RG1 with Enterococcus phage BUCT630 (accession PP434460.1) at 78.5% and Enterococcus phage IME-EFm5 (accession NC_028826.1) at 74% (Fig. 4A). Synteny analysis was performed using the Easyfig tool to compare gene arrangements between the bacteriophage genomes of RG1 and fifteen other similar phages. Visual alignment showed conserved gene clusters across the genomes of selected phages including RG1 (Fig. 4B). The phylogenetic analysis revealed a shared evolutionary lineage with Streptococcus and Listeria phage proteins by forming a distinct clad. The amino acid sequences of the terminase small subunit, holin protein, major tail protein and DNA polymerase exhibited distant relationships within the Enterococcus phages (Supplementary Fig. S3).
Fig. 4.

Comparative genomic analysis of the phage RG1 with other Enterococcus phages. (A) Heat map obtained from the VIRIDIC tool depicted the average nucleotide identity (ANI) percentage between RG1 and the 15 most humongous bacteriophages. The ANI values were computed based on a matrix of Hadamard values reflecting pairwise alignment coverage and percentage identity, with RG1 highlighted in red. (B) The intergenomic comparison through synteny between the phage RG1 and 15 other Enterococcus phages was conducted by using the EasyFig tool. The ORFs for Host cell lysis, DNA replication and metabolism, structural proteins, assembly proteins, additional functions and hypothetical proteins were depicted in red, green, yellow, orange, pink and grey colours, respectively. Genetic similarity profiles between the phage RG1 and other phages are depicted in greyscale, indicating percent homology.
Bacteriolytic and antibiofilm activity by the phage RG1 against E. faecium ATCC 35667
The bacterial growth inhibition kinetics of E. faecium ATCC 35667 was investigated in the presence of phage RG1 at different MOIs (0.01, 0.1, 1, and 10) by measuring the absorbance at 600 nm at different time intervals in the microtiter plate (Fig. 5A, B). We observed significant growth retardation at MOI 0.01, which further reduced consistently with similar rate at higher MOIs (0.1, 1 and 10) in comparison to untreated control (Fig. 5A). Likewise, estimation of growth rate from growth curve (Fig. 5A) exhibited a significant reduction in growth rate (% per hour) from 29.7 ± 3.2 (untreated control) to 11.2 ± 1.8 at MOI of 0.01. Moreover, the growth rate (% per hour) at higher MOIs decreased to -31.5 ± 1.82, -35.2 ± 3.21 and − 38.3 ± 3.48 at MOIs of 0.1, 1 and 10, respectively (Fig. 5B). These observations suggested that the phage RG1 suppressed the growth of E. faecium by its bacteriolytic activity.
Fig. 5.
Antibacterial and antibiofilm activity of the phage RG1 against E. faecium ATCC 35667. (A) Antibacterial activity of the phage RG1 was monitored by studying growth kinetics of E. faecium without and with bacteriophage at different MOIs (0.01, 0.1, 1, and 10). The optical density (600 nm) was measured at every 20 min up to 4 h in a sterile microtiter plate at 37 ℃. Three technical replicates were used to calculate Mean ± SD, and plotted. (B) Growth rate (% per hour) at each MOI was calculated from the data of Fig. 7A using formula (Nt = N0 * (1 + r)t) where Nt is absorbance at time t, N0 is absorbance at start of the growth, r is growth rate, and t is time passed. (C) Bacteriophage was co-incubated (CI) for 24 h with host bacterium as well as post-infected (PI) for 2 h and 4 h on pre-existing 24 h old biofilm at MOIs of 0.1 and 1. Antibiofilm activity of the phage RG1 against E. faecium was investigated using the crystal violet assay as described in the method. Four technical replicates were taken to calculate Mean ± SD, and analysed by t-test using GraphPad Prism (version 5.01). The p values less than 0.05, 0.01 and 0.001 were indicated as (*), (**) and (***), respectively.
The biofilm inhibition and disruption activity of the phage RG1 against E. faecium ATCC 35667 was monitored by using the crystal violet assay in a microtiter plate at different MOIs of bacteriophage as described in methodology. The co-infection of phage with E. faecium for 24 h at both MOIs (0.1 and 1) has significantly (***, p < 0.001) inhibited the production of biofilm. This could have been achieved due to the lysis of bacterial cells during co-incubation with the phage RG1 (Fig. 5C). Additionally, the post-infection of viral particles at MOI of 0.1 on 24 h old bacterial biofilm for 2 h and 4 h has also significantly (*, p < 0.05) eradicated the bacterial biomass. Increase in viral load i.e., MOI of 1, has further disrupted the biofilm with more efficiency (***, p < 0.001) as time progressed post-infection (Fig. 5C). These observations demonstrated the antibiofilm potential of the phage RG1 against its host bacterium.
Antibacterial and antibiofilm potential of the phage RG1 against the clinical isolates of E. faecium
We did the isolation of 59 clinical strains of E. faecium from the urine samples of UTI patients at Sir Sunderlal Hospital, BHU, Varanasi, and estimated their biofilm formation capability as described in40. We observed that 19 out of 59 clinical isolates were strong biofilm formers (Table S1), and many of them exhibited resistance against different antibiotics (Table S2). We evaluated the effect of the phage RG1 on the growth kinetics and biofilm of these clinical isolates as described in the method. The co-incubation of the phage RG1 at MOI of 0.1 with these bacterial isolates under orbital shaking conditions resulted in a significant reduction in growth rate of the majority of isolates except a few (15768 and 19185) in comparison to untreated control (Fig. 6A; Fig S2). The negative growth rate in presence of RG1 suggested that this bacteriophage effectively killed the majority of tested multidrug-resistant clinical isolates. The antibiofilm assay was conducted with 24 h old biofilm of 19 different clinical isolates by using 4 h treatment of phage RG1 (107 PFU/ml). We reported a significant decrease in the biomass of the majority of bacterial biofilm except for a few clinical isolates (15576, 15768 and 19185) (Fig. 6B). Such disruption of biofilm by the phage RG1 could be due to the bacteriolytic activity of this bacteriophage. The antibacterial and antibiofilm properties of the phage RG1 proposed the therapeutic potential of this bacteriophage against multidrug-resistant E. faecium isolates under the clinical setup.
