Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2025 Nov 4;15:38477. doi: 10.1038/s41598-025-23607-6

Effect of zinc oxide or selenium nanoparticles on body weight, growth related genes and physiology in Baladi goats

Ibrahim M Farag 1,, Wael M Aboulthana 2, Shimaa M Ali 3, Mohamed I El Sabry 4, Mahmoud Y Mohamed 3, Mahmoud E Abd El-Aziz 5, Mariam G Eshak 1, Wagdy K B Khalil 1, Hayam Mansour 1,
PMCID: PMC12586602  PMID: 41188585

Abstract

Enhancing meat production is essential to meet the rising global demand for animal protein, improve food security, and support sustainable agriculture. This study evaluated the effects of zinc oxide (ZnO) and selenium (Se), each administered individually in conventional or nanoparticle (NP) forms on growth of Egyptian Baladi goats. Twenty-two pregnant Egyptian Baladi goats were divided into five groups, each receiving a different treatment via drinking water: 150 mg ZnO, 15 mg ZnO-NPs, 0.3 mg Se, or 0.03 mg Se-NPs. The control group received unsupplemented water. Treatments began 30 days before parturition and continued until weaning (90 days postpartum). Body weight, expression of GH, IGF-1, and leptin genes, along with physiological parameters, were evaluated. Goats receiving either ZnO-NPs or Se-NPs had significantly higher body weights at parturition and greater weight gain from birth to weaning than those in the conventional elements and control groups. Suckling kids from ZnO-NP or Se-NP-treated goats showed significantly higher birth and weaning weights, total body gain, and daily weight gain (P < 0.001), particularly in the ZnO-NP group. Gene expression analysis revealed upregulated GH and IGF-1 and leptin expression in ZnO-NP- and Se-NP-treated goats, with the highest levels observed in the Se-NPs group. Physiological analysis showed protein and esterase isoenzyme pattern changes in ZnO-treated goats, while Se caused no alterations. Neither ZnO nor Se affected catalase, peroxidase or α-amylase activity. These findings highlight the potential of ZnO-NPs and Se-NPs as effective and safe nutritional supplements for improving livestock productivity.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-23607-6.

Keywords: Zinc oxide nanoparticles, Selenium nanoparticles, Baladi goats, Body weight, Gene expression, Physiological parameters

Subject terms: Transcriptomics, Carbohydrates, Enzymes, Isoenzymes, Proteins, Proteomics, Animal biotechnology, Biochemical assays, Reverse transcription polymerase chain reaction, Nanoparticles, Proteomic analysis

Introduction

Goats play a vital role in Egyptian agriculture, providing essential sources of meat and milk. The total goat population in Egypt is estimated at approximately 4.13 million heads, with the Baladi breed representing nearly 37% of this population. Baladi goats are widely distributed across the Nile Valley and Delta regions and are well-adapted to diverse environmental conditions. They play a significant role in smallholder farming systems, contributing to both meat and milk production in rural communities1. The economic viability of goat meat production is directly linked to body weight, which serves as a crucial metric for evaluating animal value and optimizing breeding programs2. Meat production traits result from a complex interplay of genetic and non-genetic factors, with nutrition playing a significant role3.

Recent advancements in nanotechnology have introduced the use of nanoparticles, such as ZnO-NPs and Se-NPs, as feed supplements to enhance production traits and promote growth rates in livestock. Although several studies have demonstrated the effectiveness of nanoparticles in improving growth performance in pigs4 and rabbits5, their impact in goat remains underexplored. In particular, no data are available on their influence on the expression of key growth-related genes. However, studies in goats and other animals have shown that nanoparticles can modulate the expression of genes related to various biological functions6,7.

Despite these potential benefits, metal nanoparticles may also pose risks by disrupting cellular homeostasis, causing DNA damage, and interfering with protein function8. Electrophoretic techniques serve as essential tools for detecting such alterations, allowing the assessment of DNA and protein variations and contributing to the understanding of their biological roles9.

Genetic factors are particularly significant as they govern various growth-related traits, including body weight, and shape phenotypic expression. Identifying these genetic factors is essential for effective herd management and breeding strategies. Key genes associated with growth regulation and development, and consequently body weights in farm animals include growth hormone (GH), insulin-like growth factor-1 (IGF-1), and leptin10.

The GH gene is a key regulator of growth and production traits in various livestock species, including goats11,12. Growth hormone encoded by GH gene stimulates body growth by promoting amino acid uptake and protein synthesis13. The insulin-like growth factor 1 hormone, encoded by the IGF-1 gene, is a structurally related protein that plays a critical role in cell proliferation, differentiation, metabolism regulation, embryogenesis, and overall growth. In goats, the IGF-1 gene has been shown to significantly influence growth across different breeds1416. Owing to its pivotal role in regulating growth processes, IGF-1 has also been established as a valuable genetic marker for improving live weight and meat production in farm animals10,13. The third gene that play essential role in growth is leptin gene which encode leptin hormone. This gene and its hormone are responsible for regulating energy balance, feed intake, body weight, reproduction, and immune responses17,18.

Although the Egyptian Baladi goat is one of the most prominent purebred Egyptian breeds and is renowned for the quality and flavour of its meat, making it a valuable resource for livestock production, research into improving meat production in these goats remains scarce. The application of nanotechnology in livestock production has gained growing interest to enhance productivity in species such as goats, cattle, buffaloes, and sheep. In this context, the present study aims to evaluate the effect of ZnO-NPs or Se-NPs on body weight, growth-related gene expression (GH, IGF-1, and leptin), and physiological performance in Egyptian Baladi goats.

