Skip to main content
NCBI home page
Annals of Transplantation logoLink to Annals of Transplantation
. 2017 Feb 7;22:66–74. doi: 10.12659/AOT.901738

Protective Effects of Ischemic Preconditioning-Mediated Homing of Endothelial Progenitor Cells on Renal Acute Ischemia and Reperfusion Injury in Male Rats

Jianxin Xue 1,2,B,C,D,E,*, Zhiqiang Qin 2,B,C,D,E,*, Xiao Li 3,A,B,E,*, Pu Cao 1,2,C,D, Ruipeng Jia 4,A,F,G,✉
PMCID: PMC12577531  PMID: 28167815

Abstract

Background

The objective of this study was to determine whether homing of endothelial progenitor cells (EPCs) induced by ischemic preconditioning (IPC) contributed to the protection of renal acute ischemia-reperfusion injury (IRI) in male rats.

Material/Methods

Forty male Sprague-Dawley rats were randomly divided into four groups, including sham-operated group, IRI-operated group, IPC-treated group and EPCs-treated group. Subsequently, serum samples were collected at 24 and 72 hours after reperfusion, respectively. In addition, histological examination was utilized to assess changes in renal structure. Moreover, immunohistochemical staining, quantitative real-time PCR and Western blotting analysis detected the expression levels of CD31, CD34, vascular endothelial growth factor (VEGF), angiopoietin-1 (Ang-1) and angiopoietin-2 (Ang-2).

Results

Rats in the EPCS-treated group had significantly reduced levels of blood urea nitrogen and serum creatinine at 24 hours after operation, compared to rats that in the IRI-operated group. At 72 hours after reperfusion, renal function and morphology showed significant improvements in the EPCs-treated group. In addition, CD31+ and CD34+ cells that mostly accumulated in the renal medulla were significantly increased in IPC-treated group at 72 hours (p<0.05). Compared to the IRI-operated group, the number of EPCs in the kidneys was markedly increased at 72 hours following reperfusion in the IPC-treated group. In addition, expression levels of VEGF, Ang-1 and Ang-2 in the kidneys of the IPC-treated and EPCs-treated rats were significantly increased compared to the IRI-operated group.

Conclusions

These results provided evidence that IPC-mediated homing of EPCs played an important role in the protection of renal acute IRI, involving promotion of cell proliferation and angiogenesis through release of several angiogenic factors, such as VEGF, Ang-1, and Ang-2.

MeSH Keywords: Ischemic Preconditioning; Receptors, Vascular Endothelial Growth Factor; Reperfusion Injury

Background

Ischemia and reperfusion injury (IRI) is a major cause of acute organ dysfunction. Moreover, as a vital organ of the human body, kidney is highly sensitive to ischemia [1]. IRI is defined as a risk factor for the development of acute kidney injury (AKI) in a variety of clinical situations, such as partial nephrectomy, renal transplantation, shock, sepsis, vascular surgery and other urologic conditions, which may give rise to a high incidence of complications [2–5]. The morbidity and mortality from renal IRI are still increasing and remain virtually unchanged in the past few decades [6,7]. Therefore, there is an urgent period of time to improve treatment strategies that can avoid a significant number of deaths [8].

Clinical studies of renal IRI have previously reported increased susceptibility to AKI. In addition, studies of experimental models of this disease have shown that various methods have been developed to prevent renal IRI. In previous studies, some research has presented the concept of ischemic preconditioning (IPC), which consists of one or more short cycles of reperfusion followed by one or more short cycles of ischemia, immediately before an ischemic phase and the permanent reperfusion [9]. Early studies have shown that IPC regimen can protect the target organs or distant parts of organs and tissues to increase the number of endothelial progenitor cells (EPCs) [10–12]. This phenomenon was initially described for the heart by Murry et al. [13] and Ambros et al. [14]. The protective effects of IPC consist of two distinct phases: the early phase develops rapidly from the time of the initial ischemic insult, lasting for several hours. Conversely, the later phase of protection begins 12 to 24 hours after the initial insult, persisting for several days [10,15]. However, the interval time between pre-ischemic and ischemic injury was too long for clinical application. Therefore, we laid emphasis on the study of the early phase of IPC in renal IRI.

Asahara et al. [16] first reported a population of circulating cells called EPCs, which are precursors of endothelial cells as well as progenitor cells, mobilize from bone marrow to peripheral blood in response to ischemia injury [17,18]. Interestingly, recent studies demonstrated that EPCs could mobilize to ischemic organs, alleviate kidney injury, and preserve renal function after IRI [10,11]. In addition, this cell type is known to contribute to both angiogenesis and vasculogenesis, thereby promoting proliferation of endothelial cells to meet blood supply [16,19]. However, previous studies indicated the number of circulating EPCs of adults is insufficient to repair impaired organs induced by IRI [20]. Furthermore, the number of EPCs that can be transplanted into the circulation is relatively less. Collectively, the effective strategy to sufficiently increase the number of EPCs has become an issue of concern for treatment of renal IRI.