Fig. 6.
Antibacterial and antibiofilm activity of the phage RG1 towards the clinical isolates of E. faecium. (A) The growth kinetics of 19 clinical and one ATCC 35667 strain of E. faecium was performed in the absence and presence of the phage RG1 at an MOI of 0.1 in triplicate using 96-well microtiter plate for 280 min at 37 ℃ (Fig. S2). The growth rate (% per hour) was estimated from data of the growth curve as described in the methodology, and plotted for different clinical isolates of E. faecium. (B) Biofilm disruption activity of the phage RG1 against ATCC 35667 and 19 clinical isolates of E. faecium was measured using the crystal violet assay by 4 h incubation of bacteriophage (107 PFU/ml) on the 24 h old biofilm. Four technical replicates were used for this experiment to calculate Mean ± SD, and plotted. Statistical significance was estimated either by one-way ANOVA or t-test using GraphPad Prism (version 5.01). The p values less than 0.05, 0.01 and 0.001 were indicated as (*), (**) and (***), respectively.
Impact of various sugar molecules on the stability of E. faecium
Sugars are the major source of energy required for bacterial growth and metabolism. High levels of sugars, particularly in urine, provide a supportive environment for bacterial infection and impair the body’s defence system, thus contributing to the pathogenesis of UTI [22, 23, 48–50]. Intriguingly for the first time, we investigated the impacts of different monosaccharides (ribose, glucose, fructose, sorbitol and mannitol) and disaccharides (maltose, sucrose, lactose, trehalose) on the growth rate of pathogenic, multidrug resistant, UTI′s clinical isolate of E. faecium as well as on the lytic efficiency of the novel bacteriophage RG1 against the same bacterial isolates at an optimal MOI of 0.1 (Fig. 7). The presence of glucose, fructose, sucrose at both concentrations (0.5% and 1.0%), and ribose, maltose, & lactose at a concentration of 1.0% only had significantly promoted the growth rate of E. faecium 15166. Sugar alcohols viz. sorbitol and mannitol suppressed the bacterial growth at all concentrations (Fig. 7H, I), while the presence of trehalose had no significant effect on the bacterial growth rate in comparison to the control (Fig. 7G). Interestingly, we found that higher concentrations (0.5 to 1.0%) of ribose, maltose and trehalose sugars had significantly reduced the lytic efficiency of the phage RG1 by increasing the growth rate (Fig. 7A, D,G). We reported no significant difference in lytic efficiency of the phage RG1 in the presence of glucose, fructose, sucrose and lactose due to a similar pattern of host growth rate inhibition across different sugar concentrations like control (Fig. 7B, C,E, F). However, sorbitol and mannitol inhibited bacterial growth, their effect on host-phage interactions significantly enhanced the bacterial killing. This suggested a synergistic bactericidal effect of these sugar alcohols along with the phage RG1 (Fig. 7H, I).
Fig. 7.
Impact of different sugars on the stability of E. faecium and host-phage interaction. Effect of various concentrations (0.0%, 0.1%, 0.2%, 0.5%, and 1.0%) of different monosaccharide such as Ribose (A), Glucose (B), Fructose (C); disaccharides like Maltose (D), Sucrose (E), Lactose (F), Trehalose (G); and sugar alcohols such as Sorbitol (H) & Mannitol (I) on growth rate (% per hour) of E. faecium clinical strain 15667 was measured in the absence and presence of the phage RG1 at an MOI of 0.1. The growth kinetics was performed in triplicate for 4 h to generate the data for growth rate calculation, and represented as Mean ± SD. Statistical significance was estimated either by one-way ANOVA or t-test using GraphPad Prism (version 5.01). The p values less than 0.05, 0.01 and 0.001 were indicated as (*), (**) and (***), respectively.
Biocontrol of the clinical isolate E. faecium 15166 by the phage RG1
The potential of the phage RG1 as a biocontrol tool against the E. faecium 15166 (a multidrug-resistant clinical isolate obtained from a urinary tract infection patient) was tested by estimating the viability of the target bacterium as a function of CFU counts/ml at different MOIs. We observed a significant reduction in the viable cell counts after 4 h and 8 h in comparison to the control (0 h) at all the tested MOIs (Fig. 8). Up to 8 h post-infection, host CFU counts were reduced by 1 log (CFU/ml) at MOI of 0.1, ~ 2 logs at MOI of 1, and ~ 3 logs at MOI of 10. However, after 24 h, E. faecium 15166 was able to proliferate similar to that of the control (untreated) at MOI of 0.1 but displayed a decrease in viable cell counts by ~ 3 log (CFU/mL) at MOI of 1 and 10. This demonstrates the biocontrol capacity of phage RG1 for at least 8 h post-infection at MOI 0.1. We reported greater reductions in the viable bacterial cell counts at higher MOIs in the biocontrol assay (Fig. 8).
Fig. 8.

Biocontrol assay using different MOIs of the phage RG1. Approximately 1 × 104 CFU/ml culture of E. faecium clinical strain 15166 was infected with phage RG1 at varying MOIs viz. 0.1, 1 and 10, and grown for 0, 4, 8 and 24 h. Viable cells (CFU/ml) were counted at each time point after spread plating and overnight incubation at 37 ℃. Experiment was carried out in triplicate to calculate Mean ± SD, and analysed for statistical significance by t-test using GraphPad Prism (version 5.01). The p values less than 0.05, 0.01 and 0.001 were represented as (*), (**) and (***), respectively.