Materials and methods

Experimental animals

Twenty-two pregnant Baladi goats were used in this study, starting 30 days before their expected parturition, and were housed at the Animal Production Research Institute, Agricultural Research Center, Sids City, Beni Suef Governorate, Egypt. All experiments were performed in accordance with relevant guidelines and regulations and were approved by the Institutional Animal Care and Use Committee of the National Research Centre, Egypt (Ethical approval No. 13050410-2).

Preparation of nanoparticles

ZnO-NPs were synthesized by refluxing 3.942 g of zinc acetate (Sigma Aldrich, St. Louis, USA) in 1 L of ethanol containing 1.44 g of NaOH (El-Gomhouria Co., Cairo) for 2 h at 70 °C. Following reflux, deionized water was added, and the mixture was centrifuged at 7000 rpm for 10 min. The resulting fine white powder was then calcined at 500 °C for 2 h to yield ZnO-NPs19. Se-NPs were prepared by dissolving 30 mg of sodium selenate (Na2SeO3·5 H2O, Sigma Aldrich, St. Louis, USA) in 90 ml of double-distilled water. To this solution, 10 ml of ascorbic acid solution (56.7 mM) was added dropwise while stirring vigorously. Polysorbate was added to a ratio of 0.01 ml to 2 ml of ascorbic acid. The successful synthesis of Se-NPs was confirmed by a visible color change from white to red20.

Animal diet and sample collection

The goats were randomly divided into five groups (Table 1). Treatments were administered daily in 50 ml of drinking water and continued until weaning at 90 days postpartum.

Table 1.

Experimental animal groups.

Group Number of animals Treatment
1 4 150 mg of conventional ZnO
2 5 15 mg of ZnO-NPs
3 4 0.3 mg of conventional Se
4 5 0.03 mg of Se-NPs
5 4 Unsupplemented drinking water

During the experimental period, which included parturition and lactation, body weights were recorded biweekly in the morning before feeding and drinking. Survival rates and feed intake were documented weekly, and body weight change was calculated by subtracting the initial weight (30 days prepartum) from the weight at weaning. At the end of the experiment, blood samples were collected from the jugular vein of all 22 goats in the morning before feeding to assess the expression of genes (GH, IGF-1, and leptin) associated with meat production and to perform physiological analysis.

RNA extraction

RNA was extracted from blood samples of both control and treated animals, using TRIzol® Reagent (Invitrogen, Germany). RNA purity (A260/A280 ratio: 1.8–2.1) was assessed using a NanoDrop spectrophotometer, and integrity were confirmed by agarose gel electrophoresis. Total RNA was treated with 1 U of RQ1 RNAse-free DNAse (Invitrogen, Germany) to digest DNA residues.

Reverse transcription reaction

cDNA synthesis was performed using the RevertAid™ First Strand cDNA Synthesis Kit (MBI Fermentas, Germany) with 5 µg RNA in a 20 µL reaction. The reaction included 50 mM MgCl2, 5x reverse transcription buffer, 10 mM of each dNTP, 50 µM oligo-dT primer, 20 U ribonuclease inhibitor, and 50 U M-MuLV reverse transcriptase. The reaction was conducted in a thermocycler (Biometra GmbH, Göttingen, Germany) at 25 °C for 10 min, followed by 42 °C for 1 h.

Quantitative real time PCR (qRT-PCR)

Gene expression levels were quantified using the StepOne™ Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). Each qRT-PCR reaction was prepared in a total volume of 25 µL, including SYBR® Premix Ex Taq™ (TaKaRa, Biotech Co. Ltd.), 0.2 µM forward primer, 0.2 µM reverse primer, and 5 µL of cDNA template. The thermal cycling conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s. Melting curve analysis was performed from 60 °C to 95 °C, with increments of 0.5 °C every 10 s. Relative gene expression levels were determined using the 2−ΔΔCT method. The primer sequences for the target genes are listed in Table 2.

Table 2.

Primer sequences used for qRT-PCR analysis of growth-related genes in goats.

Gene symbol GenBank accession Primer sequences (5′-3′) References
GH NM_001285586.1

F: GGCCCAGCAGAAATCAGACT

R: CTTGAGCAGCGCGTCGTCAC

21
IGF-1 NM_001285697.1

F: TCGCATCTCTTCTATCTGGCCCTGT

R: GCAGTACATCTCCAGCCTCCTCAGA

22
Leptin XM_018046968.1

F: GCCTATGTGGGCATCCTTTA

R: TGGAACAGGGAGGAAGACTG

23
GAPDH XM_005680968.3

F: ATCAAGTGGGGTGATGCTGG

R: GGCGTGGACAGTGGTCATAA

24

Determination of total protein concentration

Plasma samples from each group were pooled by combining equal volumes from individual specimens into a single tube for analysis. The total protein concentration in the pooled samples was quantified using the Bradford method. To ensure consistent protein loading during electrophoretic assays, all samples were adjusted to equal concentrations by diluting them with loading dye.

Native electrophoretic protein patterns

Native proteins were separated using Polyacrylamide Gel Electrophoresis (PAGE) and then stained with different dyes to visualize specific components. Coomassie Brilliant Blue (CBB) was used to visualize protein bands, appearing as blue bands. Sudan Black B (SBB) was employed to detect lipid components, which appeared as black bands. Alizarin Red (S) was utilized to identify calcium moieties, visualized as yellow bands, while Schiff’s reagent was used to detect carbohydrate moieties, appearing as pink bands.