With the goal of directly preserving the micro-circulation in the IRI by incorporation of EPCs into vascular structures, we investigated whether IPC could rapidly produce circulating EPCs in renal IRI. Moreover, we assessed whether IPC-mediated homing of EPCs enhanced the release of protective cytokines, including vascular endothelial growth factor (VEGF), angiopoietin-1 (Ang-1) and angiopoietin-2 (Ang-2) in ischemic kidney. According to the mechanism described earlier, it appeared logical to determine whether the early phase of IPC could protect the residual renal function following IRI. Hence, the present study aimed to examine the protective effects and the potential mechanisms of IPC induced by homing of EPCs on renal IRI in male rats.

Material and Methods

Animals and experimental protocol

All adult male Sprague-Dawley (SD) rats (220±20 g) were obtained from the Center for Experimental Animals at Southeast University Medical College (Nanjing, Jiangsu, China). All animals were maintained in our Experimental Animal Center at a controlled temperature (24–2°C) and a 12-hour alternating light-dark cycle under a pathogen-free condition, with free intake of a standard commercial diet and water during the experiment. All procedures were conducted in experimental animals and the protocols were approved by the Committee on the Ethics of Animal Research in Animal Care Facility of Nanjing Medical University (Nanjing, Jiangsu, China) in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

Surgical procedure

All male SD rats were anesthetized by intraperitoneal injection with sodium pentobarbital (40 mg/kg) and placed on a warming table to maintain a rectal temperature of 37°C. The surgical site was epilated, a midline laparotomy was made using micro-scissors and the right kidney was removed. Besides, renal arteries were exposed by a midline cervical incision and were occluded. The rats were randomly divided into four groups: sham-operated group (n=10), only the left renal artery was carefully separated without clamping; IRI-operated group (n=10), the left artery was occluded using a nontraumatic vascular clamp for 45 minutes; IPC-treated group (n=10), prior to the subsequent 45 minutes occlusion, these rats were underwent the IPC protocol of 15 minutes of occlusion and another 10 minutes of reperfusion; EPCs-treated group (n=10), rats were injected EPCs suspension liquid (1×106) from the femoral vein of rats, after the establishment of renal IRI and IPC model.

Subsequently, a synthetic absorbable surgical tissue adhesive was used to suture the surgical incision. In addition, these rats were monitored until recovery in a chamber with a warm pad, and were maintained on the normal chow diet and water for three days following surgery.

Organ weight index

After all rats were killed, body weight and kidney weight were quickly weighed at 72 hours after reperfusion. In addition, the renal weight indices were calculated as the mean value of mass (mg)/body mass (g) of the left kidney.

Serum levels of BUN and Scr

The blood from fundus venous plexus after reperfusion for 24 hours and from the inferior vena cava at 72 hours after reperfusion were collected respectively and centrifuged at 2,500 rpm for 10 minutes for equal volumes of supernatant to be stored at −80°C to harvest the sera. The serum urea nitrogen (BUN), creatinine (Scr) levels were measured using clinical automated analysis (Hitachi 7020, Hitachi High-Technologies Corporation, Tokyo, Japan).

Histological examination

Each harvested renal tissue sample was fixed with 4% formaldehyde for 24 hours and embedded in paraffin blocks, sectioned at 45 μm thickness. After gradual deparaffinization and hydration, the chosen transverse sections from each sample were examined using hematoxylin eosin staining. All histomorphological analyses described below were performed in blinded fashion. Histomorphological injury scoring was carried out using a previously described semi-quantitative method, based on a scale of 0 to 4 with higher values representing more severe damage as follows: 0, normal kidney; 1, minimal necrosis; 2, mild necrosis; 3, moderate necrosis; and 4, severe necrosis [23,24]. Then, the sections were examined under light microscopy (Olympus BX-51, Olympus, Tokyo, Japan) to evaluate structural changes in tubular necrosis, tubular dilatation and atrophy, vacuolization, inflammatory cell infiltration, MNCs infiltration, capillary dilatation, interstitial structural changes, renal corpuscle morphology, or cellular edema.

Immunohistochemical staining

Renal tissue sections were dewaxed, rehydrated, and washed three times for five minutes in PBS. After slides were microwaved for 20 minute and allowed to cool for one hour at room temperature, endogenous peroxidase activity was blocked in all sections by incubating the sections in 3% H2O2 for 15 minutes. The sections were incubated with rabbit anti-rat CD31 and CD34 antibody (Abbiotec) overnight at 4 °C. Next day, the slides were washed and incubated with a horseradish peroxidase (HRP)-conjugated anti-goat secondary antibody at a 1: 100 dilution for one hour. After stained by DAB, the sections were observed under light microscopy.

