Dietary protein: Layer performance and mineral use responses of laying performance and mineral utilization to graded levels of dietary crude protein in laying hens

Abstract

The intricate relationship between nitrogen and the mineral metabolism in laying hens has been well-established. However, the changes in digestion, deposition, and utilization of minerals under low-protein diets remain to be fully elucidated. In this study, 504 Hy-line Brown laying hens, aged 49 weeks, were assigned to six groups (7 replicates with 12 hens each) and fed diets with crude protein (CP) levels of 15.0, 15.5, 16.0, 16.5, 17.0, and 17.5 % to explore mineral metabolism changes. The elevation of the dietary CP levels led to significant increases in the average daily feed intake, the total egg weight, and the egg yolk color (linear, P < 0.001, quadratic, P < 0.001). It also resulted in a decrease in the feed-to-egg ratio (linear, P < 0.001, quadratic, P < 0.001). The group that was administered 16.5 % CP exhibited the highest total egg weight and lowest feed-to-egg ratio (P < 0.001) compared to those of the other groups. A reduction in the dietary CP levels enhanced the apparent total intestinal digestibility (ATTD) of the CP (linear, P < 0.05; quadratic, P < 0.05). Specifically, the group that was administered 17.5 % CP exhibited a significant mRNA expression upregulation of duodenal mineral transporters, including the solute carrier family 34 member A2, the Na⁺/K⁺-ATPase α1 subunit, and the solute carrier family 9 member A2 (P < 0.05). Zinc deposition in the egg yolk was positively correlated with the dietary CP levels (linear, P = 0.002; quadratic, P = 0.010), whereas manganese deposition in the livers and egg yolks showed a negative correlation (linear, P < 0.001; quadratic, P < 0.001). The group administered 15.0 % CP tended to upregulate the expression of superoxide dismutase-2 mRNA (P = 0.069) in the liver, and showed significantly higher manganese deposition in the liver and egg yolk, compared with those of other groups (P < 0.001). A dietary CP level of 16.5 % was optimal for the maintenance of laying performance. A reduction of the CP to 15.0–15.5 % boosted the nutrient efficiency and manganese utilization and deposition but reduced the laying performance. The results of this study further promote the industrial application of low-protein diets in laying hens.

Introduction

Feed resource shortages are a major limiting factor in the development of animal husbandry. Recently, there has been widespread interest in low-protein diets that can reduce dependence on high-quality protein sources, enhance the protein-utilization efficiency, and mitigate nitrogen emissions (Ishiwata and Furuya, 2020; Dao et al., 2021; Loongyai et al., 2019). However, the implications of low-protein diets extend beyond nitrogen metabolism because these diets can alter metabolic pathways that involve other nutrients (Pezeshki et al., 2016; Dao et al., 2021). These metabolic pathways include mineral metabolism. This aspect warrants particular attention because a reduction in dietary protein levels changes the basal diet structure (Loongyai et al., 2019; Poosuwan et al., 2010) and alters the inherent mineral composition of the diet. This is particularly concerning because the current diet formulations focus solely on exogenous mineral additions, and they neglect the impact of changes in the intrinsic mineral content (Liu et al., 2024a; Mousavi et al., 2013). Consequently, discrepancies may arise between the actual and theoretically calculated mineral content in the final feed formulation. This could potentially compromise animal health and growth performance.

Interconnections between the dietary crude protein (CP) levels and mineral metabolism may influence the demand for and utilization efficiency of minerals in an organism (Chavez-Abiega et al., 2020; Conigrave et al., 2008). Nitrogen metabolism is altered under low-protein conditions. Such an alteration modulates the levels of participating enzymes and hormones, and this influences mineral absorption and utilization (Chavez-Abiega et al., 2020; Conigrave et al., 2008). The dietary protein content affects parathyroid hormone (PTH) secretion via the calcium-sensing receptor (CaSR) that influences calcium (Ca) absorption and metabolism (Chavez-Abiega et al., 2020). Furthermore, low-protein diets reduce the synthesis and expression of mineral transporters (Xue et al., 2016), thereby further impairing mineral absorption. The sodium-phosphate co-transporter IIb (NaPi-IIb) expression in the jejunum of broilers and phosphorus (P) digestion and absorption are decreased under low-protein diets (Xue et al., 2016). Thus, a low protein intake alters the mineral needs of the organism.

Conversely, minerals also regulate protein synthesis, thereby influencing protein metabolism (Keeling et al., 2006). Previous studies have demonstrated that iron serves as a cofactor for enzymes that participate in various cellular processes (Barlit et al., 2022). These enzymes are essential for the modification of translation-elongation factors and transfer RNAs and for translational termination (Romero et al., 2021; Young et al., 2015). This bidirectional regulation suggests that protein and mineral metabolism are interconnected in a complex dynamic equilibrium. However, the effects of dietary CP levels on processes that involve minerals remain unclear.

To test whether dietary CP levels affected mineral metabolism in laying hens, Hy-line Brown hens were fed diets with graded CP levels for 12 weeks. Our objectives were as follows: 1) to explore the appropriate dietary CP level, and 2) to uncover the correlation and potential mechanisms involved in the relationship between dietary CP levels and mineral utilization. The findings obtained in our present study will help in the development of nutritional intervention strategies to optimize low-protein diets.

Materials and methods

All animal studies were conducted in compliance with the ethical guidelines approved by the Animal Ethics Committee of the Northwest A&F University under Protocol DK2022007.

Study design and diet formulation

A total of 504 Hy-line Brown laying hens, aged 49 weeks, were first acclimatized to the housing environment for seven days. Hens with similar laying rates and egg qualities (Supplementary Tables 1 and 2) were randomly assigned to six groups (seven replicates per group) that corresponded to the following dietary CP levels: 15.0, 15.5, 16.0, 16.5, 17.0, and 17.5 %, and these groups were designated as CP17.5, CP17.0, CP16.5, CP16.0, CP15.5, and CP15.0, respectively. The diets were formulated in accordance with the “Low-Protein and Low-Soybean Meal Diversified Layer Feed Production guidelines (T/CFIAS 8004—2023)”. The length of the study was 12 weeks. The hens were fed manually twice per day at fixed times (08:00 and 17:00), with ad libitum access to water. The hens were housed under controlled lighting conditions to provide a 16-h photoperiod (05:30–21:30) using a combination of ambient natural light and supplemental artificial illumination. The coop was regularly cleaned and ventilated, and the lighting hours remained unchanged. The compositions of the experimental diets are shown in Table 1.