Native electrophoretic isoenzyme patterns

The electrophoretic patterns of Catalase (CAT) and Peroxidase (POX) were analyzed by incubating gels with hydrogen peroxide (H2O2) as a substrate. CAT isoforms were visualized as yellow bands following potassium iodide (KI) staining, while POX isoforms appeared as brown bands after benzidine staining. The α-amylase (α-Amy) pattern was assessed by incubating the native gel with a soluble starch solution, followed by iodine staining, which produced yellow α-Amy bands. Esterase (EST) isoenzymes were analyzed by incubating the gel in a conditioning buffer to optimize enzyme activity, followed by staining with a reaction mixture containing Fast Blue RR dye and α- or β-naphthyl acetate as substrates α-EST isoforms appeared as brown bands, while β-EST isoforms appeared as pink bands.

Statistical analysis

Body weight data were expressed as mean ± SEM. A two-way repeated measures ANOVA was performed to evaluate the effects of treatment, time, and their interaction on body weight and growth parameters. Percentage values were arcsine-transformed before analysis and back-transformed for presentation. Data were analyzed using the Generalized Linear Model (GLM) procedure in SAS software version 9.2 (SAS Institute Inc., Cary, NC)25, and treatment means were compared using Tukey’s test at a significance level of P < 0.05.

Gene expression data were analyzed using the GLM procedure of SAS software version 9.2, followed by Scheffé’s test to determine significant differences among groups. Results are presented as mean ± SEM, with significance set at P < 0.05.

For physiological parameters, PAGE plate images were captured and analyzed using Quantity One software (Version 4.6.2) to determine relative mobility (Rf), quantity (Qty), and percentage contribution (B%) of protein bands. The similarity index (SI%) was calculated according to the method of Nei and Li26.

Results

Characterization of prepared zinc oxide and selenium nanoparticles

Transmission Electron Microscopy (TEM) images of the synthesized ZnO-NPs and Se-NPs are shown in Fig. 1A, B, respectively. The ZnO-NPs had particle sizes of less than 100 nm (Fig. 1A), while the Se-NPs exhibited particles smaller than 50 nm (Fig. 1B). According to the Joint Committee on Powder Diffraction Standards (JCPDS) file format, the X-ray Diffraction (XRD) pattern of ZnO-NPs and Se-NPs is displayed in Fig. 1C. For ZnO-NPs, the configuration with planes at (100), (002), (102), and (110) are corresponding to peaks at 2θ = 32°, 34.4°, 36.4°, 47.7°, and 56.7°. For Se-NPs, the XRD diffraction peaks matched the pure hexagonal phase of selenium crystals with reflections at (100), (101), (111), (201), (003), and (210) that observed at 2θ = 23.9°, 30.0°, 45.7°, 52.0°, 55.9°, and 65.5°.

Fig. 1.

Fig. 1

The TEM image of (A) ZnO-NPs and (B) Se-NPs as well as their XRD pattern (C).

Body weight evaluation of treated goats and their suckling kids

Mother Goats that received ZnO-NPs and Se-NPs from 30 days prepartum to the weaning of their offspring at 90 days postpartum exhibited significantly higher live body weights (LBW) and had significantly (P < 0.01) higher overall mean body weight than those of conventional element groups, while the control group showed the least weights. It is of interest to note that the LBW of ewes significantly (P < 0.05) showed a sharp reduction immediately after parturition and then a slight reduction up to 90 d postpartum in terms of LBW loss or as a percentage of change in LBW. The effect of interaction between treatments and experimental time was insignificant (P > 0.05) on the LBW of goats and was significant (P < 0.05) in BW loss and BW change, reflecting higher LBW of goats in NPs groups than in conventional elements and control groups at all experimental times (Table 3).

Table 3.

Impact of zinc oxide or selenium nanoparticles on body weight and growth performance of Baladi mother goats.

Items Day post -parturition Experimental groups ± Standard error
Control ZnO Se ZnO-NPs Se-NPs TR D TR×D
Live BW (kg) − 30 34.00 34.25 34.25 34.20 34.60 0.277*** 0.266*** 0.620ns
0¥ 30.75 32.00 31.75 33.40 33.20
30 31.50 33.00 32.50 34.00 34.00
60 32.75 34.75 34.25 36.20 35.80
90 33.25 36.00 35.50 38.00 37.00
Overall 32.45d 34.00bc 33.65c 35.16a 34.92ab
BW loss (kg) − 30 0.160*** 0.138*** 0.321*
0¥ − 3.25 − 2.25 − 2.50 − 0.80 − 1.40
30 0.75 1.00 0.75 0.60 0.80
60 1.25 1.75 1.75 2.20 1.80
90 0.50 1.25 1.25 1.80 1.20
Overall − 0.19c 0.44ab 0.31bc 0.95a 0.60ab
BW change (%) − 30 0.466*** 0.400*** 0.932*
0¥ − 9.56 − 6.57 − 7.30 − 2.34 − 4.05
30 2.44 3.13 2.36 1.80 2.41
60 3.97 5.30 5.38 6.47 5.29
90 1.53 3.60 3.65 4.97 3.35
Overall − 0.41b 1.36a 1.02ab 2.73a 1.75a

¥At parturition; TR, treatment; D, day; BW, body weigh; TR×D, interaction.

a, b, c and d, means with different superscripts, within each row are significantly different (P < 0.05).