Cell culture and characterization of EPCs

Male adult SD rats (weight ranges from 200 to 240 g) all were sacrificed by injection of an overdose of sodium pentobarbital (100 mg/kg) into the peritoneal cavity. EPCs were generated from bone marrow mononuclear cells (MNCs) according to previously published methods [21,22]. In brief, bone marrow samples were flushed out with phosphate-buffered saline (PBS) (Gibco) from tibias and femurs. MNCs were isolated by density gradient centrifuge method by 2,500 rpm for 30 minutes. Next, MNCs isolated from rats were counted and plated on 6-well plates pre-coated with 0.2 mg/mL human plasma fibronectin (EMD Millipore Corporation) and maintained at 37°C under an atmosphere containing 5% CO2. Meanwhile, MNCs were grown in endothelial cell basal medium-2 (EBM-2) (Clonetics) supplemented with 10% fetal bovine serum (FBS) (HyClone), containing EPC growth cytokine cocktail (Lonza). After a 4-day culture in wells not coated with biomaterial membranes, non-adherent cells were removed by washing with PBS. Thereafter, culture medium was changed every 2–3 days. During culture, an inverted phase contrast microscope (IX70-81FZ; Olympus Corporation, Tokyo, Japan) was used to observe the EPCs morphology and growth in vitro.

To identify the characters of EPCs, all cells were incubated with Dil-acetylated-low density lipoprotein (10 mg/mL) (Dil-ac-LDL; Thermo Fisher Scientific, Inc.) for 6 hours and then fixed with 4% paraformaldehyde for 15 minutes, incubated with fluorescein isothiocyanate (FITC)-Ulex europaeus agglutinin (UEA)-1 (10 mg/mL) (FITC-UEA-1; Sigma-Aldrich) for one hour and examined under a laser confocal scanning microscope (Leica, Wetzlar, Germany) for observation, differentiation and identification. In addition, cells that were double positive for Dil-ac-LDL and FITC-UEA-1 were identified as EPCs by dual staining for fluorescent lamp. Approximately 85% of cells were positive for these two markers.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from rat kidney samples with the TRIzol reagent (Ambion). RNA to cDNA from 1 μg of total RNA was reverse-transcribed in a final volume of 10 μL using random primers and a reverse transcription kit (Takara Biotechnology Co. Ltd.). The reverse transcription was performed at 37°C for 15 minutes, then 85°C for 5 seconds. All operations were performed according to the manufacturer’s instructions. Real-time PCR (RT-PCR) analyses were used as template using a standard protocol from Power SYBR Green (Takara Biotechnology Co. Ltd.) on an ABI StepOne Plus instrument (Applied Biosystems) and in a total reaction volume of 10 μL, including 5 μL of SYBR Premix (2×), 0.4 μL of PCR forward primer (10 μM), 0.4 μL of PCR reverse primer (10 μM), 0.2 μL ROX Reference Dye II (50×), 1 μL of cDNA, 3 μL of diethypyrocarbonate. The qRT-PCR cycle profile was 95°C for 10 minutes, followed by 40 cycles of 15 seconds at 95°C with a desaturated temperature, 30 seconds at annealing temperatures of 60°C, and 10 seconds at 72°C for a final extension.

The PCR primers were as follows:

  • VEGF: Forward: 5′-GTCCAATTGAGACCCTGGTG-3′

  • Reverse: 5′-CTATGTGCTGGCTTTGGTGA-3′

  • Ang-1: Forward: 5′-GGAGCATGTGATGGAAAATTA-3′

  • Reverse: 5′-TGTGTTTTCCCTCCATTTCTA-3′

  • Ang-2: Forward: 5′-AAAGAGTA CAAAGAGGGCTTC-3′

  • Reverse: 5′- TCCAGTAGTACCACTTGATAC -3′

  • β-actin: Forward: 5′-ACTGGAACGGTGAAGGTGAC-3′

  • Reverse: 5′-AGAGAAGTGGGGTGGCTTTT-3′

Western blot analysis

The proteins of kidney tissues obtained were extracted according to the manufacturer’s instructions. Protein extracts separated upon 7.5% SDS-PAGE were transferred to 0.45 μm PVDF membrane (Bio-Rad). The membranes were blocked with 5% low fat milk powder in TBST before Western blotting overnight at 4°C with rabbit polyclonal antibodies against mouse VEGF, Ang-1, and Ang-2 (1: 1,000; Santa Cruz). After a one hour incubation with HRP-conjugated secondary antibody (1: 5,000; Santa Cruz), immunoreactive bands were visualized with electro-chemiluminescence reagent (Amersham). Densitometric and ImageQuant analysis were subsequently performed using NIH Image software (Bethesda).

Statistical analysis

All statistical evaluations were performed by analysis of variance (ANOVA), followed by the Student-Newman-Keuls test. The differences were evaluated using SPSS 19.0 (Armonk, New York, United States) to evaluate each data set by the Chauvenet criterion for homogeneity. Significant differences were considered at p<0.05, when each experiment was performed at least three times.