Table 1.

Composition and nutrient levels (%, air-dry basis) of the experimental diets used in this study.

Items (%, unless noted)	Crude protein levels (%)
	15.0	15.5	16.0	16.5	17.0	17.5
Corn	36.96	36.04	35.12	33.73	32.05	30.36
Wheat	25.00	25.00	25.00	25.00	25.00	25.00
Soybean meal (46 %)	10.00	10.00	10.00	10.00	10.00	10.00
Extruded soybean	-	-	-	1.20	3.10	5.00
Corn gluten meal (58 %)	1.30	2.32	3.33	3.70	3.70	3.70
Corn bran	3.00	3.00	3.00	3.00	3.00	3.00
Calcium carbonate	6.50	6.50	6.50	6.50	6.50	6.50
Distillers dried grains with soluble	10.00	10.00	10.00	10.00	10.00	10.00
Dicalcium phosphate	0.94	0.93	0.93	0.91	0.88	0.85
Zeolite powder	2.94	2.94	2.94	2.94	2.94	2.94
Soybean oil	1.35	1.30	1.25	1.19	1.12	1.05
Premix1	0.70	0.70	0.70	0.70	0.70	0.70
NaCl	0.30	0.30	0.30	0.30	0.30	0.30
Choline chloride (60 %)	0.10	0.10	0.10	0.10	0.10	0.10
L-Lysine (70 %)	0.53	0.52	0.52	0.47	0.40	0.33
DL-Methionine (99 %)	0.20	0.18	0.17	0.15	0.14	0.12
L-Threonine (98.5 %)	0.12	0.11	0.10	0.08	0.06	0.04
L-Tryptophan (25 %)	0.07	0.06	0.05	0.04	0.01	-
Total	100.00	100.00	100.00	100.00	100.00	100.00
Calculated nutrients
Lys	0.85	0.85	0.85	0.85	0.86	0.86
Met	0.44	0.43	0.43	0.43	0.42	0.42
Met+Cys	0.69	0.69	0.69	0.70	0.70	0.70
Arg	0.80	0.81	0.83	0.86	0.91	0.95
Thr	0.62	0.62	0.63	0.63	0.63	0.64
Analyzed nutrients
GE2 (kcal/kg)	3644.38	3673.84	3639.37	3664.93	3620.49	3626.88
Crude protein	15.29	15.54	16.05	16.32	16.78	17.35
Dry matter	95.42	95.33	95.19	95.06	95.28	95.38
Ether extract	4.25	4.24	4.19	4.04	4.38	4.31
Crude fiber	3.43	3.66	3.42	3.44	3.39	3.40
Ca	3.58	3.38	3.15	3.01	3.12	3.52
Total P	0.55	0.52	0.57	0.55	0.54	0.57
Non-phytate phosphorus	0.36	0.32	0.32	0.32	0.35	0.36
Na	0.14	0.15	0.11	0.11	0.13	0.12
K	0.62	0.64	0.67	0.62	0.63	0.69
Cl	0.22	0.23	0.23	0.23	0.23	0.23
Fe (mg/kg)	354.12	343.77	385.30	383.03	356.69	319.55
Mn (mg/kg)	106.51	114.94	103.34	104.64	105.24	101.54
Zn (mg/kg)	106.89	114.70	103.70	101.89	116.99	101.47
Cu (mg/kg)	14.22	14.79	14.35	14.93	14.87	14.83

¹Provided per kilogram of diet: 60 mg iron (from FeSO₄); 80 mg zinc (from ZnSO₄·H₂O); 60 mg manganese (from MnSO₄·H₂O); 8 mg copper (from CuSO₄·5H₂O); 0.35 mg iodine (from Ca(IO₃)₂); 0.3 mg selenium (from Na₂SeO₃); 8,000 IU vitamin A (from retinyl palmitate); 1,600 IU vitamin D₃ (from cholecalciferol); 30 mg vitamin E (from tocopherol acetate); 1.5 mg vitamin K₃ (from menadione); 4 mg vitamin B₁ (from thiamine hydrochloride); 13 mg vitamin B₂ (from riboflavin); 20 mg vitamin B₃ (from nicotinamide); 15 mg vitamin B₅ (from calcium d-pantothenate); 6 mg vitamin B₆ (from pyridoxine hydrochloride); 0.15 mg vitamin B₇ (from biotin); 1.5 mg vitamin B₉ (from folic acid); 0.02 mg vitamin B₁₂ (from cobalamin).

²GE = gross energy

Laying performance and egg quality

Daily egg weights and egg production were recorded for the entire length of the study. The day laying rate and hen-housed egg laying rate per day were calculated by dividing the total number of eggs by the number of laying hens and the total number of hens housed, respectively. The feed intake and feed-to-egg ratio were recorded and calculated weekly. Prior to the trial and during weeks 2, 4, 6, 8, 10, and 12, two eggs per replicate were randomly selected to assess the egg qualities. Eggs were analyzed for the shell strength and thickness using a texture analyzer (model EFG-0503; Robotmation, Tokyo, Japan) and an ultrasonic gauge (model ETG-1061; Robotmation), respectively. Egg yolk pigmentation and the Haugh unit were evaluated using a multifunction egg quality analyzer (model EMT-520; Robotmation). The value indices for the eggshell, albumen, and yolk were calculated based on their ratios to the total egg weight. We collected and mixed two yolks per replicate at week 12 to analyze the elemental contents of the yolks.

Sample collection

An indigestible exogenous indicator of a 0.5 % chromium oxide marker (Cr₂O₃) was added to the feed to evaluate the apparent total tract digestibility (ATTD) of the nutrients (An and Kong, 2023). Samples were then air-dried at 88°C for 24 h, crushed, sieved, and uniformly mixed (Wang et al., 2021).