The average LBW, monthly and daily weight gain, and % changes in kids’ BW at birth, 30, 60, and 90 days of age as affected by the treatments, kids’ age, and their interaction are presented in Table 4. Across all treatment groups, the average BW of neonatal kids increased relative to the control by 22.42% (ZnO), 14.45% (Se), 35.10% (ZnO-NPs), and 29.94% (Se-NPs). It is interesting to note that average BW, weekly and daily gain, and % change in BW of kids showed significant (P < 0.01) gradual increase by age progress, but only absolute and relative kids’ weight were affected significantly by the type of mother treatment. Both conventional and NP trace elements enhanced weight gain compared to the control, with the NP-supplemented groups achieving the most pronounced improvements.

Table 4.

Impact of zinc oxide or selenium nanoparticles on body weight and growth performance of suckling kids.

Items Day post -parturition Experimental groups ± Standard error
Control ZnO Se ZnO-NPs Se-NPs TR D TR×D
Live BW (kg) 0¥ 1.79 2.24 2.01 2.52 2.41 0.120*** 0.103*** 0.241***
30 5.77 6.93 6.85 7.63 7.24
60 8.67 10.75 10.04 11.83 11.44
90 10.90 13.28 12.12 14.66 14.13
Overall 6.78e 8.30c 7.76d 9.16a 8.81b
Daily gain (g/d) 0¥ 4.125*** 3.065*** 7.145ns
30 132.67 156.33 161.33 170.33 161.00
60 96.67 127.33 106.33 140.00 140.00
90 74.33 84.33 69.33 94.33 89.67
Overall 101.22d 122.67bc 112.33cd 134.89a 130.22ab
BW change (%) 0¥ 7.366ns 5.473*** 12.759ns
30 222.35 209.38 240.80 202.78 200.41
60 50.26 55.12 46.57 55.05 58.01
90 25.72 23.53 20.72 23.92 23.51
Overall 99.44 96.01 102.69 93.92 93.98
Survival rate (%) 100 100 100 100 100

¥At parturition; TR, treatment; D, day; BW, body weigh; TR×D, interaction.

a, b, c and d, means with different superscripts, within each row are significantly different (P < 0.05).

Expression analysis of body weight-related genes

The expression levels of body weight-related genes, including GH, IGF-1, and Leptin in mother goat groups treated with either the conventional or NP forms of ZnO and Se, are illustrated in Fig. 2. The data reveal that the control group exhibited significantly lower expression of all three genes compared to the treated groups. Among the conventional element treatments, animals received Se showed significant upregulation (P < 0.05) in the expression of GH and IGF-1 compared to those treated with ZnO. Although Leptin expression was slightly higher in the Se group than in the ZnO group, this difference was not statistically significant. When comparing with the NP treatments, Se-NPs demonstrated a pronounced enhancement in the expression levels of all three genes, with significant increases (P < 0.01) observed compared to both the control group and the conventional element-treated groups. Furthermore, animals treated with Se-NPs exhibited significantly higher (P < 0.05) expression of IGF-1 and Leptin expression levels compared to those treated with ZnO-NPs. However, the expression levels of GH were similar between the Se-NPs and ZnO-NPs groups, with no statistically significant differences noted.

Fig. 2.

Fig. 2

The expression alteration of GH, IGF-1 and Leptin genes in blood samples collected from mother goats in control and treated groups with ZnO, Se, ZnO-NPs and Se-NPs. Data are presented as mean ± SEM. a, b,c, d: Mean values within treatments with unlike superscript letters were significantly different (P < 0.05).

Physiological analysis and electrophoretic assay

Native protein and moiety patterns

No changes were observed in any protein or moiety patterns following treatment with Se or Se-NPs, with all profiles remained identical to the control group with 100% SI (Fig. 3A). In contrast, ZnO and ZnO-NP treatments induced several changes compared to the control group. Native protein patterns showed a reduction from eight to four bands, with an SI of 66.67%. The lipid profile was altered by the appearance of two new bands and loss of one, resulting in a 57.14% SI (Fig. 3A). In the calcium moiety, one band was lost (SI = 85.71%), and in the carbohydrate moiety, two bands disappeared (SI = 75%) (Fig. 3B).

Fig. 3.

Fig. 3

Native electrophoretic protein patterns showing the effect of ZnO-NPs and Se-NPs on the physiological properties of Egyptian Baladi goats, compared to conventional ZnO and Se. GI: Goats control, GII: Goats received ZnO, GIII: Goats received Se, GIV: Goats received ZnO-NPs, GV: Goats received Se-NPs. (A) shows the protein pattern and lipid moiety, (B) shows calcium moiety and Carbohydrate moiety.

Native electrophoretic isoenzyme patterns

CAT, POX (Fig. 4), and α-Amy (Fig. 5) isoenzyme patterns were unaffected by all treatments, maintaining 100% similarity to the control. Alterations were observed only in ZnO-treated groups for EST isoenzymes: α-EST showed one lost and one new band compared to the control pattern (SI = 66.67%), while β-EST showed the loss of one band (SI = 88.89%). Se-treated groups showed no changes (Fig. 5).

Fig. 4.

Fig. 4

Native electrophoretic isoenzymes patterns showing the effect of ZnO-NPs and Se-NPs on the physiological state of catalase (CAT) and peroxidase (POX) patterns in Egyptian Baladi goats, compared to conventional ZnO and Se. GI: Goats control, GII: Goats received ZnO, GIII: Goats received Se, GIV: Goats received ZnO-NPs, GV: Goats received Se-NPs.