Results

Effects of IPC and EPCs transplantation on kidney weight and body weight

Body weight and kidney weight of the rats did not differ between the four groups (Figure 1A, 1B). The ratio of renal weight/body weight was increased in the IPC-treated group and EPCs-treated group compared to the sham-operated group, but no statistically significant difference was found (Figure 1C). Gross morphology of the kidneys was normal.

Figure 1.

Figure 1

Open in a new tab

Effect of IPC and EPCs transplantation on body weight and kidney weight. (A) Body weight of rats in the four groups. (B) Kidney weight of rats in the four groups. (C) The ratio of the left kidney weight/body weight in the four groups; n=15 for each group. Data are expressed as mean ±SD.

Effects of IPC and EPCs transplantation on renal function

As shown in Figure 2, the serum BUN and Scr levels were significantly decreased in the IPC-treated group and EPCs-treated group compared to the IRI-operated group, particularly in the EPCs transplantation group (p<0.05).

Figure 2.

Figure 2

Open in a new tab

Effect of IPC and EPCs transplantation on renal function of different groups. (A) Blood urine nitrogen (BUN, mmol/L). (B) Serum creatinine (Scr, μmol/L). Columns represent mean ±SD. * Significant difference vs. sham group (p<0.05); # significant difference vs. IRI group (p<0.05).

Effects of IPC and EPCs transplantation on renal morphology

IPC intervention and EPCs transplantation significantly attenuated ischemic tubulointerstitial abnormalities and displayed moderate to severe ischemia with characteristic tubulointerstitial lesions at 72 hours following reperfusion (p<0.05). The results of renal morphology are shown in Figure 3. In addition, acute tubular necrosis in the IRI group was identified in light microscopic examination, including marked renal tubule dilatation and cell atrophy, atrophic epithelial lining, pyknotic nuclei, and congestion in the peritubular capillaries. Furthermore, IPC intervention and EPCs transplantation obviously improved the IRI-induced histological alterations as observed by number of tubule/unit area. Our results indicated that IPC intervention could reduce renal inflammatory intensity, protecting the kidney from IRI to some extent. Meanwhile, IPC intervention might improve homing of EPCs and obviously mitigated the ischemic damage at 72 hours after operation (p<0.05 versus IRI-operated group).

Figure 3.

Figure 3

Open in a new tab

Effect of IPC and EPCs transplantation on renal morphology at 72 hours following reperfusion. Renal sections were stained with hematoxylin and eosin and examined using light microscopy at a magnification ×400. (A) Sham-operated rats exhibited minimal pathological changes in the kidneys. (B) Following IRI, more severe lesions were observed in renal tubules, with tubular atrophy, dilatation, and intratubular casts, as well as congestion in the peritubular capillaries, massive epithelial cells, atrophic epithelial lining, and intraluminal necrotic debris. (C) IPC caused a significant reduction in the severity of acute tubular necrosis. (D) Degree of renal injury in the EPCs-treated group was clearly slighter than in the IPC-treated group.

Effects of IPC on EPC mobilization

Immunohistochemical analysis was used to examine the expressions of CD31 and CD34 in the kidney. Compared to the sham-operated group, high expression levels of CD31 and CD34 were detected in the IPC-treated group and the EPCs-treated group, especially in the EPCs transplantation group. In addition, the CD31 and CD34 expression levels in the IPC-treated group and the EPCs-treated group were significantly increased (p<0.05 versus the IRI-operated group) at 72 hours after the operation. Positive staining of CD31 and CD34 cells massively accumulated in the renal medullary interstitium, which was distributed in the tubulointerstitium in the IPC-treated group and the EPCs suspension liquid was injected. Thus, these results suggested that IPC pretreatment might increase the recruitment of EPCs (Figure 4).

Figure 4.

Figure 4

Open in a new tab

Immunohistochemical staining for CD31 and CD34 at 72 hours after reperfusion (×400). CD31 and CD34 expression was decreased in the IRI-operated group compared with the IPC group and EPCs-treated group. Data are shown as mean ±SD. * Significant difference vs. sham group (p<0.05); # significant difference vs. IRI-operated group (p<0.05).

Effects of IPC and EPCs transplantation on mRNA expression of angiogenic factors

qRT-PCR was used to investigate the levels of mRNA of angiogenic factors in the kidney. VEGF mRNA expression was significantly higher in the EPCs-treated group compared with the other three groups following reperfusion (p<0.05). When investigating mRNA levels of Ang-1 and Ang-2, a significantly increased Ang-1 and Ang-2 expression level were observed in the IPC-treated group and the EPCs-treated group at 72 hours compared to the IRI-operated group (p<0.05). Furthermore, VEGF, Ang-1, and Ang-2 mRNA were more abundant in the EPCs-treated group compared to the IPC-treated group at 72 hours after reperfusion (p<0.05) (Figure 5).

Figure 5.

Figure 5

Open in a new tab

Effect of IPC and EPCs transplantation on expression of mRNA levels in different groups. (A–C) mRNA expression levels of VEGF, Ang-1, and Ang-2 in different groups. Data are expressed as mean ±SD. * Significant difference vs. sham group (p<0.05); # significant difference vs. IRI-operated group (p<0.05).

Effects of IPC and EPCs transplantation on angiogenic factor protein expression

Expression levels of VEGF, Ang-1, and Ang-2 proteins were analyzed using Western blotting at 72 hours after the operation. As was shown in Figure 6, the expression levels of VEGF, Ang-1, and Ang-2 in the kidneys of the IPC-treated group and the EPCs-treated group hosts were dramatically increased compared with the sham-operated group (p<0.05). Meanwhile, compared to the IRI-operated group, VEGF, Ang-1, and Ang-2 proteins levels were significantly increased in the EPCs-treated group. Hence, these results indicated that IPC induced the homing of EPCs and individual supplementary EPCs obviously increased the levels of paracrine factors.

Figure 6.

Figure 6

Open in a new tab

Effect of IPC and EPCs transplantation on protein expression in different groups. (A) Protein expression levels of VEGF, Ang-1, and Ang-2 in different groups. β-actin was used as a protein control to normalize volume of protein expression. (B–D) Protein levels were determined by densitometric analysis and normalized to the β-actin signal. Data are expressed as mean ±SD. * Significant difference vs. sham group (p<0.05); # significant difference vs. IRI-operated group (p<0.05).

Discussion

Renal IRI is a complex pathophysiologic process that occurs in the context of kidney transplantation, partial nephrectomy, cardiac arrest with recovery, and vascular surgery, which is a common cause of renal cell death, kidney failure, delayed graft function, and kidney allograft rejection [25,26]. The mechanisms underlying reperfusion damage to the kidneys are likely multifactorial and interdependent, involving oxidative stress injury, hypoxia, and inflammatory responses [27]. AKT produced by ischemia and reflow is a clinical and complex syndrome involving renal vasoconstriction, tubular cell necrosis, extensive tubular damage, glomerular filtration failure, glomerular injury, and signs of tubular obstruction with cell debris [28,29]. Studies at the level of animals have revealed that a number of influence factors could protect the body against IRI associated with ischemic AKT.

Renal microcirculation disturbance and impaired renal vascular activity that occurs after renal reperfusion are key factors in the development of renal IRI, which can sustain renal artery blood flow decrease and hamper the full recovery of renal IRI [30,31]. Previous studies have demonstrated that IPC participated in stem cell mobilization and the latter was closely related to ischemic repair [32,33]. Other researchers have suggested that EPC modulation by the early phase of IPC could attenuate IRI, which is in line with the reports of Li et al. [11] who stated that EPC recruitment during the early phase of IPC might alleviate acute myocardial ischemia. Therefore, these findings suggested that increasing the numbers of EPCs might offer a possible explanation in protective effects of IPC. Furthermore, multiple studies provided evidence that IPC played a protective role in a variety of organs including the kidneys [34,35]. In the current study, the early phase of IPC could afford partial renoprotection following kidney operation, involving increasing the number of EPCs in the ischemic kidney. However, the protective mechanism of IPC on renal IRI remains unknown. Therefore, the present study aimed to demonstrate whether increasing the number of EPCs in the IRI kidney could contribute to the restoration of renal function, by establishing a renal IPC model to mobilize and recruit EPCs.

This study showed that the number of EPCs in the kidneys might be modulated by IPC, which was detected in a large number of CD31+ and CD34+ cells in the medullopapillary region using immunochemistry. Furthermore, significant increases in angiogenesis were found in these preconditioned rats, as measured by peritubular capillary rarefaction index. In addition, EPCs might be critical to recovery from ischemic injury, and at least partially participated in neovascularization and cell regeneration.

These mechanisms could prompt EPC incorporation into injured cells and subsequent paracrine effects [36–39]. Previous studies have showed that EPCs did not act via directly incorporation into the injured cells, but rather by a paracrine mechanism [40,41]. This was because only low numbers of EPCs could be identified as having been incorporated into the new capillaries following EPCs transplantation. In addition, some researchers confirmed that EPCs had the ability to secrete and regulate many factors. Each gene has a different function in tissue repair and reconstruction [42]. More positively, paracrine factors obviously increase angiogenesis [43,44] and play an important role in homing, migration, and mobilization of EPCs [45,46]. In the present study, we found IPC could produce rapid increases in the number of circulating EPCs in ischemic kidney. In addition, IPC-mediated homing of EPCs enhanced the release of protective cytokines, including VEGF, Ang-1, and Ang-2 in renal IRI.

Although the results obtained in our study are promising, some limitations should be taken into consideration. First, no long-term observation was conducted, the study time frame was for only three days after reperfusion to measure the effects of IPC-mediated homing of EPCs on renal IRI. Therefore, future experiments need to be carried out to substantiate an exact mechanism and explain the long-term effects of EPCs transplantation on kidney IRI. Second, renal IRI results from complex interactions, including a variety of factors, suggests that EPCs are only one important factor in the renal protection capacity of IPC. Hence, exploring more new and potential mechanism is needed. What’s more, the detailed mechanisms that regulate VEGF expression levels through IPC-mediated homing of EPCs and the differential effects of VEGF remain unknown and need to be studied further. Accordingly, it is required that further studies be performed to elucidate the effect of IPC-mediated homing of EPCs on renal acute IRI.

Conclusions

IPC could produce rapidly increasing numbers of circulating EPCs in a renal IRI model. Moreover, IPC and increased number of EPCs could contribute to improvements in BUN, Scr, and morphological changes, thereby alleviating IRI-induced renal dysfunction and histological damage. Meanwhile, IPC-mediated homing of EPCs could enhance the release of protective cytokines, including VEGF, Ang-1, and Ang-2 in ischemic kidney. Further studies with different measuring methods and long-term follow-up are required to validate our results.

Footnotes

Conflict of interest: We declare that we have no conflict of interest.

Source of support: Departmental sources

References

  • 1.Legrand M, Mik EG, Johannes T, et al. Renal hypoxia and dysoxia after reperfusion of the ischemic kidney. Mol Med. 2008;14(7–8):502–16. doi: 10.2119/2008-00006.Legrand. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Nigwekar SU, Kandula P, Hix JK, Thakar CV. Off-pump coronary artery bypass surgery and acute kidney injury: A meta-analysis of randomized and observational studies. Am J Kidney Dis. 2009;54(3):413–23. doi: 10.1053/j.ajkd.2009.01.267. [DOI] [PubMed] [Google Scholar]
  • 3.White LE, Hassoun HT. Inflammatory mechanisms of organ crosstalk during ischemic acute kidney injury. Int J Nephrol. 2012;2012:505197. doi: 10.4061/2012/505197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mehta RL, Pascual MT, Soroko S, et al. Spectrum of acute renal failure in the intensive care unit: The PICARD experience. Kidney Int. 2004;66(4):1613–21. doi: 10.1111/j.1523-1755.2004.00927.x. [DOI] [PubMed] [Google Scholar]
  • 5.Perico N, Cattaneo D, Sayegh MH, Remuzzi G. Delayed graft function in kidney transplantation. Lancet. 2004;364(9447):1814–27. doi: 10.1016/S0140-6736(04)17406-0. [DOI] [PubMed] [Google Scholar]
  • 6.Susantitaphong P, Cruz DN, Cerda J, et al. World incidence of AKI: A meta-analysis. Clin J Am Soc Nephrol. 2013;8(9):1482–93. doi: 10.2215/CJN.00710113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Macedo E, Mehta RL. Preventing acute kidney injury. Crit Care Clin. 2015;31(4):773–84. doi: 10.1016/j.ccc.2015.06.011. [DOI] [PubMed] [Google Scholar]
  • 8.Yuen PS, Jo SK, Holly MK, et al. Ischemic and nephrotoxic acute renal failure are distinguished by their broad transcriptomic responses. Physiol Genomics. 2006;25(3):375–86. doi: 10.1152/physiolgenomics.00223.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhao ZQ, Corvera JS, Halkos ME, et al. Inhibition of myocardial injury by ischemic postconditioning during reperfusion: Comparison with ischemic preconditioning. Am J Physiol Heart Circ Physiol. 2003;285(2):H579–88. doi: 10.1152/ajpheart.01064.2002. [DOI] [PubMed] [Google Scholar]
  • 10.Patschan D, Krupincza K, Patschan S, et al. Dynamics of mobilization and homing of endothelial progenitor cells after acute renal ischemia: Modulation by ischemic preconditioning. Am J Physiol Renal Physiol. 2006;291(1):F176–85. doi: 10.1152/ajprenal.00454.2005. [DOI] [PubMed] [Google Scholar]
  • 11.Ii M, Nishimura H, Iwakura A, et al. Endothelial progenitor cells are rapidly recruited to myocardium and mediate protective effect of ischemic preconditioning via “imported” nitric oxide synthase activity. Circulation. 2005;111(9):1114–20. doi: 10.1161/01.CIR.0000157144.24888.7E. [DOI] [PubMed] [Google Scholar]
  • 12.Przyklenk K, Bauer B, Ovize M, et al. Regional ischemic ‘preconditioning’ protects remote virgin myocardium from subsequent sustained coronary occlusion. Circulation. 1993;87(3):893–99. doi: 10.1161/01.cir.87.3.893. [DOI] [PubMed] [Google Scholar]
  • 13.Murry CE, Jennings RB, Reimer KA. Preconditioning with ischemia: A delay of lethal cell injury in ischemic myocardium. Circulation. 1986;74(5):1124–36. doi: 10.1161/01.cir.74.5.1124. [DOI] [PubMed] [Google Scholar]
  • 14.Ambros JT, Herrero-Fresneda I, Borau OG, Boira JM. Ischemic preconditioning in solid organ transplantation: from experimental to clinics. Transpl Int. 2007;20(3):219–29. doi: 10.1111/j.1432-2277.2006.00418.x. [DOI] [PubMed] [Google Scholar]
  • 15.Blanco M, Lizasoain I, Sobrino T, et al. Ischemic preconditioning: A novel target for neuroprotective therapy. Cerebrovasc Dis. 2006;21(Suppl 2):38–47. doi: 10.1159/000091702. [DOI] [PubMed] [Google Scholar]
  • 16.Asahara T, Murohara T, Sullivan A, et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science. 1997;275(5302):964–67. doi: 10.1126/science.275.5302.964. [DOI] [PubMed] [Google Scholar]
  • 17.Kalka C, Masuda H, Takahashi T, et al. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization. Proc Natl Acad Sci USA. 2000;97(7):3422–27. doi: 10.1073/pnas.070046397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rouhl RP, van Oostenbrugge RJ, Damoiseaux J, et al. Endothelial progenitor cell research in stroke: A potential shift in pathophysiological and therapeutical concepts. Stroke. 2008;39(7):2158–65. doi: 10.1161/STROKEAHA.107.507251. [DOI] [PubMed] [Google Scholar]
  • 19.Li B, Cohen A, Hudson TE, et al. Mobilized human hematopoietic stem/progenitor cells promote kidney repair after ischemia/reperfusion injury. Circulation. 2010;121(20):2211–20. doi: 10.1161/CIRCULATIONAHA.109.928796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Peichev M, Naiyer AJ, Pereira D, et al. Expression of VEGFR-2 and AC133 by circulating human CD34(+) cells identifies a population of functional endothelial precursors. Blood. 2000;95(3):952–58. [PubMed] [Google Scholar]
  • 21.Chen J, Chen S, Chen Y, et al. Circulating endothelial progenitor cells and cellular membrane microparticles in db/db diabetic mouse: Possible implications in cerebral ischemic damage. Am J Physiol Endocrinol Metab. 2011;301(1):E62–71. doi: 10.1152/ajpendo.00026.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Marrotte EJ, Chen DD, Hakim JS, Chen AF. Manganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice. J Clin Invest. 2010;120(12):4207–19. doi: 10.1172/JCI36858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hattori K, Dias S, Heissig B, et al. Vascular endothelial growth factor and angiopoietin-1 stimulate postnatal hematopoiesis by recruitment of vasculogenic and hematopoietic stem cells. J Exp Med. 2001;193(9):1005–14. doi: 10.1084/jem.193.9.1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jia RP, Xie JJ, Luo FY, Zhu JG. Ischemic preconditioning improves rat kidney allograft function after ischemia/reperfusion injury: The role of tumor necrosis factor-alpha. Transplant Proc. 2008;40(10):3316–20. doi: 10.1016/j.transproceed.2008.06.113. [DOI] [PubMed] [Google Scholar]
  • 25.Baker GL, Corry RJ, Autor AP. Oxygen free radical induced damage in kidneys subjected to warm ischemia and reperfusion. Protective effect of superoxide dismutase. Ann Surg. 1985;202(5):628–41. doi: 10.1097/00000658-198511000-00016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Almond PS, Matas AJ, Gillingham K, et al. Predictors of chronic rejection in renal transplant recipients. Transplant Proc. 1993;25(1 Pt 2):936. [PubMed] [Google Scholar]
  • 27.Paller MS. The cell biology of reperfusion injury in the kidney. J Investig Med. 1994;42(4):632–39. [PubMed] [Google Scholar]
  • 28.Bird JE, Milhoan K, Wilson CB, et al. Ischemic acute renal failure and antioxidant therapy in the rat. The relation between glomerular and tubular dysfunction. J Clin Invest. 1988;81(5):1630–38. doi: 10.1172/JCI113498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Finn WF. Nephron heterogeneity in polyuric acute renal failure. J Lab Clin Med. 1981;98(1):21–29. [PubMed] [Google Scholar]
  • 30.Pechman KR, De Miguel C, Lund H, et al. Recovery from renal ischemia-reperfusion injury is associated with altered renal hemodynamics, blunted pressure natriuresis, and sodium-sensitive hypertension. Am J Physiol Regul Integr Comp Physiol. 2009;297(5):R1358–63. doi: 10.1152/ajpregu.91022.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Regner KR, Roman RJ. Role of medullary blood flow in the pathogenesis of renal ischemia-reperfusion injury. Curr Opin Nephrol Hypertens. 2012;21(1):33–38. doi: 10.1097/MNH.0b013e32834d085a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kamota T, Li TS, Morikage N, et al. Ischemic pre-conditioning enhances the mobilization and recruitment of bone marrow stem cells to protect against ischemia/reperfusion injury in the late phase. J Am Coll Cardiol. 2009;53(19):1814–22. doi: 10.1016/j.jacc.2009.02.015. [DOI] [PubMed] [Google Scholar]
  • 33.Czeiger D, Dukhno O, Douvdevani A, et al. Transient extremity ischemia augments CD34+ progenitor cell availability. Stem Cell Rev. 2011;7(3):639–45. doi: 10.1007/s12015-011-9234-x. [DOI] [PubMed] [Google Scholar]
  • 34.Chen X, Liu X, Wan X, et al. Ischemic preconditioning attenuates renal ischemia-reperfusion injury by inhibiting activation of IKKbeta and inflammatory response. Am J Nephrol. 2009;30(3):287–94. doi: 10.1159/000225928. [DOI] [PubMed] [Google Scholar]
  • 35.Liu H, Wu R, Jia RP, et al. Ischemic preconditioning increases endothelial progenitor cell number to attenuate partial nephrectomy-induced ischemia/reperfusion injury. PLoS One. 2013;8(1):e55389. doi: 10.1371/journal.pone.0055389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yu Y, Gao Y, Qin J, et al. CCN1 promotes the differentiation of endothelial progenitor cells and reendothelialization in the early phase after vascular injury. Basic Res Cardiol. 2010;105(6):713–24. doi: 10.1007/s00395-010-0117-0. [DOI] [PubMed] [Google Scholar]
  • 37.Chen L, Wu F, Xia WH, et al. CXCR4 gene transfer contributes to in vivo reendothelialization capacity of endothelial progenitor cells. Cardiovasc Res. 2010;88(3):462–70. doi: 10.1093/cvr/cvq207. [DOI] [PubMed] [Google Scholar]
  • 38.Rehman J, Li J, Orschell CM, March KL. Peripheral blood “endothelial progenitor cells” are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation. 2003;107(8):1164–69. doi: 10.1161/01.cir.0000058702.69484.a0. [DOI] [PubMed] [Google Scholar]
  • 39.Kwon O, Miller S, Li N, et al. Bone marrow-derived endothelial progenitor cells and endothelial cells may contribute to endothelial repair in the kidney immediately after ischemia-reperfusion. J Histochem Cytochem. 2010;58(8):687–94. doi: 10.1369/jhc.2010.956011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zampetaki A, Kirton JP, Xu Q. Vascular repair by endothelial progenitor cells. Cardiovasc Res. 2008;78(3):413–21. doi: 10.1093/cvr/cvn081. [DOI] [PubMed] [Google Scholar]
  • 41.Yoder MC, Mead LE, Prater D, et al. Redefining endothelial progenitor cells via clonal analysis and hematopoietic stem/progenitor cell principals. Blood. 2007;109(5):1801–9. doi: 10.1182/blood-2006-08-043471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Xu S, Zhu J, Yu L, Fu G. Endothelial progenitor cells: Current development of their paracrine factors in cardiovascular therapy. J Cardiovasc Pharmacol. 2012;59(4):387–96. doi: 10.1097/FJC.0b013e3182440338. [DOI] [PubMed] [Google Scholar]
  • 43.Yu JX, Huang XF, Lv WM, et al. Combination of stromal-derived factor-1alpha and vascular endothelial growth factor gene-modified endothelial progenitor cells is more effective for ischemic neovascularization. J Vasc Surg. 2009;50(3):608–16. doi: 10.1016/j.jvs.2009.05.049. [DOI] [PubMed] [Google Scholar]
  • 44.Yi C, Xia W, Zheng Y, et al. Transplantation of endothelial progenitor cells transferred by vascular endothelial growth factor gene for vascular regeneration of ischemic flaps. J Surg Res. 2006;135(1):100–6. doi: 10.1016/j.jss.2006.01.014. [DOI] [PubMed] [Google Scholar]
  • 45.Thum T, Hoeber S, Froese S, et al. Age-dependent impairment of endothelial progenitor cells is corrected by growth-hormone-mediated increase of insulin-like growth-factor-1. Circ Res. 2007;100(3):434–43. doi: 10.1161/01.RES.0000257912.78915.af. [DOI] [PubMed] [Google Scholar]
  • 46.Henrich D, Hahn P, Wahl M, et al. Serum derived from multiple trauma patients promotes the differentiation of endothelial progenitor cells in vitro: Possible role of transforming growth factor-beta1 and vascular endothelial growth factor165. Shock. 2004;21(1):13–16. doi: 10.1097/01.shk.0000101669.49265.50. [DOI] [PubMed] [Google Scholar]

Articles from Annals of Transplantation are provided here courtesy of International Scientific Information, Inc.

RESOURCES