Discussion
Enterococci represent the second most prevalent cause of healthcare-associated infections and bacteremia, constituting approximately 10% of all bacteremias. E. faecium is responsible for 30 to 80% of enterococcal infections, which imposes a huge load of morbidity and mortality, especially among immunocompromised patients because of MDR enterococci51–53. They exhibit resistance to several first-line antibiotics and are often linked to chronic and recurrent infections54. Phage therapy has regained its recognition as a potential therapeutic alternative to the increasing incidences of antibiotic resistance. In comparison to antibiotics, phages co-evolve with their bacterial hosts, which reduce the possibility of having host resistance dissimilar to antibiotics. In addition, antibiotics used to have a broad host range unlike bacteriophages, which can jeopardize beneficial bacteria within the human body55. Further, bacteriophages exhibit specificity and bacteriolytic action against antibiotic-resistant bacteria and their biofilms. Numerous studies have demonstrated that both naturally occurring and genetically engineered phages can effectively target Enterococcus biofilms21,56–58.
In this research work, we isolated a lytic and dsDNA bacteriophage RG1 (GenBank accession number PQ586903) from sewage water near the ‘Ravidas Ghat’ of the ancient city Varanasi, and performed the genetic and biological characterisation. Although enterococcal phages are usually very specific to their host and exhibit a narrow host range, however, Enterococcus phage IME-EF1 was capable of infecting both E. faecium and E. faecalis strains59. The phage RG1 specifically infect the E. faecium strains including clinical isolates (18 out of 20 strains) with a comparatively wide host range, but failed to infect other bacterial species (Fig. 1B; Table 1). Morphological studies using TEM revealed that the phage RG1 possesses a regular icosahedral head and a long, non-contractile tail, which is similar to siphovirus-like phages60. The genome sequence of the phage RG1 showed similarity to other E. faecium bacteriophages including SSBHU, IME-EFm561 and BUCT63062 of the genus Efemquintavirus. Majority of the bacteriophages infecting E. faecium are siphovirus-like phages, and they usually have broad host range, which increases their applicability against MDR clinical strains21.
The assessment of phage stability under different environmental conditions, and determination of optimum MOI, latency period and burst size are crucial steps for producing phage agents with high therapeutic potential and long-term storage63,64. Notably, the phage RG1 was found resistant to varying temperature, pH, and chloroform concentrations (Fig. 1D, E,F, respectively), which featured its potential for phage therapy. The phage RG1 showed enhanced thermal stability compared to previously reported Enterococcus phages21. The high stability of phage RG1 toward wide range of pH (Fig. 1E) was comparable to that described in earlier studies45,65,66. This allows it to be taken orally without compromising its capacity to survive in the digestive system67. The infectivity of the phage RG1 at wide concentrations of chloroform (up to 90%) suggested its high chemical resistance, which was consistent with previous findings68,69. Further, we reported the highest phage titer at MOI of 0.1 for the phage RG1 (Fig. 2A), which is relatively lower than few enterococcal phages reported earlier21. One step growth curve analysis revealed that the phage RG1 has a latent period of 10 min, and the average burst size is 61 PFU/ml at an MOI of 0.001 (Fig. 2B). The latent period of the phage RG1 is similar to E. faecium Max phage but shorter than many Enterococcus phages while the average burst size is in range of previously reported typical burst size of 36–155 PFU/ml for several Enterococcus phages with few exceptions including Phage vB_GEC_EfS_9 (222 pfu/ml)22,66,70–73. A bacteriophage with higher burst size with a short latency period can produce a huge number of viral particles that can infect large numbers of bacterial cells during the initial phase of infection within a short time span. This is one of the major properties of lytic phages used for therapeutic purposes but can’t be predicted for therapeutic success74.
The genome of the phage RG1 is 41,364 bp dsDNA with a GC content of 36%, which is in the range of genome size of other E. faecium-infecting phages associated with the genus Efemquintavirus including SSBHU (43,953 bps), IME-EFm5 (42,265 bps) and BUCT630 (41,942 bps)61,62. A significant number of the encoded proteins in the RG1 genome were annotated as hypothetical viz. 27 out of 65, which suggests that only a minor proportion of viral products demonstrate similarity to proteins in databases due to the extensive diversity of viruses and the limited number of described proteins76. These functionally annotated proteins from the genome of phage RG1 were categorized into the replication & DNA metabolism, structural proteins, viral assembly and DNA packaging, cell lysis, and additional functions. Absence of genes for integrase, excisionase, recombinase or repressors, and presence of endolysin and two holins encoding genes in the phage RG1 genome reduces the possibilities of lysogenic transformation, and suggests that the phage RG1 primarily undergoes the lytic cycle, which is important in phage therapy for rapid removal of host bacteria, and useful as antimicrobial enzybiotics against MDR E. faecium (Table S3, Fig. 3)76. Like RG1, genome of PBSX and SPP1 phages of B. subtilis encodes two holin proteins, which work in a sequential manner and their co-production is required for bacterial cell death46,47. Like other lytic phages of E. faecium, we did not report any gene for antibiotic resistance or virulence factor in the RG1 genome that eliminates the possibilities of horizontal gene transfer of antibiotic resistance or virulence factors by this bacteriophage, and ensures its safety21,77,78. The nucleotide BLAST based analysis of the phage RG1 genome has positioned it within a scattered cluster of E. faecium bacteriophage population. Comparative genomics of the phage RG1 through VIRIDIC and synteny analysis showed limited intergenomic similarity with other E. faecium phages, which suggest the novelty of this bacteriophage (Fig. 4). However, it exhibited highest query coverage of 91% with Enterococcus phage SSBHU and an ANI of 83.6%, query coverage of 84% with Enterococcus phage BUCT630 and an ANI of 78.5% followed by query coverage of 81% with Enterococcus phage IME-EFm5 and an ANI of 74% (Fig. 4A). Further, phylogenetic analysis of major tail protein, Terminase small subunit protein, holin and DNA polymerase of the RG1 demonstrated distinct evolutionary relationships among Enterococcus phages (Fig. S3)65. The phage RG1 lysis