Fig. 5.

Fig. 5

Native electrophoretic isoenzymes patterns showing the effect of ZnO-NPs and Se-NPs on the physiological state of α-amylase (α-Amy), α-esterase (α-EST) and β-esterase (β-EST) in Egyptian Baladi goats, compared to conventional ZnO and Se. GI: Goats control, GII: Goats received ZnO, GIII: Goats received Se, GIV: Goats received ZnO-NPs, GV: Goats received Se-NPs.

Unprocessed and analyzed images of electrophoretic gels and isoenzyme patterns are provided in Supplementary File (Fig. S1-S9).

Discussion

The effect of NP elements on body weight of goats

The results in Table 3 show that mother goats receiving NP forms of ZnO or Se exhibited significantly higher body weights at parturition and throughout the postpartum period compared to those receiving conventional elements or no additives. Similarly, Table 4 demonstrates that kids from NP-treated groups had significantly higher birth and weaning weights, total body gain, and average daily gain compared to the conventional element-treated and control groups. Among all treatments, ZnO-NPs demonstrated the highest efficacy. These findings align with previous studies that reported enhanced growth performance following NP supplementation. The enhanced body weight observed in NP-treated goats may be attributed to improved nutrient bioavailability, more efficient feed utilization, and increased metabolic activity associated with nanoscale size that promotes absorption and cellular interactions27,28. ZnO-NPs have been shown to enhance growth and feed efficiency in several species. For instance, Lina et al.29 reported improved growth and carcass traits in broilers supplemented with 40 mg/kg ZnO-NPs. Similarly, Se-NPs supplementation has been associated with improved final body weight and average daily gain in goat bucks compared to control and sodium selenite-treated groups30. In rabbits, dietary supplementation with Se-NPs led to significant improvements in growth performance, weight gain, and carcass characteristics compared to natural Se sources31. The superior performance in trace element-treated groups may also relate to the essential roles of Zn and Se in enzymatic and hormonal processes. Compared to conventional forms, NPs offer higher biological availability due to their greater surface area and reactivity, resulting in enhanced catalytic efficiency32,33.

Ther effect of NPs on gene expression and growth regulation

The gene expression results provide insights into the molecular mechanisms underlying the observed improvements in body weight and growth performance in NP-treated goats. Significant upregulation of GH, IGF-1, and leptin in these animals highlights the role of ZnO and Se, particularly in nanoparticle form, in modulating key growth-related pathways. GH and IGF-1 are critical for protein synthesis, cell proliferation, and muscle development, which likely contributed to the increased body weight and growth efficiency in treated groups10,34. The upregulation of leptin, a key hormone in regulating energy balance and fat metabolism, indicates enhanced metabolic efficiency and nutrient utilization in treated goats. Elevated leptin expression is typically linked to increased body fat and contributes to energy homeostasis by suppressing appetite and promoting metabolic activity35. Investigations in pigs and ewes have highlighted a significant connection between leptin levels and body fat accumulation36,37. Similarly, in cattle, leptin has been identified as a key factor influencing fat deposition, including backfat thickness and marbling quality38.

Although both conventional and NP forms showed positive effects, NPs demonstrated superior efficacy. ZnO-NPs and Se-NPs induced greater gene expression levels than their conventional counterparts, likely due to enhanced bioavailability and cellular uptake enabled by their nanoscale properties32,33. While limited data exist on the effects of ZnO-NPs and Se-NPs on gene expression in goats, findings from other species support our observations. In zebrafish, combined ZnO-NPs and Se-NPs supplementation increased GH and IGF-1 expression and improved growth outcomes39. In mice, ZnO-NPs upregulated genes involved in zinc metabolism, such as metallothionein, particularly at higher doses40. In goats, Abedin et al.6 reported that ZnO-NPs and Se-NPs supplementation in cryopreserved buck semen upregulated stress-related genes such as HSP70 and HSP90, further suggesting their protective and performance-enhancing roles.

Collectively, these findings support the use of ZnO-NPs and Se-NPs as effective modulators of growth-related gene expression. By enhancing the activity of GH, IGF-1, and leptin, these nanoparticles offer a promising strategy to improve meat yield and overall productivity in small ruminants.

The effect of NPs on physiological parameters

To assess potential physiological risks, this study examined the effects of ZnO-NPs or Se-NPs on protein and isoenzyme patterns. Significant alterations were observed in the native protein profiles of goats treated with ZnO in both forms. These changes may be attributed to their ability to disrupt membrane fluidity and bind to protein thiol groups, particularly cysteine residues, leading to improper protein folding and inhibited enzyme function41. Additionally, ZnO-NPs release zinc ions that impair cellular energy production by downregulating key enzymes in glycolysis, the tricarboxylic cycle, and the electron transport chain42.

In terms of lipid-associated proteins, ZnO-NPs likely interact with plasma lipoproteins and acute-phase proteins, possibly adsorbing apolipoproteins via hydrophobic interactions through flexible hinge regions43. Moreover, ZnO-NPs can generate intracellular reactive oxygen species (ROS) in a size-dependent manner, inducing conformational and functional changes in proteins44. Calcium-binding proteins, typically involved in detoxification, also exhibited structural changes, potentially due to abnormal mineralization and ROS production triggered by ZnO-NPs45. Similarly, carbohydrate-linked protein patterns were disrupted, likely due to oxidative stress affecting glycosylation processes and protein stability46.