One hen per replicate was then randomly selected for sample collection and fasted for 12 h prior to the experiment. Plasma samples were then collected from the wing vein. After euthanasia via cervical dislocation, serum samples were collected from the carotid artery. The liver, tibia, and duodenal mucosa were collected, flash frozen in liquid nitrogen, and stored at −80°C for future analysis. Plasma was collected using heparin sodium as an anticoagulant, while serum was collected without an anticoagulant. Blood samples were centrifuged at 3,500 × g and 4°C for 15 min, and the resulting supernatants (plasma and serum) were transferred to sterile microcentrifuge tubes. The levels of plasma albumin (ALB), alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), Ca, P, total cholesterol (TC), direct bilirubin (DBIL), glucose (GLU), lactate dehydrogenase (LDH), total bilirubin (TBIL), triglycerides (TG), urea (UA), the total protein (TP), and creatinine (Cr) were measured using a BK-400 fully automated biochemical analyzer (model BK-400, Shandong Bok Biotechnology Co., Ltd., Jinan, Shandong, China) and a urea nitrogen assay kit (cat. no. C013-1-1, the Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China).

The tibias were immersed in ether until all fat was removed. They were then rinsed with deionized water and dried at 105°C for 24 h in accordance with the protocol by Qiu et al. (2020). The livers and yolks were also dried at 105°C for 24 h, air-dried to a constant weight, and subsequently ground to measure the mineral content.

Sample mineral analysis

Next, 1 mL of plasma was digested in a microwave to determine the plasma concentrations of iron (Fe), manganese (Mn), copper (Cu), and Zinc (Zn), as described by Rubio et al. (2018). This was followed by inductively coupled plasma optical emission spectrometry (ICP-OES; ARCOS; SPECTRO Analytical Instruments GmbH, Kleve, Germany). The serum Na and potassium (K) levels were then measured using the same protocol as followed by Rubio et al. (2018). The serum chlorine (Cl) content was assessed using the ADS blood Cl test kit (catalog no. ADS-W-D024, the Jiangsu Addison Biotechnology Co., Ltd., Nanjing, Jiangsu, China). The methods used for the pretreatment and elemental analysis of the tibias, egg yolks, and livers were identical to those used for the plasma.

Apparent total tract digestibility

The proximate composition of the crude nutrients, ash, and energy content was analyzed following AOAC official methods (International, 1995). The elemental analysis was based on the ash content following the method of Adhikari et al. (2020). The P contents in the feed and excreta samples were determined using a spectrophotometer (model UV-1800, Shimadzu Corporation, Kyoto, Japan) and the ammonium vanadium molybdate colorimetric method (Ren et al., 2017). The Cl content was measured using the GB/T 6439-2023 method recommended by the China National Standard, while the chromium (Cr), Ca, Na, K, Fe, Mn, Cu, and Zn contents were analyzed using a flame atomic absorption spectrophotometer (model PinAAcle 900F, PerkinElmer, Shelton, CT, USA). The Ca and P contents in the tibias were analyzed using a flame atomic absorption spectrophotometer (PerkinElmer).

The following equations were used to calculate the ATTD and apparent metabolizable energy (AME):

ATTD (%) = [1 – (Nf / Nd) / (Cd / Cf)] × 100

AME (kcal/kg) = GE_diet – GE_excreta × (Cd/Cf), where Nf represents the nutrient concentration in the excreta (% DM); Nd represents the nutrient concentration in the diet (% DM); Cf represents the chromium concentration in the excreta (% DM); and Cd represents the chromium concentration in the diet (% DM).

The gene expression levels in the duodenum and liver were analyzed as previously described (Ren et al., 2020). The total RNA was extracted from the samples using the AG RNAex Pro Reagent (Accurate Biotechnology Co., Ltd., Changsha, Hunan, China) following the manufacturer's instructions. The concentration and purity of the extracted RNA were assessed using a NanoDrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The cDNA synthesis was conducted using the Primer Script RT Reagent Kit (TaKaRa Bio Inc., Dalian, Liaoning, China). Subsequently, the mRNA expression levels of the target genes were analyzed using the SYBR Premix Ex Taq Kit (TaKaRa Bio Inc., Dalian, Liaoning, China) and a CFX Opus 96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The primer sequences used for the real-time quantitative PCR are listed in Table 2. The relative mRNA expression levels were calculated using the 2^-ΔΔCt method with β-actin as the internal control.

Table 2.

Primer sequences used in this study.

Genes	ID	Primer (5′−3′)	Product length (bp)
TRPV5	XM_040661661.2	F: TGGAACGGACTAAGTCAGAAGTTG R: CGTTATGGCTGGGATGTTGTT	141
SLC34A2	XM_046915425.1	F: ACTGGCTTGCTGTGTTTGC R: AGGGGCATCTTCACCACTTT	113
SLC9A2	NM_001285935.3	F: GCAGATCCCCTTCGAGATCA R: CCAGCGTCGAGTACAATTGG	228
ATP1A1	NM_205521.2	F: TCCTCGCTTACTGGTGAGTCA R: AGTGCGGTCTCCAGTGCTAA	150
SLC26A9	XM_425821.7	F: CTCCTGTCAACGGGCTCTA R: GTATTCACGCTGGTCTCAT	190
SLC40A1	NM_001128102.3	F: AGCCGTTCACCACTTATTTCG R: GGTCCAAATAGGCGATGCTC	129
SLC11A2	NM_001012913.2	F: GAGACTGGGTGGACAAGAACTC R: ATGCATTCTGAACAACCAAGGA	66
SLC31A1	NM_001012913.2	F: CATCTTCAGGAGGTGGTCAT R: ACAACTCCCCTCCGTTAGCA	66
SLC30A1	XM_040673965.2	F: ATCTGCGAGTGCCTTCTTCCT R: ATGAACACTGATGGTAGCCTGGA	84
SLC39A14	XM_040689605.1	F: GTTCTGCCCCGCTGTCCT R: GGTCTGCCCTCCTCCGTCT	96
SOD2	NM_204211.2	F: GACCTGCCCTACGACTATGG R: TTGCCAGCGCCTCTTTGTAT	136
SLC30A10	XM_015283897.1	F: ATCAGATGGCACAAGGCAAACA R: GAACAGACCTACGATCCCGACA	186
β-actin	NM_205518.2	F: AATCAAGATCATTGCCCCACCT R: TGGGTGTTGGTAACAGTCCG	173

Statistical analysis

The data were analyzed using a one-way analysis of variance (ANOVA) and linear and quadratic regression analyses using IBM SPSS Statistics 26 (IBM Corp., Chicago, IL, USA). Figures were generated using GraphPad Prism 8.0 software. Results are presented as means and pooled standard errors of the means (SEM). A P < 0.05 was considered significant.