kinetics against E. faecium ATCC 35667 at different MOIs suggested that a phage titer lower than optimal MOI is sufficient to inhibit the bacterial growth in liquid broth. Furthermore, phage concentration equal to or higher than optimal MOI resulted in negative growth rate of E. faecium because of bacterial lysis (Fig. 5A, B). We also reported significant growth inhibition of 17 out of 19 clinical isolates by the phage RG1 at an MOI of 0.1 (Fig. 6A), which demonstrates the therapeutic potential of this bacteriophage in a short time duration like other phages including iF6 and vB_EfaH_16321,45. Biofilm formation imposes serious problems in the treatment of bacterial infection by producing a protective shield against different antimicrobial agents and thus contributes to antibiotic resistance56. Bacteriophages can penetrate the biofilm and lyse the bacterial cells to release phage-encoded lyases or host/phage-origin depolymerases, which degrade the extracellular polysaccharide and further destroy the biofilm79. In this study, we demonstrated that the phage RG1 can inhibit the biofilm formation as well as disrupt the pre-existing biofilm of E. faecium ATCC 35667 albeit at different rates for different MOIs (Fig. 5C). The co-incubation of the phage with the host caused the bacterial lysis and prevented the biofilm formation by E. faecium irrespective of the phage titer (Fig. 5C). Further, time-dependent application of the RG1 over a 24 h old biofilm of E. faecium has efficiently destroyed the bacterial biofilm. Treatment with higher phage titer for longer duration showed better biofilm disruption activity. The phage RG1 showed better biofilm inhibition and disruption potential than other E. faecium phages including vB-EfmS-S2, LG62, etc21,80,81. In addition, the phage RG1 (107 PFU/ml) also demonstrated the antibiofilm activity against the 24 h old biofilm of different MDR clinical isolates (16 out of 19) of E. faecium (Fig. 6B). The potential of the bacteriophage RG1 to penetrate and eradicate the pre-existing biofilm of MDR pathogens is essential for treating persistent infections. The phage RG1 failed to disrupt the biofilm of three isolates (15576, 15768, and 19185), which could be due to phage resistance, quorum sensing mediated inhibition of phage infection, and high density of biofilm82.
In this study, we also demonstrated the impact of different sugar molecules on the growth kinetics of E. faecium 15166 as well as lytic efficiency of the phage RG1. The concentration of ≥ 0.5% of glucose, fructose, sucrose, ribose, maltose and lactose enhanced the bacterial growth (Fig. 7A-F). Previously, it was found that lactose encourages Enterococcus growth, and contributes to graft-versus-host disease (GVHD) in a mouse model83. Enterococcus spp. utilises fructose as an energy source84,85, but fructose reduction by commensal bacteria diminishes Vancomycin-Resistant Enterococci (VRE) growth in the murine gut85. Alternatively, sugar alcohols such as sorbitol and mannitol (Fig. 7H, I) suppressed the growth of E. faecium in a concentration-dependent manner which corroborate the earlier reports86,87. Intriguingly, presence of ribose, trehalose and maltose suppressed the phage RG1 mediated bacterial lysis, and supported cell proliferation while presence of glucose, fructose, lactose and sucrose had no effect on bacteriolytic activity of this phage (Fig. 7). This probably might be due to the interference of these sugars on the adsorption of bacteriophages over the host surface or decreased availability of functional viral particles because of sugar-induced phage aggregation or altered bacterial metabolism, which is less favourable for phage multiplication51. Furthermore, sugar alcohols exhibited combined lytic effect with the phage RG1 against MDR E. faecium isolate (Fig. 7H, I). For the first time, we reported the effect of these sugar molecules on the host-bacteriophage interaction and bacteriolytic activity of a phage. Biocontrol assays demonstrated the efficacy of phage RG1 against an MDR clinical isolate E. faecium 15166 in the broth medium. Viable CFUs on solid agar plates revealed that RG1 inhibited bacterial growth in a concentration-dependent manner (Fig. 8). At MOI of 0.1, significant reduction in bacterial growth was reported after 4–8 h infection of RG1, but E. faecium regrown at 24 h similar to the phage vB_EfaH_163, phage Max and Phage Zip [75, 48]. This might be viewed as a limitation for phage therapy (Fig. 8). However, we observed a significant decrease in CFU counts of E. faecium at higher phage titer (MOIs of 1 & 10) after 24 h (Fig. 8). Further, the efficacy of phage therapy can be improved by extending the treatment durations, application of higher phage titer, use of phage cocktails, or synergism using antibiotics88.
Conclusion
In the current study, we isolated a novel lytic bacteriophage, the RG1, against opportunistic human pathogen E. faecium, and investigated its genome, structure and biological functions under various environmental conditions. Linear, AT rich, dsDNA genome of the phage RG1 showed limited intergenomic similarity among E. faecium phages. This phage exhibited a short latency period of 10 min with an average burst size of 61 PFU/cell at MOI lower than optimal, and was able to infect E. faecium cells at a wide range of pH, temperatures and chloroform concentrations. The growth kinetics analysis revealed the bacteriolytic property of phage RG1 against E. faecium and its MDR clinical isolates at an optimal MOI of 0.1. In addition, phage RG1 demonstrated antibiofilm activity against ATCC 35667 and antibiotic-resistant clinical isolates of E. faecium. Further, presence of ribose, maltose and trehalose inhibited the lytic activity of the phage RG1 by supporting the growth of host cells, while the presence of glucose, fructose, sucrose and lactose enhanced the bacterial growth without affecting lytic efficiency of phage. However, sorbitol and mannitol showed a combined bactericidal effect on E. faecium with the phage RG1. These findings led us to conclude that the phage RG1 can be employed as a therapeutic agent against MDR E. faecium infections under the clinical exercises.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
RKS acknowledges the Institution of Eminence, Banaras Hindu University for offering an RJP Postdoctoral Fellow position. RA thanks UGC, India for a Junior Research Fellowship. We would like to thank Dr. Pradyot Prakash, Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi for providing the E. faecium clinical isolates for the study of the RG1 phage. GKM is thankful to the Institution of Eminence, BHU for providing seed grant support, and SATHI, CDC-BHU for instrumentation facility. GKM acknowledged SERB-DST for SRG grant (SRG/2021/000900), and University Grant Commission for UGC-BSR Research Start up Grant.
Author contributions
Rakesh Kumar Singh: Conceptualization; Data curation; Formal analysis; Investigation; Methodology; Writing – original draft. Riya Anand: Conceptualization; Data curation; Formal analysis; Investigation; Writing. Ajeet Singh: Data curation; Formal analysis; Investigation; Zinnu Rain: Formal analysis; Investigation. Pradyot Prakash: Methodology, Resources. Ganesh Kumar Maurya: Conceptualization; Funding acquisition; Methodology; Project administration; Resources, Supervision; Writing – review and editing.
Data availability
Whole genome sequence of phage RG1 is deposited in the NCBI genome with accession number PQ586903 (https://www.ncbi.nlm.nih.gov/nuccore/PQ586903). Further, data of manuscript and supplementary information is provided.
Declarations
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Rakesh Kumar Singh and Riya Anand.
References
- 1.WHO, Prioritization of pathogens to guide discovery, research and development of new antibiotics for drug resistant bacterial infections, including tuberculosis. World Health Organization No. WHO/EMP/IAU/2017.12 (2017) 14–88.
- 2.Mogasale, V.V., Saldanha, P., Pai, V., Rekha, P.D. & Mogasale, V. A descriptive analysis of antimicrobial resistance patterns of WHO priority pathogens isolated in children from a tertiary care hospital in India. Sci Rep.11.1, 5116. 10.1038/s41598-021-84293-8 (2021). [DOI] [PMC free article] [PubMed]
- 3.McLellan, L. K. & Hunstad, D. A. Urinary tract infection: pathogenesis and outlook. Trends Mol. Med.22, 946–957. 10.1016/j.molmed.2016.09.003 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Huang, L., Huang, C., Yan, Y., Sun, L. & Li, H. Urinary tract infection etiological profiles and antibiotic resistance patterns varied among different age categories: a retrospective study from a tertiary general hospital during a 12-year period. Front. Microbiol.12, 813145. 10.3389/fmicb.2021.813145 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Parte, A. C., Sardà Carbasse, J., Meier-Kolthoff, J. P., Reimer, L. C. & Göker, M. List of Prokaryotic names with Standing in Nomenclature (LPSN) moves to the DSMZ. Int. J. Syst. Evol. Microbiol.70(11), 5607–5612. 10.1099/ijsem.0.004332 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kristich, C. J., Rice, L. B., & Arias, C. A. Enterococcal infection—treatment and antibiotic resistance. 1–62 (2014).
- 7.Khan, A. et al. Antimicrobial sensing coupled with cell membrane remodeling mediates antibiotic resistance and virulence in Enterococcus faecalis. Proc Natl Acad Sci.116(52), 26925–26932. 10.1073/pnas.1916037116 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.van Harten, R. M., Willems, R. J. L., Martin, N. I. & Hendrickx, A. P. A. Multidrug-Resistant Enterococcal Infections: New Compounds, Novel Antimicrobial Therapies?. Trends Microbiol.25(6), 467–479. 10.1016/j.tim.2017.01.004 (2017). [DOI] [PubMed] [Google Scholar]
- 9.Prestinaci, F., Pezzotti, P. & Pantosti, A. Antimicrobial resistance: a global multifaceted phenomenon. Pathog Glob Health.109(7), 309–318. 10.1179/2047773215Y.0000000030 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Beganovic, M. et al. A review of combination antimicrobial therapy for Enterococcus faecalis bloodstream infections and infective endocarditis. Clin. Infect Dis.67(2), 303–309. 10.1093/cid/ciy064 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Canfield, G. S. et al. Lytic bacteriophages facilitate antibiotic sensitization of Enterococcus faecium. Antimicrob. Agents Chemother65(5), 10–1128. 10.1128/aac.00143-21 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Allen, H. K., Trachsel, J., Looft, T. & Casey, T. A. Finding alternatives to antibiotics. Ann. N. Y. Acad. Sci.1323(1), 91–100. 10.1111/nyas.12468 (2014). [DOI] [PubMed] [Google Scholar]
- 13.Hendrix, R. W., Smith, M. C., Burns, R. N., Ford, M. E. & Hatfull, G. F. Hatfull, Evolutionary relationships among diverse bacteriophages and prophages: All the world’s a phage. Proc. Natl. Acad. Sci. USA96, 2192–2197 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Luong, T., Salabarria, A. C., Edwards, R. A. & Roach, D. R. Standardized bacteriophage purification for personalized phage therapy. Nat. Protoc.15, 2867–2890. 10.1038/s41596-020-0346-0 (2020). [DOI] [PubMed] [Google Scholar]
- 15.Pires, D. P., Vilas Boas, D., Sillankorva, S. & Azeredo, J. Phage therapy: a step forward in the treatment of Pseudomonas aeruginosa infections. J. Virol.89, 7449–7456. 10.1128/JVI.00385-15 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Jault, P. et al. Efficacy and tolerability of a cocktail of bacteriophages to treat burn wounds infected by Pseudomonas aeruginosa (PhagoBurn): a randomised, controlled, double-blind phase, 1/2 trial. Lancet Infect. Dis.19, 35–45. 10.1016/S1473-3099(18) (2018). [DOI] [PubMed] [Google Scholar]
- 17.Principi, N., Silvestri, E. & Esposito, S. Advantages and Limitations of Bacteriophages for the Treatment of Bacterial Infections. Front. Pharmaco10, 513 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hyman, P. Phages for Phage Therapy: Isolation, Characterization, and Host Range Breadth. Pharmaceuticals.12, 35 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Prestinaci, F., Pezzotti, P. & Pantosti, A. Antimicrobial resistance: a global multifaceted phenomenon. Pathog Glob Health.109(7), 309–318. 10.1179/2047773215Y.0000000030 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Koskella, B. & Meaden, S. Understanding bacteriophage specificity in natural microbial communities. Viruses5(3), 806–823. 10.3390/v5030806 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ribes-Martínez, L. et al. Bacteriophage Therapy as a Promising Alternative for Antibiotic-Resistant Enterococcus faecium: Advances and Challenges. Antibiotics (Basel).13(12), 1120. 10.3390/antibiotics13121120 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Fünfstück, R. et al. Urinary tract infection in patients with diabetes mellitus. Clin. Nephrol.77(1), 40–48. 10.5414/cn107216 (2012). [DOI] [PubMed] [Google Scholar]
- 23.Wang, M.C. et al. Bacterial characteristics and glycemic control in diabetic patients with Escherichia coli urinary tract infection. J. Microbiol. Immunol. Infect. 46(1), 24–29. 10.1016/j.jmii.2011.12.024 (2013). [DOI] [PubMed]
- 24.Khazani Asforooshani, M. et al. A novel Enterococcus faecium phage EF-M80: unveiling the effects of hydrogel-encapsulated phage on wound infection healing. Front. Microbiol.15, 1416971. 10.3389/fmicb.2024.1416971 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Sarkis, G.J. & Hatfull, G.F. Mycobacteriophages, in Mycobacteria protocols (Humana Press), 145–173 (1998). 10.1385/0-89603-471-2:145.
- 26.Ackermann, H. W. Basic phage electron microscopy. Bacteriophages, Methods and protocols, Isolation, characterization, and interactions.1, 113–126. 10.1007/978-1-60327-164-6_12 (2009). [DOI] [PubMed] [Google Scholar]
- 27.Ellis, E. L. & Delbruck, M. The growth of bacteriophage. J. Gen. Physiol.22(3), 365–384. 10.1085/jgp.22.3.365 (1939). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Capra, M. L., Quiberoni, A. & Reinheimer, J. A. Thermal and chemical resistance of lactobacillus casei and lactobacillus paracasei bacteriophages. Lett. Appl. Microbiol.38(6), 499–504. 10.1111/j.1472-765X.2004.01525.x (2004). [DOI] [PubMed] [Google Scholar]
- 29.Capra, M. L., Quiberoni, A. & Reinheimer, J. Phages of lactobacillus casei/paracasei: response to environmental factors and interaction with collection and commercial strains. J. Appl. Microbiol100(2), 334–342. 10.1111/j.1365-2672.2005.02767.x (2006). [DOI] [PubMed] [Google Scholar]
- 30.Nishiguchi, M.K. et al. DNA isolation procedures. In Techniques in molecular systematics and evolution (Basel: Birkhäuser), 249–287 (2002). 10.1007/978-3-0348-8125-8_12.
- 31.Fleming, E.A. The Isolation and Characterization of Novel Mycobacteriophages, Chancellor’s Honors Program Projects, (2004). https://trace.tennessee.edu/utk_chanhonoproj/736.
- 32.Li., D. et al. MEGAHIT v1. 0: a fast and scalable metagenome assembler driven by advanced methodologies and community practices. Methods, 102, pp.3–11 (2016). [DOI] [PubMed]
- 33.Nayfach, S. et al. CheckV assesses the quality and completeness of metagenome-assembled viral genomes. Nat. Biotechnol.39(5), 578–585. 10.1038/s41587-020-00774-7 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Bouras, G. et al. Pharokka: a fast scalable bacteriophage annotation tool. Bioinformatics. 1;39, 776 (2023). 10.1093/bioinformatics/btac776. [DOI] [PMC free article] [PubMed]
- 35.Steinegger, M. & Söding, J. MMseqs2 enables sensitive protein sequence searching for the analysis of massive data sets. Nat Biotechnol.35(11), 1026–1028. 10.1038/nbt.3988 (2017) (Epub 2017 Oct 16). [DOI] [PubMed] [Google Scholar]
- 36.Sullivan, M. J., Petty, N. K. & Beatson, S. A. Easyfig: a genome comparison visualize. Bioinformatics27(7), 1009–1010. 10.1093/bioinformatics/btr039 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Moraru, C., Varsani, A. & Kropinski, A.M. VIRIDIC—A Novel Tool to Calculate the Intergenomic Similarities of Prokaryote-Infecting Viruses. Viruses 12(11), 1268. 10.3390/v12111268 (2020). [DOI] [PMC free article] [PubMed]
- 38.Tamura, K., Stecher, G. & Kumar, S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol. Evol.38(7), 3022–3027 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Harwood, V. J. et al. Molecular confirmation of Enterococcus faecalis and E. faecium from clinical, faecal and environmental sources. Lett. Appl. Microbiol.38(6), 476–482 (2004). [DOI] [PubMed]
- 40.Singh, A. K. et al. Standardization and Classification of In vitro Biofilm Formation by Clinical Isolates of Staphylococcus aureus. J Glob Infect Dis.9(3), 93–101. 10.4103/jgid.jgid_91_16 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lu, C. L. et al. Antimicrobial susceptibilities of commonly encountered bacterial isolates to fosfomycin determined by agar dilution and disk diffusion methods. Antimicrob Agents Chemother.55, 4295–4301 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Maurya, G.K., Kota, S. & Misra, H.S. Characterisation of ParB encoded on multipartite genome in Deinococcus radiodurans and their roles in radioresistance. Microbiol. Res. 223–225. 10.1016/j.micres.2019.03.005 (2019). [DOI] [PubMed]
- 43.Goodarzi, F. et al. Anti-biofilm Activity of a Lytic Phage Against Vancomycin-Resistant Enterococcus faecalis. Iran. J. Pathol.17.3, 285–293. 10.30699/IJP.2022.541855.2760 (2022). [DOI] [PMC free article] [PubMed]
- 44.Sharma, S. et al. Isolation and characterization of a lytic bacteriophage against Pseudomonas aeruginosa. Sci Rep.11, 19393. 10.1038/s41598-021-98457-z (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Pradal, I. et al. Enterococcus faecium Bacteriophage vB_efah_163, a new member of the Herelleviridae family, reduces the mortality associated with an E. faecium vanR clinical isolate in a Galleria mellonella animal model, Viruses, 15.1, 179. 10.3390/v15010179 (2023). [DOI] [PMC free article] [PubMed]
- 46.Krogh, S., Jørgensen, S. T. & Devine, K. M. Lysis genes of the Bacillus subtilis defective prophage PBSX. J. Bacteriol.180(8), 2110–2117. 10.1128/JB.180.8.2110-2117.1998 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Fernandes, S. & São-José, C. Probing the function of the two holin-like proteins of bacteriophage SPP1. Virology500, 184–189. 10.1016/j.virol.2016.10.030 (2017). [DOI] [PubMed] [Google Scholar]
- 48.Fünfstück, R. et al. Urinary tract infection in patients with diabetes mellitus. Clin. Nephrol.77, 40–48. 10.5414/cn107216 (2012). [DOI] [PubMed] [Google Scholar]
- 49.Wang, M. C. et al. Bacterial characteristics and glycemic control in diabetic patients with Escherichia coli urinary tract infection. J. Microbiol. Immunol. Infect.46, 24–29. 10.1016/j.jmii.2011.12.024 (2013). [DOI] [PubMed] [Google Scholar]
- 50.Manbua, N., Suteewong, T. & Sae-Ueng, U. Efficacy of sugar excipients on lyophilized C22 phage infectivity evaluated by atomic force microscopy. Biol. Control170, 104922 (2022). [Google Scholar]
- 51.Sievert, D. M. et al. Antimicrobial resistant pathogens associated with healthcare-associated infections: summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2009–2010. Infect Control Hosp. Epidemiol.34(1), 1–14. 10.1086/668770 (2013). [DOI] [PubMed] [Google Scholar]
- 52.Pinholt, M. et al. Incidence, clinical characteristics and 30-day mortality of enterococcal bacteraemia in Denmark 2006–2009: a population-based cohort study. Clin. Microbiol. Infect.20, 145–151. 10.1111/1469-0691.12236 (2014). [DOI] [PubMed] [Google Scholar]
- 53.Del Turco Rosselli, E. et al. How do I manage a patient with enterococcal bacteraemia?, Clin Microbiol Infect. 27,364–371 (2021). 10.1016/j.cmi.2020.10.029. [DOI] [PubMed]
- 54.Stellfox, M. E. et al. Bacteriophage and antibiotic combination therapy for recurrent Enterococcus faecium bacteremia. MBio15(3), e03396-e3423. 10.1128/mbio.03396-23 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Gondil, V. S. & Chhibber, S. Exploring potential of phage therapy for tuberculosis using model organisms. Biomed. Biomed. Biotechnol. Res. J.2(1), 9–15. 10.4103/bbrj.bbrj_93_17 (2018). [Google Scholar]
- 56.Pires, D. P. et al. Phage therapy as an alternative or complementary strategy to prevent and control biofilm-related infections. Curr. Opin. Microbiol.39, 48–56. 10.1016/j.mib.2017.09.004 (2017). [DOI] [PubMed] [Google Scholar]
- 57.Khalifa, L. et al. Targeting Enterococcus faecalis biofilms with phage therapy. Appl Environ Microbiol.81(8), 2696–2705. 10.1128/AEM.00096-15 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Tinoco, J.M. et a. Effect of a genetically engineered bacteriophage on Enterococcus faecalis biofilms. Arch. Oral Biol.. 71, 80–86. 10.1016/j.archoralbio.2016.07.001 (2016). [DOI] [PMC free article] [PubMed]
- 59.Zhang, W. et al. Characterization of Enterococcus faecalis phage IME-EF1 and its endolysin. PLoS One. 13;8, e80435 (2013). 10.1371/journal.pone.0080435. [DOI] [PMC free article] [PubMed]
- 60.Ackermann, H. W. 5500Phages examined in the electron microscope. Arch Virol.152(2), 227–243. 10.1007/s00705-006-0849-1 (2007). [DOI] [PubMed] [Google Scholar]
- 61.Gong, P. et al. Characterization of Enterococcus faecium bacteriophage IME-EFm5 and its endolysin LysEFm5. Virology492, 11–20. 10.1016/j.virol.2016.02.006 (2016). [DOI] [PubMed] [Google Scholar]
- 62.Soro, O. et al. Complete genome sequences of four lytic bacteriophages against multidrug-resistant Enterococcus faecium. Microbiol Resour Announc. 10 Oct e0068824 (2024). 10.1128/mra.00688-24. [DOI] [PMC free article] [PubMed]
- 63.Ly-Chatain, M. H. The factors affecting effectiveness of treatment in phagestherapy. Front Microbiol.18, 5–51. 10.3389/fmicb.2014.00051 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Pires, D. P. et al. Current challenges and future opportunities of phage therapy. FEMS Microbiol Rev.24, 684–700. 10.1093/femsre/fuaa017 (2020). [DOI] [PubMed] [Google Scholar]
- 65.Soro, O. et al. Characterization and Anti-Biofilm Activity of Lytic Enterococcus Phage vB_Efs8_KEN04 against Clinical Isolates of Multidrug-Resistant Enterococcus faecalis in Kenya. Viruses16, 1275. 10.3390/v16081275 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Rigvava, S. et al. Novel lytic bacteriophage vB_GEC_EfS_9 against Enterococcus faecium. Virus Res.307, 198599. 10.1016/j.virusres.2021.198599 (2022). [DOI] [PubMed] [Google Scholar]
- 67.El-Atrees, D. M. et al. Characterization and anti-biofilm activity of bacteriophages against urinary tract Enterococcus faecalis isolates. Sci Rep.29, 13048. 10.1038/s41598-022-17275-z (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Song, F. et al. Characterization of an Enterococcus faecalis bacteriophage SFQ1 as a potential therapeutic agent. Front. Microbiol.14, 1210319. 10.3389/fmicb.2023.1210319 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Song, M. et al. Characterization of an Enterococcus faecalis Bacteriophage vB_EfaM_LG1 and Its Synergistic Effect With Antibiotic. Front Cell Infect Microbiol.1611, 698807. 10.3389/fcimb.2021.698807 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Chan, B. K., Abedon, S. T. & Loc-Carrillo, C. Phage cocktails and the future of phage therapy. Future Microbiol.8, 769–783. 10.2217/fmb.13.47 (2013). [DOI] [PubMed] [Google Scholar]
- 71.Wang, R. et al. Characterization and genome analysis of novel phage vB_EfaP_IME195 infecting Enterococcus faecalis. Virus Genes54, 804–881. 10.1007/s11262-018-1608-6 (2018). [DOI] [PubMed] [Google Scholar]
- 72.Melo, L. D. R. et al. Efficacy and safety assessment of two enterococci phages in an in vitro biofilm wound model. Sci. Rep.30, 6643. 10.1038/s41598-019-43115-8 (2019) (Erratum in: Sci Rep. 20, 11008 (2021). 10.1038/s41598-021-90464-4). [DOI] [PMC free article] [PubMed]
- 73.Abed, S. et al. Insights into the novel Enterococcus faecalis phage: A comprehensive genome analysis. PLoS ONE14, e0301292. 10.1371/journal.pone.0301292 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Casey, E., van Sinderen, D. & Mahony, J. In Vitro Characteristics of Phages to Guide “Real Life” Phage Therapy Suitability. Viruses30, 163. 10.3390/v10040163 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Yin, Y. & Fischer, D. Identification and investigation of ORFans in the viral world. BMC Genom.9, 1–10. 10.1186/1471-2164-9-24 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Rodríguez-Rubio, L. et al. Phage lytic proteins: biotechnological applications beyond clinical antimicrobials. Crit Rev Biotechnol.36, 542–552. 10.3109/07388551.2014.993587 (2016). [DOI] [PubMed] [Google Scholar]
- 77.Wójcicki, M. et al. Characterization and Genome Study of Novel Lytic Bacteriophages against Prevailing Saprophytic Bacterial Microflora of Minimally Processed Plant-Based Food Products. Int J Mol Sci.18, 12460. 10.3390/ijms222212460 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Lee, D. et al. The novel Enterococcus phage vB_EfaS_HEf13 has broad lytic activity against clinical isolates of Enterococcus faecalis. Frontiers in Microbiol10, 2877 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Ferriol-Gonzalez, C. & Domingo-Calap, P. Phages for Biofilm Removal. Antibiotics.9, 268. 10.3390/antibiotics9050268 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Goodarzi, F. et al. Biological characteristics and anti-biofilm activity of a lytic phage against vancomycin-resistant Enterococcus faecium. Iran J. Microbiol.13, 691–702. 10.18502/ijm.v13i5.7436 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Qu, Q. et al. Isolation and characterization of a novel lytic bacteriophage vB_Efm_LG62 infecting Enterococcus faecium. Virus Genes59, 763–774. 10.1007/s11262-023-02016-9 (2023). [DOI] [PubMed] [Google Scholar]
- 82.Chegini, Z. et al. A Shariati, Bacteriophage therapy against Pseudomonas aeruginosa biofilms: a review. Ann Clin Microbiol Antimicrob.30, 45. 10.1186/s12941-020-00389-5 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Stein-Thoeringer, C. K. Lactose drives Enterococcus expansion to promote graft-versus-host disease. Science366, 1143–1149. 10.1126/science.aax3760 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Rea, M. C. & Cogan, T. M. Catabolite repression in Enterococcus faecalis. Syst. Appl. Microbiol.26, 159–164. 10.1078/072320203322345985 (2003). [DOI] [PubMed] [Google Scholar]
- 85.Reissier, S. The Regulatory RNA ern0160 Confers a Potential Selective Advantage to Enterococcus faecium for Intestinal Colonization. Front. Microbiol.12, 1–9. 10.3389/fmicb.2021.757227 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Quiloan, M. L., Vu, J. & Carvalho, J. Enterococcus faecalis can be distinguished from Enterococcus faecium via differential susceptibility to antibiotics and growth and fermentation characteristics on mannitol salt agar. Front. Biol.7, 167–177. 10.1007/s11515-012-1183-5 (2012). [Google Scholar]
- 87.Deibel, R. H., Lake, D. E. & Niven, C. F. Jr. Physiology of the enterococci as related to their taxonomy. J. Bacteriol.86, 1275–1282 (1963). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Stuart, C. H., Schwartz, S. A., Beeson, T. J. & Owatz, C. B. Enterococcus faecalis: Its role in root canal treatment failure and current concepts in retreatment. J. Endod.32, 93–98. 10.1016/j.joen.2005.10.049 (2006). [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Whole genome sequence of phage RG1 is deposited in the NCBI genome with accession number PQ586903 (https://www.ncbi.nlm.nih.gov/nuccore/PQ586903). Further, data of manuscript and supplementary information is provided.