Enzymatic assays revealed alterations in the EST isoenzyme pattern in goats treated with ZnO in both forms, likely due to ROS-mediated polypeptide fragmentation and direct binding of ZnO-NPs to cysteine residues at the active site, forming enzyme-inhibitor complexes47. Other enzymes like CAT, POX and α-Amy were not affected by ZnO treatment. Conventional Se and Se-NPs did not affect native protein or isoenzyme profiles, suggesting a more favorable physiological safety profile.

In conclusion, oral administration of ZnO-NPs and Se-NPs improved body weight and enhanced the expression of growth-related genes in Baladi goats. The physiological changes observed in electrophoretic protein and isoenzyme patterns in the ZnO-NPs groups indicate potential metabolic effects, though no impairment in critical enzyme activities was detected. Se-NPs, however, did not result in such physiological alterations, suggesting that the impact of NP supplementation may vary based on the specific trace element used. NP supplementation may serve as a valuable approach to enhance bioavailability and biological activity. However, further research is warranted to explore the long-term effects and safety of these treatments in diverse animal models, as well as to optimize strategies for their practical application in livestock production systems.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (5.9MB, docx)

Acknowledgements

We gratefully acknowledge the National Research Centre for providing financial support to cover the cost of materials and equipment.

Author contributions

**IMF: ** Designed the study, coordinated the project, analyzed data, wrote, reviewed and edited the main manuscript; **WMA: ** Conducted and analyzed physiological experiments and contributed to writing the physiological analysis section; **SMA, MYM and MIE** : Performed nutritional experiments and contributed to writing and evaluating the body weigh data; **MEA: ** Prepared and characterized the nanoparticles; **MGE: ** Contributed to writing the genetic analysis section; **WKBK and HM** : Conducted gene expression analysis experiments, curated the gene expression data and contributed to writing the genetic analysis section. **HM: ** Reviewed and edited the main manuscript. All authors reviewed and approved the final manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). This research was funded by the National Research Centre, Giza, Egypt. Internal project (No. 13050410) under title”: “use of gene markers, gene expression and feeding nanoparticles of selenium and zinc oxide for improving meat and milk production in Egyptian goats”, PI: Prof. Dr. Ibrahim M Farag.

Data availability

All data is provided within the manuscript or supplementary information files.

Declarations

Competing interests

The authors declare no competing interests.

Ethics statement and consent to participate

Blood samples were collected from goats under veterinary supervision and comply with local and international guidelines and recommendations for the care and use of animals.  Sampling was conducted after obtaining written approval from the Animal Production Research Institute, Agricultural Research Centre, Sids City, Beni Suef Governorate, Egypt. All animal procedures were approved by the Institutional Animal Care and Use Committee of the National Research Centre, Egypt (Permit No. 13050410-2), and the study was conducted in compliance with the ARRIVE guidelines (https://arriveguidelines.org).

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Ibrahim M. Farag, Email: faragim@hotmail.com

Hayam Mansour, Email: hayammansour@hotmail.com.