Results

Laying performance

The CP16.5 group demonstrated a superior laying performance (Table 3). The CP17.5, CP17.0, and CP16.5 groups exhibited significantly higher average daily feed intakes (ADFI, P < 0.001), total egg weights (P < 0.001), and a significantly lower feed-to-egg ratios (P < 0.001) compared to those of the CP15.5 and CP15.0 groups during the entire study duration. The ADFI and total egg weights demonstrated linear (P < 0.001) and quadratic (P < 0.001) increases with increased dietary CP levels. Conversely, the feed-to-egg ratios demonstrated linear (P < 0.001) and quadratic (P < 0.001) decreases with increased dietary CP levels. These results indicated that a reduction in the dietary CP level to 15.0–15.5 % would require additional nutritional interventions to enhance the feed conversion efficiency.

Table 3.

Effects of dietary crude protein levels on the laying performance of laying hens.

Items	Crude protein levels (%)						SEM	P-value
	15.0	15.5	16.0	16.5	17.0	17.5		ANOVA	Linear	Quadratic
Day laying rate (%)
1-6wk	89.29	91.85	90.49	90.90	90.67	85.09	0.70	0.065	0.092	0.013
7-12wk	86.91	88.47	86.97	89.68	88.48	84.36	0.80	0.504	0.548	0.270
1-12wk	88.12	90.18	88.74	90.30	89.58	84.73	0.69	0.175	0.227	0.054
Hen-housed egg laying rate (%)
1-6wk	89.29	91.01	89.80	90.59	90.67	84.81	0.73	0.127	0.133	0.039
7-12wk	86.30	87.31	85.63	87.92	86.38	83.39	0.87	0.763	0.407	0.483
1-12wk	87.81	89.19	87.74	89.27	88.55	84.11	0.74	0.371	0.221	0.137
Average daily feed intake (g)
1-6wk	108.18b	106.85b	126.04a	123.44a	123.89a	121.45a	1.47	< 0.001	< 0.001	< 0.001
7-12wk	124.19	123.12	125.04	124.23	124.99	122.72	0.56	0.809	0.828	0.690
1-12wk	116.15b	114.86b	125.52a	123.82a	124.40a	122.07a	0.86	< 0.001	< 0.001	< 0.001
Total egg weight (g)
1-6wk	23.90c	24.93c	28.83ab	29.37a	29.38a	27.81b	0.38	< 0.001	< 0.001	< 0.001
7-12wk	23.39b	23.59b	24.40b	28.00a	27.65a	26.75a	0.39	< 0.001	< 0.001	< 0.001
1-12wk	47.30c	48.52c	53.22b	57.38a	57.03a	54.56ab	0.71	< 0.001	< 0.001	< 0.001
Feed-to-egg ratio (g:g)
1-6wk	2.16	2.14	2.19	2.11	2.13	2.20	0.01	0.255	0.841	0.507
7-12wk	2.60a	2.54a	2.50a	2.14b	2.18b	2.23b	0.04	< 0.001	< 0.001	< 0.001
1-12wk	2.38a	2.34a	2.33a	2.13b	2.15b	2.21b	0.02	< 0.001	< 0.001	< 0.001
Mortality (%)
1-6wk	0.00	1.19	1.19	1.19	0.00	1.19	0.38	0.846	0.765	0.826
7-12wk	1.19	0.00	1.19	1.19	2.38	0.00	0.42	0.607	0.892	0.820
1-12wk	1.19	1.19	2.38	2.38	2.38	1.19	0.53	0.949	0.749	0.647
Percentage of unqualified eggs (%)
1-6wk	3.18	2.62	3.46	3.75	3.52	3.82	0.30	0.891	0.320	0.614
7-12wk	7.53	6.31	5.80	5.23	5.36	8.82	0.73	0.706	0.841	0.283
1-12wk	5.44	4.52	4.67	4.53	4.48	6.45	0.49	0.842	0.638	0.421

^a-c Different superscripts within a row indicate significant differences between means. (n = 7, P < 0.05).

Egg quality

The egg yolk colors were significantly increased in the high-protein groups (Table 4). The egg yolk colors in the CP17.5, CP17.0, and CP16.5 groups exhibited significant pigmentation increases (P < 0.001) compared with those of the CP15.5 and CP15.0 groups. The egg yolk colors showed linear (P < 0.001) and quadratic increases (P < 0.001) with increases in the dietary CP level, indicating that the egg yolk color was associated with the feed ingredients.

Table 4.

Effects of dietary crude protein levels on the egg quality of laying hens¹.

Items	Crude protein levels (%)						SEM	P-value
	15.0	15.5	16.0	16.5	17.0	17.5		ANOVA	Linear	Quadratic
Shell thickness (cm)	0.39	0.38	0.38	0.39	0.39	0.39	0.01	0.372	0.758	0.689
Shell strength (N)	39.50	41.70	41.50	42.50	41.10	42.50	0.38	0.202	0.071	0.057
Albumen height (mm)	7.19	7.48	7.33	7.22	7.50	7.43	0.07	0.735	0.592	0.866
Egg yolk color score	7.80c	8.10b	8.70a	8.50a	8.50a	8.40ab	0.05	< 0.001	< 0.001	< 0.001
Haugh unit2	83.43	82.43	81.43	80.43	82.11	82.70	0.61	0.742	0.800	0.802
Shell index (%)	12.02	12.14	12.30	12.59	12.30	11.86	0.66	0.473	0.569	0.750
Yolk index (%)	26.62	27.49	27.66	27.60	26.93	27.26	0.22	0.697	0.959	0.361
Albumen index (%)	56.59	57.93	58.85	59.82	58.39	57.30	0.42	0.300	0.727	0.620

^a-c Different superscripts within a row indicate significant differences between means. (n = 84, P < 0.05).

Where W represents egg weight (g), and H represents albumen height (mm).

¹Items for the entire period of the study.

²Haugh unit = 100 × log (H – 1.7 W^0.37 + 7.57).

Plasma biochemical parameters

The effects of dietary CP levels on the overall health and nitrogen metabolism of the hens are shown in Table 5. The plasma levels of uric acid in the CP15.0 group decreased by 18.45 % compared with those of the CP17.5 group. No significant changes were observed in the other plasma biochemical indicators (P > 0.05).

Table 5.

Effects of dietary crude protein levels on plasma biochemical indicators in laying hens.

Items	Crude protein levels (%)						SEM	P-value
	15.0	15.5	16.0	16.5	17.0	17.5		ANOVA	Linear	Quadratic
UA (μmol/L)1	237.43ab	292.71ab	325.86a	315.86a	206.43b	291.14ab	12.62	0.033	0.999	0.336
BUN (mmol/L)	7.84	6.99	5.70	5.10	7.20	7.96	0.40	0.207	0.935	0.048
ALB (mg/mL)	23.31	23.26	22.33	21.91	22.17	26.10	0.79	0.702	0.535	0.323
ALP (U/L)	472.00	685.43	483.86	719.71	296.86	540.29	63.51	0.437	0.657	0.799
ALT (U/L)	3.11	1.56	0.83	0.90	1.14	2.07	0.31	0.256	0.322	0.035
AST (U/L)	172.60	184.04	176.21	190.24	175.26	164.30	16.70	0.875	0.664	0.532
T-CHO (mmol/L)	3.11	2.93	2.39	2.47	2.68	2.60	0.12	0.488	0.187	0.171
DBIL (mmol/L)	1.37	1.26	0.93	1.01	0.83	1.11	0.06	0.121	0.056	0.029
GLU (mmol/L)	14.25	14.78	14.75	14.62	14.40	14.55	0.09	0.576	0.905	0.455
LDH (U/L)	180.43	179.14	170.00	167.71	164.14	142.43	7.30	0.729	0.114	0.258
TBIL (μmol/L)	1.43	1.17	1.56	1.80	2.27	2.63	0.22	0.403	0.032	0.079
TG (mmol/L)	13.44	13.79	9.39	9.67	11.53	11.52	0.67	0.280	0.243	0.149
TP (mg/mL)	56.73	56.71	53.56	53.20	52.01	45.84	1.22	0.097	0.004	0.012
Cr (μmol/L)	13.90	9.16	10.16	11.70	7.69	8.04	0.82	0.232	0.056	0.157

^{a b}Different superscripts within a row indicate significant differences between means (n = 7, P < 0.05).

¹UA, uric acid; BUN, blood urea nitrogen; ALB, albumin; ALP, alkaline phosphatase; ALT, alanine transaminase; AST, aspartate transaminase; T-CHO, total cholesterol; DBIL, direct bilirubin; GLU, glucose; LDH, lactate dehydrogenase; TBIL, total bilirubin; TG, triglycerides; TP, total protein; Cr, creatinine.

The apparent total tract digestibility of nutrients and the apparent metabolizable energy

The low-protein groups (CP15.5 and CP15.0) demonstrated a significant increase in the ATTD of the proximate nutrients compared with those of the other groups (P < 0.05), as shown in Table 6. Specifically, the ATTD values of the DM and CP in the CP15.5 and CP15.0 groups were significantly greater than those observed in the CP17.5 and CP16.5 groups (P = 0.008 and P = 0.023, respectively). The AME values were also notably increased (P = 0.003) in the CP17.5 and CP16.5 groups compared with the values of the CP17.5 and CP16.5 groups. Furthermore, the ATTD value of ash in group CP15.0 was significantly elevated compared with those of the CP17.0, CP16.5, and CP16.0 groups (P < 0.001). The ATTD values of the DM, CP, ash, and AME exhibited both linear (P < 0.05) and quadratic decreases (P < 0.05) with increased dietary CP levels. Conversely, the high-protein groups exhibited increased P digestibility (P < 0.05) and decreased Na and Cl digestibility (P < 0.05). The ATTD values of P in the CP17.5 and CP17.0 groups significantly increased (P < 0.001). The ATTD values of Na and Cl in the CP15.5 group was significantly greater than that in the CP17.0 and CP16.5 groups (P < 0.001; P = 0.049). These findings indicated that a reduction in the dietary protein level enhanced the protein digestibility; however, the effects of the dietary protein level on mineral digestibility were inconsistent.

Table 6.

Effects of dietary crude protein levels on apparent total tract digestibility of nutrients in laying hens.

Items (%)	Crude protein levels (%)						SEM	P-value
	15.0	15.5	16.0	16.5	17.0	17.5		ANOVA	Linear	Quadratic
DM1	76.79a	77.82a	75.25ab	72.05b	74.96ab	73.28b	0.48	0.008	0.003	0.009
CP	56.53a	57.11a	50.24ab	47.33b	51.64ab	48.77b	1.06	0.023	0.006	0.011
EE	93.89	89.99	90.08	90.54	90.43	89.46	0.54	0.168	0.967	0.348
Ash	52.20a	48.80ab	47.07ab	28.21c	42.20b	43.44ab	1.63	<0.001	0.012	0.001
AME	3001.63a	3026.75a	2998.21a	2869.16c	2978.93ab	2905.78bc	14.20	0.003	0.008	0.031
Macro-minerals
Ca	63.32a	62.37a	48.45b	38.37c	59.84a	54.74ab	1.87	< 0.001	0.115	0.003
P	31.98c	36.42bc	24.36c	47.96ab	60.38a	51.24a	2.50	< 0.001	< 0.001	< 0.001
Na	70.34ab	77.17a	66.87b	51.31c	67.45b	69.62ab	1.60	< 0.001	0.143	0.021
K	29.99	39.38	29.53	31.49	31.01	37.10	1.41	0.213	0.674	0.742
Cl	65.02ab	70.61a	66.29ab	59.22b	59.36b	64.95ab	1.23	0.049	0.102	0.215
Trace elements
Fe	36.38abc	35.23bc	41.31ab	44.74a	44.91a	31.26c	1.41	0.014	0.815	0.019
Mn	36.33c	45.51a	37.31bc	35.74c	44.65ab	45.98a	1.21	0.009	0.075	0.114
Zn	34.95cd	46.92ab	40.77bc	30.92d	53.35a	43.98b	1.59	< 0.001	0.095	0.246
Cu	35.63bc	57.37a	44.84b	26.62cd	40.65b	23.37c	2.20	< 0.001	0.003	0.002

^a-dDifferent superscripts within a row indicate significant differences between means (n = 7, P < 0.05).

¹DM, dry matter; CP, crude protein; EE, ether extract; AME, apparent metabolizable energy.

Macro-mineral deposition in plasma, serum, and tibia

High-protein diets enhanced the deposition of Ca and P in the tibias (P < 0.05, Table 7). The CP17.5 group exhibited significantly increased Ca and P contents in the tibias (P = 0.033 and P = 0.039). The Ca and P contents of the tibias exhibited linear (P < 0.001 and P = 0.016) and quadratic (P = 0.004 and P = 0.048) increases with increased dietary CP levels.

Table 7.

Effects of dietary crude protein levels on macro-mineral content in the plasma, serum, and tibia of laying hens.

Items	Crude protein levels (%)						SEM	P-value
	15.0	15.5	16.0	16.5	17.0	17.5		ANOVA	Linear	Quadratic
Plasma
Ca (mmol/L)	5.23	5.20	5.03	5.11	5.10	4.94	0.05	0.612	0.105	0.273
P, (mmol/L)	2.25	2.04	1.80	1.78	1.86	1.97	0.07	0.320	0.156	0.052
Serum
Na (g/L)	2.73	2.83	2.74	2.74	2.69	2.61	0.03	0.347	0.216	0.321
K (g/L)	0.22	0.23	0.21	0.21	0.32	0.24	0.02	0.667	0.426	0.727
Cl (g/L)	7.86	7.14	7.07	7.16	7.06	6.52	0.14	0.190	0.018	0.062
Tibia
Ca (g/kg)	164.95b	161.91b	179.03ab	184.59ab	195.97a	194.90a	3.96	0.033	< 0.001	0.004
P (g/kg)	77.25b	77.12b	91.64ab	79.22b	83.89ab	98.30a	2.44	0.039	0.016	0.048

^ab Different superscripts within a row indicate significant differences between means (n = 7, P < 0.05).

Deposition of trace elements in the plasma, livers, and egg yolks

High-protein diets increased the Zn contents in egg yolks (P < 0.05, Table 8) and increased the Mn contents in the livers (P < 0.05) and egg yolks (P < 0.05) under low-protein conditions. The Mn contents were significantly greater in the livers and egg yolks of the CP15.5 and CP15.0 groups than in those in the CP17.5, CP17.0, and CP16.5 groups (P < 0.05). Conversely, the Zn contents in the egg yolks of the CP17.5 and CP17.0 groups were significantly greater than that in the egg yolks of the CP15.0 group (P = 0.046). The Mn contents in the livers and egg yolks demonstrated linear (P < 0.001) and quadratic decreases (P < 0.001) with increased dietary CP levels, while the Zn contents in the egg yolks exhibited linear (P = 0.002) and quadratic increases (P = 0.010). The Mn deposition showed a significant decrease with increasing dietary CP levels (P < 0.05), and this was markedly different from the trends of the other mineral elements.

Table 8.

Effects of dietary crude protein levels on trace mineral content in the plasma, liver, and egg yolk of laying hens.

Items	Crude protein levels (%)						SEM	P-value
	15.0	15.5	16.0	16.5	17.0	17.5		ANOVA	Linear	Quadratic
Plasma
Fe (mg/mL)	11.46	12.50	10.65	12.22	11.59	16.06	0.73	0.330	0.058	0.070
Mn (mg/mL)	129.88	118.43	128.94	80.58	145.67	179.47	12.23	0.317	0.041	0.060
Cu (mg/L)	284.53	260.42	140.68	162.25	257.58	199.78	23.67	0.409	0.755	0.738
Zn (mg/mL)	6.51	6.21	7.98	8.43	7.08	9.57	0.49	0.363	0.088	0.215
Liver
Fe (mg/kg)	520.57	498.56	456.65	545.26	543.97	512.78	13.83	0.466	0.519	0.761
Mn (mg/kg)	37.21a	35.81a	29.30b	27.76bc	23.69c	17.71d	1.26	< 0.001	< 0.001	< 0.001
Cu (mg/kg)	9.89	8.92	8.06	8.96	8.73	9.03	0.23	0.364	0.399	0.156
Zn (mg/kg)	94.30	88.33	86.14	93.05	90.87	89.24	1.97	0.869	0.749	0.862
Egg yolk
Fe (mg/kg)	333.32	342.79	340.65	337.20	384.53	376.17	6.32	0.060	0.008	0.022
Mn (mg/kg)	43.86a	43.09a	38.47b	35.61c	33.76c	31.05d	0.81	< 0.001	< 0.001	< 0.001
Cu (mg/kg)	2.45	2.29	2.49	2.57	3.47	2.95	0.13	0.075	0.017	0.057
Zn (mg/kg)	63.87b	69.71ab	70.41ab	69.55ab	79.60a	77.94a	5.63	0.046	0.002	0.010

^a-d Different superscripts within a row indicate significant differences between means (n = 7, P < 0.05).

Relative mRNA expression of nutrient transporters in the duodenum mucosa

The CP17.5 group exhibited elevated expression levels of mineral transporters in the duodenal mucosa (Fig. 1, P < 0.05). The mRNA expression of the solute carrier family 34 member A2 (SLC34A2), the solute carrier family 9 member A2 (SLC9A2), and the Na⁺/K⁺-ATPase α1 subunit (ATP1A1) exhibited significant linear (P < 0.05) and quadratic increases (P < 0.05) with higher dietary CP levels. These results demonstrated that intestinal absorption and the transport of certain minerals were significantly enhanced under high-protein dietary conditions.

Fig. 1.

The effects of dietary crude protein levels on the relative mRNA expression of nutrient transporters. (A) Relative mRNA expression of TRPV5, (B) SLC34A2, (C) SLC9A2, (D) ATP1A1, (E) SLC26A9, (F) SLC40A1, (G) SLC11A2, (H) SLC31A1, and (I) SLC30A1. TRPV5 = Transient Receptor Potential Cation Channel Subfamily V Member 5; SLC34A2 = Solute Carrier Family 34 Member A2; SLC9A2 = Solute Carrier Family 9 Member A2; ATP1A1 = ATPase Na⁺/K⁺ Transporting Subunit Alpha 1; SLC26A9 = Solute Carrier Family 26 Member A9; SLC40A1 = Solute Carrier Family 40 Member A1; SLC11A2 = Solute Carrier Family 11 Member A2; SLC31A1 = Solute Carrier Family 31 Member A1; SLC30A1= Solute Carrier Family 30 Member A1.

^a-c Different letters indicate statistical significance (n = 7, P < 0.05).

Relative mRNA expression of manganese-related genes in the livers

The Mn contents decreased in the livers and egg yolks with increased dietary CP levels; hence, we examined the expression of manganese-related genes in the livers (Fig. 2). The superoxide dismutase 2 (SOD2) expression showed a significant decrease with increasing dietary CP levels (P = 0.069). The SOD2 mRNA expressions in the CP15.5 and CP15.0 groups were greater than that in the CP17.5 group (P = 0.069). The SOD2 mRNA expressions showed both linear (P = 0.001) and quadratic (P = 0.005) decreases with increased dietary CP levels. These results indicated that Mn absorption and utilization were enhanced under low-protein conditions.

Fig. 2.

Effects of dietary crude protein levels on relative mRNA expression of manganese-associated genes. (A) The relative mRNA expressions of SOD2, (B) SLC30A10, (C) SLC40A1, (D) SLC11A2, and (E) SLC39A14. SOD2 = Superoxide Dismutase 2; SLC30A10 = Solute Carrier Family 30 Member A10; SLC40A1 = Solute Carrier Family 40 Member A1; SLC11A2 = Solute Carrier Family 11 Member A2; SLC39A14 = Solute Carrier Family 39 Member A14 (n = 7).

Discussion

Low-protein diets can be a strategic feeding approach in the modern livestock industry (Such et al., 2021; Hu et al., 2022). Current studies regarding low-protein diets have primarily focused on the nitrogen-metabolism equilibrium (Strifler et al., 2023; Loongyai et al., 2019); however, in the practical livestock industry, it is necessary to consider not only the nitrogen balance, but also the compatibility of other nutrients (such as minerals) under low-protein diets. Changes in the feed ingredients of low-protein diets result in significant alterations in both the total mineral content and bioavailability (Loongyai et al., 2019; Poosuwan et al., 2010). In addition, nitrogen metabolism and mineral nutrition are intricately linked, with bidirectional regulation occurring via molecular, cellular, and enzymatic pathways (Conigrave et al., 2008; Woloshun et al., 2022). In this study, we systematically examined the effects of graded dietary CP levels on mineral digestion, absorption, and tissue deposition in laying hens. Our results showed that a 16.5 % CP maintained the production performance, while a 15.0–15.5 % CP improved the digestibility of nutrients, enhanced protein utilization, reduced nitrogen excretion, and promoted Mn absorption, utilization, and deposition. These results suggested that it is necessary to optimize the standards used to formulate low-protein diets (Fig. 3).

Fig. 3.

Responses of laying performance and mineral metabolism to dietary crude protein levels in laying hens. In this study, we examined the effects of dietary CP levels on the laying performance of laying hens. We also investigated the effects of dietary CP levels on mineral nutrition, including digestibility, duodenal absorption, and tissue deposition, to elucidate the correlation and potential mechanisms linking dietary CP levels with mineral utilization.

The key production parameters ultimately reflected the efficacy of these optimized low-protein diets. Contrary to the common viewpoint, low-protein diets do not necessarily lead to increased feed intake. This misconception is often attributed to insufficient levels of specific amino acids such as lysine and the total sulfur amino acids (Bartov, 1979; Hurwitz et al., 1998). The findings of this study indicated that the low-protein group did not show a compensatory increase in the feed intake. This result agreed with results obtained in previous studies and demonstrated that low-protein diets in laying hens reduced the feed intake while simultaneously increasing the feed-to-egg ratio. These results showed a significant negative correlation with the dietary CP levels (Novak et al., 2006; Liu et al., 2024b; Zhang et al., 2024). The feed-to-egg ratio in the CP16.5 group approached the result reported by Liu et al. (2024a). In this study, the laying performance of the CP16.5 group did not significantly differ from that of CP17.5, suggesting that adjustments in the dietary CP level within an appropriate range and would ensure an adequate supply of essential amino acids to optimize the laying performance. The development of practical strategies would aid in sustaining the laying performance in hens administered low-protein diets (15.0–15.5 % CP).

The primary sources of egg yolk color are the carotenoids contained in corn (Wang et al., 2021). These carotenoids, which cannot be synthesized within the avian body, must be primarily obtained from the diet (Wang et al., 2021). Previous studies have demonstrated that the egg yolk color is significantly altered by varying the corn and corn gluten meal levels in poultry feed (Torki et al., 2015; Wu et al., 2007), consistent with the results of our present study

Low-protein diets also modulate metabolic pathways related to nitrogen utilization in addition to influencing the egg quality. Strifler et al. (2023) demonstrated that the uric acid excretion levels, a byproduct of purine breakdown, were reduced in the feces of broilers subjected to decreased dietary CP levels. Our results showed that despite a lack of direct measurement of the fecal levels of uric acid, the low-protein diet, having 15.0 % dietary CP, enhanced CP digestion. This led to a decreased generation of uric acid (a nitrogenous waste having low solubility) and diminished nitrogenous waste.

Nutrient metabolism is a highly interconnected system, and dietary CP levels have a broader impact on the digestion of various nutrients, beyond just protein itself (Pezeshki et al., 2016; Champeil-Potokar et al., 2021). Increased ATTD has been shown in previous studies to produce benefits in broiler chicken growth and development. (Dong et al., 2023; Melo-Durán et al., 2021). Increased ATTD is a crucial indicator of nutrient balance. Previous studies have shown that the effects of low-protein diets on broiler chickens result in reductions in the dietary protein levels and enhance intestinal nutrient digestion and absorption, thereby improving ATTD (Dong et al., 2023). These results agree with the results of our study. Digestibility can be used to assess poultry mineral requirements. Our results demonstrated that high-protein diets enhanced the P digestibility but reduced the CI digestibility compared with the effects of low-protein diets on the digestibility of these minerals. Low-protein diets universally influence the P digestion efficiency in animals (Xue et al., 2016; Wei et al., 2021; Shili et al., 2019). Wei et al. (2021) found that lowering CP in the diets of dairy cows increased the P digestibility. Shili et al. (2019) demonstrated that reducing the dietary CP from 24 to 13 % enhanced the Ca and P digestibility in weaned piglets, and they attributed this result to the breakdown of phytic acid and the release of bound minerals by phytase that is present at 400 FTU/kg in low-protein diets. The results of our present study agreed with results of Xue et al. (2016) who observed that dietary CP levels were positively correlated with P digestibility in broiler chickens. Current studies have not revealed a consistent pattern in the effects of dietary CP on mineral digestibility; hence, further research is required to elucidate the precise biological mechanisms involved in this process.

ATTD provides a macroscopic assessment of the mineral absorption efficiency in the gastrointestinal tract. The underlying mechanisms that govern mineral uptake and transcellular transport are partially mediated by transporters. The duodenum is enriched in mineral transporters that are responsible for mineral absorption (Liao et al., 2017). Consequently, we examined the mineral transporter gene expressions to investigate the impact of the dietary CP levels on mineral transport and absorption efficiency. NaPi-IIb (SLC34A2) facilitates P transport across the apical membranes of intestinal epithelial cells, and it is predominantly expressed in the small intestine (particularly in the duodenum) and plays a dominant role in active P transport (Li et al., 2012; Hu et al., 2018). Previous studies have shown that intestinal P transport requires NaPi-IIb mRNA expression (Li et al., 2012). Our data indicated that the CP17.5 group showed an enhanced P uptake efficiency, and this was associated with the highest SLC34A2 expression. This finding agreed with the results obtained by Xue et al. (2016) that demonstrated that reduced dietary protein levels downregulated the NaPi-IIb gene expression, thereby impairing the intestinal P absorption efficiency and digestibility. Na⁺/H⁺ exchanger-2 (NHE2) encoded by SLC9A2 primarily mediates the exchange of extracellular Na⁺ and intracellular H⁺. NHE2 has been found to be highly expressed in the duodenum, and its expression level is sensitive to Na⁺ and H⁺ concentrations (Jiang et al., 2019; Toriano et al., 2011). ATP1A1 is also highly expressed in the duodenum and is responsible for actively pumping Na out of and K into the cell, thereby establishing and maintaining the concentration gradients (Araujo et al., 2022). In our study, adequate levels of dietary CP upregulated the gene expressions that encode P, Na, and K transporters. Additionally, our data showed a negative correlation between the dietary CP levels and Na digestibility, and this contradicted the positive correlation between dietary CP levels and Na transporters. This discrepancy may have been due to the intricate regulatory mechanisms that underlie Na absorption (Charoenphandhu et al., 2017). Further research is required to elucidate the molecular mechanisms that govern Na⁺ and K⁺ transport under low-protein diets.

Mineral deposition in tissues and organs can serve as a proxy for their bioavailability (Dao et al., 2023). Hence, we next quantified the Ca and P deposition in bone to further investigate mineral bioavailability changes. As the primary physiological reservoir for Ca and P, the Ca and P levels in bone serve as direct measures of Ca and P metabolism and utilization (Shao et al., 2019). Kerstetter et al. (2003) found that low-protein diets elevated the levels of calcium-regulating hormones, such as PTH and calcitonin, while they suppressed the production of bone health-related insulin-like growth factor-1, ultimately leading to bone degradation. This finding agreed with the results reported by Pirzado et al. (2021). They demonstrated that an increase in dietary CP levels from 19 to 21.5 % significantly enhanced Ca deposition in the tibias of broilers. In our present study, Ca and P depositions in the tibias were enhanced. These findings suggest that elevated dietary CP levels promote the improved deposition of Ca and P in bone. These findings also suggest that low-protein diets would necessitate the careful monitoring of Ca and P loss in bone.

The liver serves as the primary organ for mineral storage, with notably high element deposition (Aydemir et al., 2018) similar to that of egg yolks (Hopcroft et al., 2020). Mineral deposition in the liver and egg yolks is a sensitive indicator in animals of trace element demand and utilization (Kilicalp et al., 2005; Ullah et al., 2024; Afshar Bakeshlo et al., 2024). In our present study, the Mn deposition in the livers and egg yolks decreased, while that of Zn in eggs increased with increased dietary CP levels. The opposite pattern of changes in the Mn deposition was observed in mice, in which the dietary CP levels were positively correlated with the Mn deposition in the liver (Kilicalp et al., 2005). These discrepancies may have been due to both dietary variations and physiological specificities inherent to mice and birds. Hepatic Mn deposition significantly decreased with increasing dietary CP levels; hence, we hypothesized that CP may influence the mechanisms involved in Mn homeostasis maintenance. To test this hypothesis, we examined the Mn transporter expression and the expression of manganese-dependent SOD2 that is involved in clearing reactive oxygen species. The Mn content in the liver was increased in the CP15.0 group, and our results demonstrated that the Mn utilization and the SOD2 expressions were also increased in the CP15.0 group. This result was consistent with our previous finding. These findings indicated that dietary CP level modulations can enhance the mineral utilization efficiency. However, the precise molecular mechanisms that underlie the relationship between the dietary CP levels and mineral deposition warrant further investigation.

In this study, we systematically investigated the correlation between dietary CP levels and mineral metabolism to provide a theoretical basis for the formulation and application of low-protein diets. However, the metabolic network of minerals in organisms is very complex, and there exist potential antagonistic or synergistic interactions among these minerals. Therefore, this study is only a preliminary step in the elucidation of these metabolic mechanisms. Subsequent research will need to focus on investigating the requirements for both macro and trace minerals under low-protein conditions to establish precise nutritional standards for minerals in low-protein diets. The aim of these studies will be to provide a scientific reference for the practical application of low-protein diets and the development of animal nutritional supplements.

Conclusion

In summary, dietary CP levels significantly affected the laying performance and mineral deposition and utilization in laying hens. The groups administered 16.5 % CP showed optimal laying performances. Reduction in the dietary CP to 15.0–15.5 % enhanced protein digestion and Mn utilization and deposition but compromised the laying performance. Our results suggested that further reductions in dietary CP levels would necessitate a reassessment of the nutrient requirements under low-protein diets. This study not only elucidated the correlation between dietary CP levels and mineral nutrition, but also provided a scientific foundation to advance the animal nutritional supplement industry.

CRediT authorship contribution statement

Xinyi Zhang: Writing – original draft, Software, Investigation, Formal analysis, Data curation. Aoze Wang: Writing – review & editing. Wanting Zhao: Writing – review & editing. Shutong Wang: Writing – review & editing. Jiayi Shi: Data curation. Yang Liu: Methodology. Zhuting Chen: Writing – review & editing. Qinyi Zhan: Methodology, Formal analysis. Yanli Liu: Supervision, Project administration. Xin Yang: Supervision, Project administration. Zhouzheng Ren: Supervision, Resources, Project administration, Funding acquisition. Xiaojun Yang: Resources, Funding acquisition.

Disclosures

We declare that we have no financial and personal relationships with other people or organizations that could have inappropriately influenced our work, and there is no professional or other personal interest of any nature or kind in any product.