References

  • 1.Abd-Elgaber, S. R., Abou-Ammou, F. F., Moursy, F. & Mikhail, W. Z. A. Characterization of productive and reproductive performance of Saidi goats in Egypt. Assiut Veterinary Med. J.71 (184), 81–90. 10.21608/avmj.2024.319654.1397 (2025). [Google Scholar]
  • 2.Gawat, M., Boland, M., Singh, J. & Kaur, L. Goat meat: production and quality attributes. Foods12, 3130. 10.3390/foods12163130 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Gagaoua, M. et al. Intrinsic and extrinsic factors impacting fresh goat meat quality: an overview. Meat Technol.64, 20–40. 10.18485/meattech.2023.64.1.3 (2023). [Google Scholar]
  • 4.Oh, H. J. et al. Effect of nano zinc oxide or chelated zinc as alternatives to medical zinc oxide on growth performance, faecal scores, nutrient digestibility, blood profiles and faecal Escherichia coli and Lactobacillus concentrations in weaned piglets. Ital. J. Anim. Sci.21, 708–716. 10.1080/1828051X.2022.2057875 (2022). [Google Scholar]
  • 5.Abdel-Wareth, A., Amer, S., Mobashar, M. & El-Sayed, H. Use of zinc oxide nanoparticles in the growing rabbit diets to mitigate hot environmental conditions for sustainable production and improved meat quality. BMC Vet. Res.18, 34. 10.1186/s12917-022-03451-w (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Abedin, S. N. et al. Zinc oxide and selenium nanoparticles can improve semen quality and heat shock protein expression in cryopreserved goat (Capra hircus) spermatozoa. J. Trace Elem. Med. Biol.80, 127296. 10.1016/j.jtemb.2023.127296 (2023). [DOI] [PubMed] [Google Scholar]
  • 7.Mansour, H. et al. Effect of zinc oxide and selenium nanoparticles on milk production efficiency and related gene expression in Egyptian Baladi goats. Egypt. J. Chem.68, 445–454. 10.21608/ejchem.2024.320064.1042 (2025). [Google Scholar]
  • 8.Hosiner, D. et al. Impact of acute metal stress in Saccharomyces cerevisiae. PLoS One. 9, e83330. 10.1371/journal.pone.0083330 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Aboulthana, W. M. et al. The hepato- and neuroprotective effect of gold casuarina equisetifolia bark nano-extract against Chlorpyrifos-induced toxicity in rats. J. Genet. Eng. Biotechnol.21, 158. 10.1186/s43141-023-00595-6 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Machado, A. et al. Variants in GH, IGF1, and LEP genes associated with body traits in Santa Inês sheep. Sci. Agric.78, e20190216. 10.1590/1678-992X-2019-0216 (2021). [Google Scholar]
  • 11.Hua, G. H. et al. Polymorphism of the growth hormone gene and its association with growth traits in Boer goat bucks. Meat Sci.81, 391–395. 10.1016/j.meatsci.2008.08.015 (2009). [DOI] [PubMed] [Google Scholar]
  • 12.Kumar, S. et al. Polymorphism of growth hormone (GH) gene and its association with performance and body conformation of harnali sheep. Trop. Anim. Health Prod.56, 116. 10.1007/s11250-024-03968-2 (2024). [DOI] [PubMed] [Google Scholar]
  • 13.Alqasimi, R., Hassan, A. & Khudaier, B. Effect of IGF-1 and GH genes polymorphism on weights and body measurements of Awassi lambs in different ages. Basrah J. Agric. Sci.32, 39–46. 10.33762/bjas.2019.161201 (2019). [Google Scholar]
  • 14.Supakorn, C. & Pralomkarn, W. Genetic polymorphisms of growth hormone (GH), Insulin-like growth factor 1 (IGF-1) and Diacylglycerol acyltransferase 2 (DGAT-2) genes and their effect on birth weight and weaning weight in goats. Philipp Agric. Sci.96, 18–25 (2013). http://journals.uplb.edu.ph/index.php/PAS/article/view/873 [Google Scholar]
  • 15.Shareef, M., Basheer, A., Zahoor, I. & Anjum, A. A. Polymorphisms in growth hormone (GH) and insulin-like growth factor-1 (IGF-1) gene and their association with growth traits in beetal goat. Pak J. Agric. Sci.55, 719–726. 10.21162/PAKJAS/18.7166 (2018). [Google Scholar]
  • 16.Li, S. et al. H. Nucleotide sequence variation in the insulin-like growth factor 1 gene affects growth and carcass traits in new Zealand Romney sheep. DNA Cell. Biol.40, 265–271. 10.1089/DNA.2020.6166 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Van Dijk, G. The role of leptin in the regulation of energy balance and adiposity. J. Neuroendocrinol.13, 913–921. 10.1046/j.1365-2826.2001.00707.x (2001). [DOI] [PubMed] [Google Scholar]
  • 18.Kumar, S., Dahiya, S. P., Magotra, A. & Bangar, Y. C. Identification of point mutation in exon 3 of leptin gene in Munjal sheep. Indian J. Anim. Res.56, 807–810. 10.18805/ijar.b-3981 (2022). [Google Scholar]
  • 19.Shaban, E. E. et al. Effect of zinc oxide nanoparticles on diabetes development and complications in diabetic rats compared to conventional zinc sulfate and Metformin. Biocatal. Agric. Biotechnol.46, 102538. 10.1016/j.bcab.2022.102538 (2022). [Google Scholar]
  • 20.Sentkowska, A. & Pyrzyńska, K. The influence of synthesis conditions on the antioxidant activity of selenium nanoparticles. Molecules27, 2486. 10.3390/molecules27082486 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jia, J., Zhang, P., Wu, J., Ha, Z. & Li, W. Study of the correlation between GH gene polymorphism and growth traits in sheep. Genet. Mol. Res.13, 7190–7200. 10.4238/2014.September.5.5 (2014). [DOI] [PubMed] [Google Scholar]
  • 22.Rotwein, P. Diversification of the insulin-like growth factor 1 gene in mammals. PLoS ONE. 12, e0189642. 10.1371/journal.pone.0189642 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Shojaei, M. et al. Association of growth trait and leptin gene polymorphism in Kermani sheep. J. Cell. Mol. Res.2, 67–73. 10.22067/JCMR.V2I2.3117 (2011). [Google Scholar]
  • 24.Vorachek, W., Hugejiletu, Bobe, G. & Hall, J. Reference gene selection for quantitative PCR studies in sheep neutrophils. Int. J. Mol. Sci.14, 11484–11495. 10.3390/ijms140611484 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.SAS Institute. SAS/STAT user’s guide for personal computer. Release 6.12. Cary (SAS Inst., Inc., 2001). https://www.sas.com/en_us/software/stat.html.
  • 26.Nei, M. & Li, W. H. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA. 76, 5269–5273. 10.1073/pnas.76.10.5269 (1979). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mohamed, A. H., Mohamed, M. Y., Ibrahim, K., Abd El Ghany, F. T. F. & Mahgoup, A. A. Impact of nano-zinc oxide supplementation on productive performance and some biochemical parameters of Ewes and offspring. Egypt. J. Sheep Goat Sci.12, 1–16. 10.21608/ejsgs.2017.26308 (2017). [Google Scholar]
  • 28.Ibrahim, E. & Mohamed, M. Effect of different dietary selenium sources supplementation on nutrient digestibility, productive performance and some serum biochemical indices in sheep. Egypt. J. Nutr. Feeds. 21, 53–64. 10.21608/ejnf.2018.75398 (2018). [Google Scholar]
  • 29.Lina, T., Fenghua, Z., Hui-ying, R., Jian-yang, J. & Wenli, L. Effects of nano-zinc oxide on antioxidant function in broilers. Chin. J. Anim. Nutr.21, 534–539 (2009). https://api.semanticscholar.org/CorpusID:81488738 [Google Scholar]
  • 30.Shi, L., Xun, W., Yue, W., Zhang, C. & Ren, Y. Effect of sodium selenite, se-yeast and nanoelemental selenium on growth performance, se concentration and antioxidant status in growing male goats. Small Rumin Res.96, 49–52. 10.1016/j.smallrumres.2010.11.005 (2011). [Google Scholar]
  • 31.Sheiha, A. et al. El-Saadony, M. Effects of dietary biological or chemical-synthesized nano-selenium supplementation on growing rabbits exposed to thermal stress. Animals10, 430. 10.3390/ani10030430 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.O’Dell, B. L. Zinc plays both structural and catalytic roles in metalloproteins. Nutr. Rev.50, 48–50. 10.1111/j.1753-4887.1992.tb02513.x (1992). [DOI] [PubMed] [Google Scholar]
  • 33.Zhang, J., Wang, X. & Xu, T. Elemental selenium at nano size (Nano-Se) as a potential chemopreventive agent with reduced risk of selenium toxicity: comparison with Se-methylselenocysteine in mice. Toxicol. Sci.101, 22–31. 10.1093/toxsci/kfm221 (2008). [DOI] [PubMed] [Google Scholar]
  • 34.El-Magd, M. A. et al. Polymorphisms of the IGF1 gene and their association with growth traits, serum concentration, and expression rate of IGF1 and IGF1R in Buffalo. J. Zhejiang Univ. Sci. B. 18, 1064–1074. 10.1631/jzus.B1600573 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liefers, S. C., Te Pas, M. F., Veerkamp, R. F. & van der Lende, T. Associations between leptin gene polymorphisms and production, live weight, energy balance, feed intake, and fertility in Holstein heifers. J. Dairy. Sci.85, 1633–1638. 10.3168/jds.S0022-0302(02)74235-5 (2002). [DOI] [PubMed] [Google Scholar]
  • 36.Robert, C. et al. Backfat thickness in pigs is positively associated with leptin mRNA levels. Can. J. Anim. Sci.78, 473–482. 10.4141/A98-072 (1998). [Google Scholar]
  • 37.Daniel, J. A. et al. Effect of body fat mass and nutritional status on 24-hour leptin profiles in Ewes. J. Anim. Sci.80, 1083–1089. 10.2527/2002.8041083x (2002). [DOI] [PubMed] [Google Scholar]
  • 38.Matsumoto, H. et al. Leptin gene contributes to beef marbling standard, meat brightness, meat firmness, and beef fat standard of the Kumamoto sub-breed of Japanese brown cattle. Anim. Sci. J.93, e13698. 10.1111/asj.13698 (2022). [DOI] [PubMed] [Google Scholar]
  • 39.Fasil, D. M. et al. Selenium and zinc oxide multinutrient supplementation enhanced growth performance in zebra fish by modulating oxidative stress and growth-related gene expression. Front. Bioeng Biotechnol. 9, 721717. 10.3389/fbioe.2021.721717 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wang, C. et al. Effects of long-term exposure to zinc oxide nanoparticles on development, zinc metabolism and biodistribution of minerals (Zn, Fe, Cu, Mn) in mice. PLoS ONE. 11, e0164434. 10.1371/journal.pone.0164434 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Babele, P. K. Zinc oxide nanoparticles impose metabolic toxicity by de-regulating proteome and metabolome in Saccharomyces cerevisiae. Toxicol. Rep.6, 64–73. 10.1016/j.toxrep.2018.12.001 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Yan, G. et al. Zinc oxide nanoparticles cause nephrotoxicity and kidney metabolism alterations in rats. J. Environ. Sci. Health A. 47, 577–588. 10.1080/10934529.2012.650576 (2012). [DOI] [PubMed] [Google Scholar]
  • 43.Shim, K., Hulme, J., Maeng, E. H., Kim, M. K. & An, S. S. A. Analysis of zinc oxide nanoparticles binding proteins in rat blood and brain homogenate. Int. J. Nanomed.9, 217–224. 10.2147/IJN.S58204 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Yao, Y., Zang, Y., Qu, J., Tang, M. & Zhang, T. The toxicity of metallic nanoparticles on liver: the subcellular Damages, Mechanisms, and outcomes. Int. J. Nanomed.14, 8787–8804. 10.2147/IJN.S212907 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.El-Sayed, A. E. B., Aboulthana, W. M., El-Feky, A. M., Ibrahim, N. E. & Seif, M. M. Bio and phyto-chemical effect of amphora coffeaeformis extract against hepatic injury induced by Paracetamol in rats. Mol. Biol. Rep.45, 2007–2023. 10.1007/s11033-018-4356-8 (2018). [DOI] [PubMed] [Google Scholar]
  • 46.Farghaly, F. A., Radi, A. A., Al-Kahtany, F. A. & Hamada, A. M. Impacts of zinc oxide nano and bulk particles on redox-enzymes of the Punica granatum callus. Sci. Rep.10, 19722. 10.1038/s41598-020-76664-4 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sloan-Dennison, S., Laing, S., Shand, N. C., Graham, D. & Faulds, K. A novel nanozyme assay utilising the catalytic activity of silver nanoparticles and SERRS. Analyst142, 2484–2490. 10.1039/c7an00887b (2017). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (5.9MB, docx)

Data Availability Statement

All data is provided within the manuscript or supplementary information files.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES