Abstract
Objectives
This study demonstrates that the Sema3A/Nrp1 pathway confers protection against Porphyromonas gingivalis LPS (P-LPS)-induced osteolysis and identifies key molecular mechanisms involved.
Methods
The effect of P-LPS on Sema3A/Nrp1 expression assessed in the preosteoclast cell line (RAW267.4) and primary mouse bone marrow stromal cells (BMSCs) using Real-time-PCR, western blot and ELISA. The effect of recombinant Sema3A on RAW267.4 cell and BMSC proliferation under P-LPS treatment was determined by CCK8 assay. Osteoclastic and osteoblastic markers gene was analysed by Real-time-PCR. ALP activity and mineralization were tested in BMSCs for osteoblast differentiation. TRAP staining and activity were measured for osteoclast differentiation. Micro-CT was applied to analysed P-LPS-induced calvarial osteolytic model.
Results
P-LPS induced significantly downregulated Sema3A/Nrp1 expression in both the preosteoclast cell line (RAW267.4) and primary mouse bone marrow stromal cells (BMSCs). Moreover, P-LPS exposure elevated osteoclastic gene expression, increased TRAP activity and promoted RANKL-induced osteoclast differentiation. However, these effects of promotion were attenuated by Sema3A administration. In addition, P-LPS impaired osteoblast differentiation in BMSCs, as evidenced by depressed osteogenic markers, attenuated β-catenin transcriptional activity, and diminished mineralization, all of which were rescued by Sema3A supplementation. Intriguingly, Sema3A alleviated P-LPS-induced repression of proliferation in BMSCs but did not affect the proliferation of RAW267.4 cells. Furthermore, P-LPS downregulated the expression of Sema3A/Nrp1 via Toll-like receptor 4 (TLR-4). Additionally, an in vivo study revealed that Sema3A administration markedly ameliorated P-LPS-mediated inflammatory osteolysis.
Conclusion
Our data identify the Sema3A-Nrp1 axis as a P-LPS–sensitive regulator of bone homeostasis, offering therapeutic potential to reverse infection-induced osteolysis through dual modulation of osteoclast and osteoblast activities. Sema3A attenuated PLPS- driven bone loss via concurrent osteoclast inhibition and osteoblast stimulation
Clinical Relevance
Our work identifies the above dual-targeting mechanism as a foundation for novel therapies against infection-related oral osteolysis.
Key words: P. gingivalis LPS, Osteoclastogenesis, Osteoblast differentiation, Sema3A, Nrp1, TLR-4
Introduction
Decades of scientific research have established Porphyromonas gingivalis (P. gingivalis ) as a Gram-negative anaerobic bacterium that serves as a keystone pathogen in periodontal diseases and a primary etiological agent of chronic periodontitis.1, 2, 3 This oral pathogen triggers a destructive inflammatory cascade characterized by gingival tissue degradation, progressive alveolar bone resorption, and ultimately tooth loss.3,4 Central to its virulence is P. gingivalis lipopolysaccharide (P-LPS), which disrupts bone remodelling homeostasis and accounts for approximately 30% of alveolar bone loss in experimental periodontitis.5
The osteolytic effects of P-LPS extend beyond periodontal tissues, contributing to periapical cysts, septic arthritis, and orthopaedic implant failures.6, 7, 8, 9, 10 Under physiological conditions, bone homeostasis is maintained through a tightly regulated balance between osteoclast-mediated bone resorption and osteoblast-driven bone formation.11,12 Current studies confirmed that pathological bone loss primarily arises from an imbalance in bone remodelling homeostasis, characterized by excessive osteoclastic resorption coupled with inadequate osteoblastic formation.13, 14, 15, 16, 17, 18 However, P-LPS disrupts this equilibrium by hyperactivating osteoclasts to accelerate bone loss while simultaneously impairing osteoblast function, thereby preventing tissue repair.19, 20, 21, 22, 23, 24, 25, 26 This dual mechanism leads to progressive bone destruction in the jaw, joints, and peri-implant regions.6, 7, 8, 9, 10,19,20 Although significant progress has been made, the precise molecular mechanisms underlying these processes remain to be fully elucidated.8,10,15,21,27, 28, 29, 30 Clarifying these mechanisms is crucial for developing targeted therapeutic strategies to combat P. gingivalis-associated bone loss, a condition affecting millions worldwide
Semaphorins represent a large family of secreted and membrane-bound glycoproteins that play pivotal roles in diverse physiological and pathological processes, ranging from neurogenesis and angiogenesis to immune regulation and cancer progression.31, 32, 33, 34 Among them, Semaphorin3A (Sema3A), initially identified as a key axon guidance molecule, has emerged as a critical regulator of bone metabolism through its interaction with neuropilin-1 (Nrp1) receptor.31,35,36 Recent studies have demonstrated that the Sema3A-Nrp1 axis exerts potent osteoprotective effects by co-ordinately modulating both bone resorption and formation.35,37,38 Accumulating evidence from preclinical studies has established the Sema3A/Nrp1 signalling axis as a critical regulator of bone homeostasis. Mechanistically, Sema3A-Nrp1 signalling suppresses osteoclastogenesis through dual inhibition of immunoreceptor tyrosine-based activation motif (ITAM) and RhoA pathways downstream of RANKL stimulation.35 Concurrently, this ligand-receptor system enhances osteoblastic bone formation by potentiating Wnt/β-catenin signalling.35,39 The essential role of Sema3A-Nrp1 signalling in bone homeostasis is further underscored by the severe osteogenic phenotypes observed in both Sema3A- and Nrp1-deficient mice.35,40 Multiple investigations have demonstrated that Sema3A/Nrp1 promotes bone formation and decreases bone resorption across multiple bone loss models, including osteoporosis, rheumatoid arthritis, glucocorticoid-induced osteoporosis and diabetic osteopathy.37,41, 42, 43, 44, 45 Although accumulating evidence indicates that targeting the Sema3A/Nrp1 signalling axis promotes osteogenesis in inflammatory microenvironments,46,47 the detailed molecular mechanisms driving this phenomenon require further investigation. Moreover, previous studies have established that osteoblast-derived Sema3A regulates osteoclast differentiation through Nrp1 receptor signalling in osteoclast precursors.48, 49, 50 However, recent findings reveal that osteoclast precursors intrinsically express Sema3A, suggesting a novel autocrine regulatory mechanism for osteoclast differentiation under inflammatory conditions that requires further investigation. Collectively, these findings establish the Sema3A/Nrp1 signalling axis as a novel therapeutic target for osteolytic disorders. This study systematically investigates the protective effects of the Sema3A/Nrp1 pathway on P-LPS-induced osteolysis and the underlying molecular mechanisms regulating this process.
Methods
Cell culture
BMSCs derived from C57BL/6 mice are widely used to investigate inflammatory osteolysis mechanisms and screen anti-resorptive therapeutics owing to their genetic stability and physiological relevance.51 Primary BMSCs were isolated from mouse bone marrow (6-week-old male C57BL/6) using our established protocol.20 Isolated cells were cultured in complete α-MEM medium (Gibco) containing 10% FBS (HyClone) at 37°C/5% CO2. The RAW264.7 macrophage cell line (ATCC) was propagated in RPMI 1640 (Gibco) with 10% FBS, as previously reported. 19
To evaluate the roles of Toll-like receptors 2 and 4 (TLR2/4) in P-LPS-mediated suppression of Sema3A/Nrp1 expression in RAW264.7 cells and bone marrow stromal cells (BMSCs), the cells were incubated with either anti-TLR2 antibody (15 μg/mL) or anti-TLR4 antibody (20 μg/mL) for 1 hour before stimulation with P-LPS (1 μg/mL), as previously described.19
Quantitative real-time PCR (qPCR)
RNA was extracted (Esunbio kit) and reverse transcribed (PrimeScript™ RT Master Mix, Takara). qPCR was performed in triplicate using TB Green™ Premix (Takara) with β-actin normalization. Primer sequences are presented in Table or Supplementary Table 1. Relative expression was calculated by 2-ΔΔCT method.
Table.
Primer sequence used for real-time PCR analysis.
| Gene | Gene ID | Forward primer sequence ((5’-3’) / Reverse primer sequence (5’-3’) |
|---|---|---|
| Sema3A40 | NM_009152 | TGGGCTGGTTCACTGGGATTGC |
| CTGGAGCTGTTGGCCAAGCCAT | ||
| Nrp-140 | NM_008737 | GAAGCACCGAGAAAACAAGG |
| TTGCCTTCGAACGACTTAGC | ||
| OCN38 | NM_007541 | CTGCGCTCTGTCTCTCTGAC |
| TTAAGCTCACACTGCTCCCG | ||
| ALP38 | NM_007431 | CCGGCTGGAGATGGACAAAT |
| CTCATTGCCCTGAGTGGTG | ||
| Runx238 | NM_001146038 | AAATGCCTCCGCTGTTATGAA |
| GCTCCGGCCCACAAATCT | ||
| CTR28 | NC_000072.7 | TGCAG ACA ACT CTT GGTTGG |
| TCGGT TTC TTC TCC TCTGGA | ||
| CTSK37 | NC_000069.7 | CAGCTTCCCCAAGATGTGAT |
| AGCACCAACGAGAGGAGAAA | ||
| NTATc-137 | NC_000075.7 | CCCCACGCCTTCTATCA |
| GTCGGTCTCGCCTTTCC | ||
| β-actin18 | NM_007393 | TGACAGGATGCAGAAGGAGA |
| CGCTCAGGAGGAGCAATG |
Western blotting
Briefly, proteins were extracted (M-PER, Thermo Fisher), quantified (BCA assay), and separated by SDS-PAGE. After transfer to nitrocellulose membranes, blots were probed with anti-Sema3A (1:1000; Abcam), anti-Nrp1 (1:1500; Abcam), and anti-GAPDH (1:5000; Santa Cruz) antibodies. Signals were detected by chemiluminescence (Pierce) with GAPDH normalization. Quantification followed established methods.39
Enzyme-linked immunosorbent assay (ELISA)
Following 48 h treatment with 1 µg/mL P-LPS (or untreated control), culture supernatants were analysed for Sema3A secretion using a commercial ELISA kit (Abbexa), with absorbance measured at 450/570 nm.
Cell proliferation assay
Cells were stimulated with P-LPS (1µg/ml) or P-LPS (1µg/ml) +Sema3A(100 ng/ml) for indicated periods of time. Subsequently, cell proliferation was measured by CCK-8 assay (Dojindo), with OD450 readings taken after 2 h incubation.
Alkaline phosphatase enzyme activity (ALP) activity
BMSCs were plated at a density of 1 × 10⁴ cells/cm² in 6-well plates. BMSCs were treated for 14 days with: 100 ng/mL Sema3A (R&D), P-LPS (InvivoGen), or both in conditioned medium. Protein content was quantified by BCA assay (Pierce). ALP activity on days 7 and 14 was measured with an ALP activity detection kit (Sigma‒Aldrich) as described in the manufacturer’s instructions. The values of ALP activity are presented as IU/mg protein.
Mineralization assay
BMSCs were cultured in osteogenic differentiation media for 14 days a following established protocol.20 Throughout the differentiation period, BMSCs were maintained in culture medium containing 100 ng/mL recombinant Sema3A with or without 1 μg/mL P-LPS. The conditioned medium was replaced every 72 hours to ensure consistent growth factor concentrations and remove metabolic by products. Mineralization was quantified by Alizarin Red S staining on day 14 of osteogenic differentiation according to previous description.39
Topflash/fopflash reporter assay
β-Catenin/Tcf-Lef transcriptional activity was assessed in BMSCs using TopFlash/FopFlash reporter assays. Cells were co-transfected with either TopFlash plasmid (wild-type TCF-responsive luciferase reporter, Sigma) or FopFlash plasmid (mutant negative control, Sigma) along with pRL-TK Renilla luciferase plasmid (Promega) for normalization, using Lipofectamine 2000 (Invitrogen).
After 48 hours, dual luciferase activity was measured (Promega kit) and TopFlash activity was normalized to both FopFlash and Renilla controls per established protocols.39
Tartrate-resistant acid phosphatase (TRAP) staining assay and TRAP activity
RAW 264.7 cells (1.3 × 10⁴ cells/cm²) were differentiated in medium containing 50 ng/mL RANKL and subsequently treated with 1μg/mL LPS in the absence or presence of 100 ng/mL Sema3A.Medium was refreshed every 2 days. Following 7 days of culture, cells were fixed and stained for osteoclast formation using a commercial kit (Sigma-Aldrich). TRAP-positive cells were considered to contain more than three nuclei were quantified using light microscopy at 200 × magnification
For measurement of TRAP activity, the fixed RAW264.7 cells were treated with 100 ml phosphatase substrate solution containing 10mM pNPP and10mM sodium tartrate as described in literature.45 Absorbance was analysed at 405nm using an ELISA reader.
Establishment of the P-LPS-induced calvarial osteolytic model
An established P-LPS-induced osteolysis model was used in 8-week-old C57BL/6 mice.29 Briefly, with PBS (sham group), P-LPS (25 mg/kg) or P-LPS in conjunction with Sema3A (1 mg/kg) was injected subcutaneous into the at the midline calvaria region. 14 days after injection, calvaria samples were collected for micro-CT analysis after fixation with 4% paraformaldehyde. The experimental timeline, including P-LPS administration with or without Sema3A treatment, induction of inflammatory osteolysis, and sample collection, is illustrated in Figure 1.
Fig. 1.
An inflammatory bone destruction model was induced in 8-week-old C57BL/6 mice by subcutaneous injection of either LPS or PBS (sham group) into the tissue pocket surrounding the calvaria near the skull midline (between the ears and eyes). Fourteen days post-injection, the mice (n = 5 per group) were euthanized, and calvarial samples were collected for analysis.
Micro-CT scanning and analysis
Calvariae were scanned at 15 μm resolution (Scanco Medical, 70 kV/114 μA). A 3 mm diameter ROI cantered on the sagittal suture was analysed for: the bone volume fraction (BV/TV), trabecular thickness (Tb.Th.), trabecular number (Tb.N.), and trabecular separation (Tb.Sp.) using manufacturer software. 3D reconstructions were created in Mimics software v17.0 (Materialise) with standardized thresholds.
Statistics
Data are presented as the means±SEM. Statistical comparisons were performed using either one-way ANOVA (for single-factor comparisons) or two-way ANOVA (for multifactorial analyses) as followed by appropriate post hoc tests. A threshold of P < 0.05 was considered statistically significant.
Results
Sema3A/Nrp1 expression is suppressed by P-LPS in osteoclast precursors and preosteoblasts
The experimental findings indicated that P-LPS (1 µg/ml) obviously reduced Sema3A/Nrp1 mRNA expression and protein level in RAW267.4 cells (Figure 2 A-E). Additionally, ELISA analysis demonstrated that secreted Sema3A declined in RAW267.4 cells after P-LPS exposure (Figure 2 F).
Fig. 2.
Effects of P-LPS on Sema3A/Nrp1 expression in RAW267.4 cells. Sema3A/Nrp1 expression levels were measured via real-time PCR and western blotting. The Sema3A expression level in the cell culture supernatant was detected via ELISA. A, B, mRNA expression of Sema3A/Nrp1 in RAW267 cells treated with P-LPS for 6 h. C, Representative western blots. D, E, Protein expression of Sema3A/Nrp1 in P-LPS-treated RAW267 cells at 6 h. F, Sema3A expression in the cell culture supernatant of RAW267 cells treated with P-LPS for 48 h. The data are expressed as the meansSEMs (n = 3). * P < 0.05 compared with the control sample.
Moreover, quantitative analysis demonstrated that 1 µg/ml P-LPS significantly downregulated Sema3A/Nrp1 expression at both transcriptional and translational levels in BMSCs (Figure 3 A-E). The ELISA data also revealed that P-LPS reduced extracellular Sema3A in BMSCs culture supernatants (Figure 3 F).
Fig. 3.
Effects of P-LPS on Sema3A/Nrp1 expression in BMSCs. Sema3A/Nrp1 expression levels were measured via real-time PCR and western blotting. The Sema3A expression level in the cell culture supernatant was detected via ELISA. A, B, mRNA expression of Sema3A/Nrp1 in RAW267 cells treated with P-LPS for 6 h. C, Representative western blots. D, E, Protein expression of Sema3A/Nrp1 in BMSCs stimulated with P-LPS for 6 h. F, Sema3A expression in the cell culture supernatant of P-LPS-treated BMSCs at 48 h. The data are expressed as the meansSEMs (n = 3). * P < 0.05 compared with the control sample.
Effect of Sema3A on cellular proliferation under inflammatory conditions
P-LPS (1 µg/ml) remarkably reduced BMSC proliferation at all time point. Furthermore, recombinant Sema3A (100ng/ml) restored the decrease in BMSC proliferation (Figure 4 A).
Fig. 4.
Effects of Sema3A/Nrp1 on BMSC and Raw267.4 cell proliferation under P-LPS treatment. A and B, The proliferation of BMSCs (A) and Raw267.4 cells (B) cultured under P-LPS stimulation was detected by CCK-8 assays at 24, 48 and 72 h. The results are expressed as the meanSEM (n = 3). *P < 0.05 compared with the other samples.
However, P-LPS exposure showed no significant effect on proliferation rates of control group across time points. Sema3A co-treatment similarly demonstrated no measurable impact on RAW267.4 cell proliferation under P-LPS treatment (Figure 4 B).
Sema3A rescued P-LPS -induce promotion of osteoclast differentiation
Quantitative analysis demonstrated that 1µg/ml P-LPS significantly upregulated the mRNA levels of nuclear factor of activated T cells cytoplasmic 1 (NFATc1), calcitonin receptor (CTR) and cathepsin K (CTSK) in RAW267.4 cells were obviously increased by exposure to P-LPS. Notably, exogenous Sema3A (100 ng/ml) treatment essentially suppressed the increase in NFATc1, CTR and CTSK mRNA expression in the P-LPS treatment groups (Figure 5 A-C).
Fig. 5.
Effects of Sema3A/Nrp1 on preosteoclast differentiation under P-LPS treatment. A‒C, Real-time PCR was used to measure the changes in the mRNA expression of NFATc1, CTR and CTSK in Raw267.4 cells treated with P-LPS and incubated with or without Sema3A. D, Representative TRAP staining for osteoclast differentiation. The scale bar equals 50 µm in all the graphs. E, The number of osteoclast-like cells/well in the different groups. F, TRAP activity of Raw267.4 cells in different groups. The concentrations of reagents used in the experiment were as follows: RANKL (50 ng/ml), P-LPS (1 μg/ml), Sema3A (100 ng/ml). The results are shown as the meansSEMs (n = 3). *P < 0.05 compared with the other samples.
TRAP activity quantification revealed that P-LPS stimulation (1 µg/mL P-LPS) significantly increased TRAP activity compared to the control. Co-treatment with Sema3A (100 ng/mL) markedly attenuated this P-LPS-induced increase in TRAP activity. Furthermore, P-LPS raised the number of TRAP-positive multinucleated cells in RANKL-induced RAW 264.7 cells, indicating enhanced osteoclast differentiation. Critically, recombinant Sema3A co-administration significantly suppressed P-LPS-driven osteoclast differentiation. (Figure 5 D-F).
Sema3A rescued P-LPS -driven reduction of osteoblast differentiation
1 µg/ml P-LPS exposure significantly downregulated mRNA expression of osteogenic markers (ALP, OCN, Runx2) in BMSCs compared to Sema3A-untreated controls. Concomitant recombinant Sema3A (100ng/ml) administration virtually abrogated this P-LPS-induced suppression (Figure 6 A-C). Consistent with these findings, TopFlash/FopFlash reporter assays confirmed that P-LPS potently inhibited β-catenin/TCF-LEF transcriptional activity, while Sema3A co-treatment substantially rescued this inhibition (Figure 6 D)
Fig. 6.
Effects of Sema3A/Nrp1 on preosteoblast differentiation under P-LPS treatment. A‒C, Real-time PCR was used to measure the changes in the mRNA expression of ALP, OCN and Runx2 in BMSCs treated with 1 µg/mL P-LPS in conjunction with or without Sema3A. D, β-catenin/Tcf transcriptional activity was measured in BMSCs. Luciferase activity is presented as the ratio of pTopflash/pFopflash activity. E, Quantification of ALP activity in BMSCs. F, Representative alizarin red S staining. G, Quantification of alizarin red staining in BMSCs. The results are displayed as the meansSEMs (n = 3). *P < 0.05 compared with the other samples.
We assessed the effects of P-LPS stimulation on quantitative ALP activity and mineralization in BMSCs with or without recombinant Sema3A co-treatment. The results demonstrated that P-LPS significantly reduced ALP activity at both 7 and 14 days. Exogenous Sema3A treatment markedly reversed this P-LPS-induced suppression of ALP activity in BMSCs at all examined time points (Figure 6 E).
The mineralized nodules of BMSCs were assessed via Alizarin red staining. P-LPS treatment potently suppressed mineralization capacity in BMSCs, while coadministration of recombinant Sema3A significantly rescued this P-LPS-induced mineralization impairment (Figure 6 F and G).
P-LPS decreased Sema3A/Nrp1 expression via TLR-4
Furthermore, we investigated the roles of Toll-like receptor 2 and 4 (TLR-2/4) in P-LPS-mediated suppression of Sema3A/Nrp1 expression in RAW264.7 cells and BMSCs. Quantitative real-time PCR analysis revealed that P-LPS significantly downregulated Sema3A/Nrp1 expression in both cell types. TLR-4 blockade using a neutralizing antibody substantially attenuated the P-LPS-induced reduction of Sema3A/Nrp1 mRNA levels in these cells. In contrast, TLR-2 inhibition with a specific antibody failed to modulate Sema3A/Nrp1 mRNA expression in either BMSCs or RAW264.7 cells under LPS stimulation (Figure7 A and B).
Fig. 7.
P-LPS influences Sema3A/Npr1 expression in BMSCs and Raw267.4 cells through TLR-4.The mRNA expression levels of Sema3A/Npr1 were analysed via real-time PCR. A and B, mRNA expression of Sema3A/Nrp1 in BMSCs (A) and Raw267.4 cells (B) after P-LPS exposure (1 μg/ml) alone, P-LPS (1 μg/ml) + anti-TLR-2 antibody (15 μg/ml) or P-LPS (1 μg/ml) + anti-TLR-4 antibody (20 μg/ml). The data are presented as the means ± SEMs (n = 3). *P < 0.05 compared with the other samples.
Sema3A administration prevents bone resorption induced by P-LPS in vivo
Three-dimensional micro-CT reconstruction at day 14 showed pronounced calvarial resorption in P-LPS-treated mice relative to controls. Quantitative analysis demonstrated significant reductions in BV/TV, Tb.Th., and Tb.N., along with increased Tb.Sp. in the P-LPS group versus controls. Importantly, Sema3A coadministration attenuated these effects, with fewer resorption lacunae than P-LPS treatment alone (Figure 8 A and B).
Fig. 8.
Sema3A protected against LPS-induced osteolysis in vivo. A, Micro-CT 3D reconstructed radiograph of the calvaria. B, Bone volume versus tissue volume (BV/TV), trabecular separation (Tb.Sp.), trabecular number (Tb.N.) and trabecular thickness (Tb.Th.) were analysed within regions of interest. The data are expressed as the means ± SEMs (n = 5). *P < 0.05 compared with the other samples.
Discussion
Bacterial infection is the predominant cause of inflammatory oral bone loss disorders.30,52, 53, 54 The polysaccharide of P. gingivalis is a crucial virulence factor and has been well recognized to be involved in this pathological process in several previous studies.6,8,10,19, 20, 21, 22 P-LPS has been shown to induce excessive osteoclastogenesis and insufficient osteoblastogenesis.19, 20, 21, 22, 23, 24, 25, 26 However, effective treatments for bone resorption caused by bacterial infection are lacking. Deciphering the molecular mechanisms controlling osteoclast/osteoblast differentiation and proliferation during P-LPS exposure could pave the way for targeted clinical interventions against infection-driven bone resorption. Sema3A/Nrp1 signalling plays a critical role in bone metabolism, highlighting its potential importance in this process.35,40,41,43,55 Hence, we speculated that the Sema3A/Nrp1 axis may participate in P-LPS-induced osteolysis. Previous studies revealed that Sema3A is an important dual regulatory factor in bone remodelling that decreases osteoclastogenesis and increases osteoblastogenesis simultaneously.35,40 Thus, targeting Sema3A/Nrp1 signalling emerges as a potential therapeutic strategy for pathological bone loss.
P-LPS exposure was found to significantly depress Sema3A/Nrp1 mRNA and protein expression in both RAW 264.7 cells and BMSCs. Earlier research demonstrated that in the skeletal system, Sema3A derived from osteoblasts binds the Nrp1 receptor on osteoclasts to inhibit osteoclastic differentiation.35,56 However, the mRNA and protein expression of Sema3A was detected in RAW267.4 cells in this study, which was consistent with previous research.48, 49, 50 Our results revealed that P-LPS suppressed Sema3A and its receptors in osteoclast precursor. Contrary to the established paradigm of osteoblast-derived Sema3A suppressing osteoclastogenesis via Nrp1 on precursors, we reveal that P-LPS directly regulates osteoclast differentiation by modulating Sema3A/Nrp1 expression within osteoclast precursors.
The effects of P-LPS on RAW267.4 cell and BMSC proliferation were analysed via a CCK-8 assay. These results indicate that, compared with the control treatment, P-LPS significantly decreased BMSC proliferation. In addition, Sema3A treatment obviously reversed the P-LPS-mediated decrease in BMSC proliferation. Intriguingly, P-LPS stimulation alone or P-LPS coadministration with Sema3A did not influence RAW267.4 cell proliferation. A previous study reported that Sema3A enhances osteoblast proliferation but does not affect osteoclast precursor cell proliferation.35 Current research data suggest that Sema3A ameliorates the inhibition of osteoblast proliferation in a P-LPS-induced inflammatory environment. However, Sema3A did not affect the proliferation of osteoclasts under P-LPS stimulation.
We also found that Sema3A obviously reversed the promotion of osteoclastic marker gene expression in preosteoclasts under P-LPS exposure. Moreover, Sema3A completely reversed the P-LPS-stimulated increase in TRAP activity and osteoclast differentiation. Therefore, we conclude that the suppression of Sema3A/Nrp1 in preosteoclasts is in relation to promotion of osteoclast differentiation under P-LPS exposure.
The influence of Sema3A/Nrp1 signalling on osteoblast differentiation under P-LPS exposure was also assessed. We observed that P-LPS strongly inhibited Sema3A/Nrp1 expression, as evidenced by decreased mRNA and protein levels in BMSCs. Moreover, this study demonstrated that P-LPS stimulation significantly suppressed osteoblastic gene expression, ALP activity and mineralization. These effects were remarkedly attenuated by the addition of recombinant Sema3A. The results from this study also implied that P-LPS inhibited osteogenic differentiation by reducing Sema3A.
Sema3A binding to Nrp1 activates the canonical Wnt pathway, enhancing osteogenesis in osteoblasts. through β-catenin/TCF-LEF-mediated transcriptional activation.35,39,57,58 In our study, quantitative reporter assays revealed that P-LPS suppressed β-catenin/TCF-LEF transcriptional activity by in BMSCs. Critically, this P-LPS-induced suppression was completely reversed by Sema3A coadministration.
P-LPS exerts its biological effects by interacting with key surface receptors TLR-4 and TLR-2. These receptors participate in P-LPS-mediated regulation of osteogenesis and osteoclastogenesis, as demonstrated by prior studies.59, 60, 61, 62, 63 Blockade of TLR-4 in BMSCs and RAW267.4 cells rescued the expression of Sema3A/NRP1 under LPS stimulation. However, TLR-2 inhibition did not alter the expression of Sema3A/NRP1 in BMSCs or RAW267.4 cells. The data indicated that P-LPS decreased the expression of Sema3A/NRP-1 in BMSCs and RAW267.4 cells through TLR-4.
We further evaluated Sema3A administration on P-LPS-driven bone resorption in vivo. Our data show that P-LPS induced significant osteolysis in mice, while coadministration of exogenous Sema3A completely prevented this bone loss. These results demonstrate that exogenous Sema3A represents a promising therapeutic strategy against P-LPS-induced bone resorption.
In summary, our study suggested that P-LPS decreased Sema3A/Nrp1 expression in preosteoblasts and preosteoclasts. Furthermore, P-LPS synchronously induced suppression of osteoblast proliferation and differentiation and enhancement of osteoclast differentiation via depressing Sema3A/Nrp1 expression. The upregulation of Sema3A/Nrp1 may not only promote osteoblast proliferation and differentiation but also inhibit osteoclast differentiation. The dual effect of Sema3A significantly attenuated P-LPS-induced bone loss (Figure 9). Our study provides new therapeutic strategies for treating P-LPS-induced bone loss diseases. Furthermore, the continuous advancement in the performance of various novel nanomaterials has led to their application in treating bone defect diseases.64 The integration of the Sema3A/Nrp-1 signalling axis with nanomaterials to enhance bone regeneration effects is expected to become a promising therapeutic strategy for bone defects induced by P-LPS, which will also constitute a key direction for our future research.
Fig. 9.
P-LPS promotes osteolysis by disrupting bone homeostasis via TLR-4/Sema3A/Nrp1 signalling. P-LPS suppresses Sema3A/Nrp1 expression in preosteoblasts and preosteoclasts through TLR-4 signalling, thereby disrupting bone remodelling via two complementary mechanisms: inhibition of osteoblast proliferation/differentiation and stimulation of osteoclastogenesis. This dual action shifts bone homeostasis toward net resorption, characterized by impaired bone formation and enhanced osteolytic activity, ultimately leading to pathological bone destruction
Conclusion
We identify the Sema3A-Nrp1 axis as a critical P-LPS–responsive pathway governing bone homeostasis. By dually inhibiting osteoclast activity while promoting osteoblast function, Sema3A counteracted P-LPS–induced osteolysis, demonstrating therapeutic potential for reversing infection-mediated bone destruction. These findings establish a targeted strategy against oral infectious osteolysis.
Funding
This study is supported by the National Nature of Science Foundation of China (Grant No. 81300874 and 11772361) and Guangdong Basic and Applied Basic Research Foundation (Grant nos. 2022A1515012531 and 2024A1515012222).
Declarations ethics approval and consent to participate
The research protocol was conducted in accordance with the principles of the Helsinki Declaration and Chinese national regulations. Animal experiment of this study was approved by the Animal Ethical and Welfare Committee of Sun Yat-sen University, China. (approval number SYSU-IACUC-2020-000069).
Data availability
All data supporting this study's findings are available from the corresponding author upon reasonable request.
Author contributions
Jingyi Feng: Investigation; Methodology, Data curation; Dongjie Fu: Formal analysis, Data curation; Sandeth Phan: Writing - review & editing; Xiaoli Hu: Conceptualization, Writing - review & editing; Quan Xing: Funding acquisition, Formal analysis, Resources, Supervision, Writing - review & editing.
Conflict of interest
None disclosed.
Acknowledgements
We sincerely thank Dr. Xiaolei Zhang for his generous support and collaborative contributions to this research.
Footnotes
Supplementary material associated with this article can be found in the online version at doi:10.1016/j.identj.2025.103941.
Contributor Information
Xiaoli Hu, Email: huxiaol3@mail.sysu.edu.cn.
Quan Xing, Email: xingquan@mail.sysu.edu.cn.
Appendix. Supplementary materials
References
- 1.McIntosh M.L., Hajishengallis G. Inhibition of Porphyromonas gingivalis-induced periodontal bone loss by CXCR4 antagonist treatment. Mol Oral Microbiol. 2012;27(6):449–457. doi: 10.1111/j.2041-1014.2012.00657.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Seneviratne C.J., Zhang C.F., Samaranayake L.P. Dental plaque biofilm in oral health and disease. Chin J Dent Res. 2011;14(2):87–94. [PubMed] [Google Scholar]
- 3.Kugaji M.S., Kumbar V.M., Peram M.R., Patil S., Bhat K.G., Diwan P.V. Effect of resveratrol on biofilm formation and virulence factor gene expression of Porphyromonas gingivalis in periodontal disease. APMIS. 2019;127(4):187–195. doi: 10.1111/apm.12930. [DOI] [PubMed] [Google Scholar]
- 4.Baek K.J., Ji S., Kim Y.C., Choi Y. Association of the invasion ability of Porphyromonas gingivalis with the severity of periodontitis. Virulence. 2015;6(3):274–281. doi: 10.1080/21505594.2014.1000764. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hasturk H., Jones V.L., Andry C., Kantarci A. 1-Tetradecanol complex reduces progression of Porphyromonas gingivalis-induced experimental periodontitis in rabbits. J Periodontol. 2007;78(5):924–932. doi: 10.1902/jop.2007.060293. [DOI] [PubMed] [Google Scholar]
- 6.Kato H., Taguchi Y., Tominaga K., Umeda M., Tanaka A. Porphyromonas gingivalis LPS inhibits osteoblastic differentiation and promotes pro-inflammatory cytokine production in human periodontal ligament stem cells. Arch Oral Biol. 2014;59(2):167–175. doi: 10.1016/j.archoralbio.2013.11.008. [DOI] [PubMed] [Google Scholar]
- 7.Virkkunen S., Kaarela T., Laine M., Suominen A., Hagstrom J., Sorsa T., et al. Radicular cysts and periapical granulomas: data documentation for 696 cases and findings on fibrosis, and Porphyromonas gingivalis and fusobacterium nucleatum in these lesions. Clin Exp Dent Res. 2025;11(1) doi: 10.1002/cre2.70098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Maresz K.J., Hellvard A., Sroka A., Adamowicz K., Bielecka E., Koziel J., et al. Porphyromonas gingivalis facilitates the development and progression of destructive arthritis through its unique bacterial peptidylarginine deiminase (PAD) PLoS Pathog. 2013;9(9) doi: 10.1371/journal.ppat.1003627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Asayama T., Takada A., Mikami Y., Yamaguchi H., Tamura M., Matsumoto K., et al. Possible roles of short-chain fatty acids produced by oral bacteria in the development of alveolar osteitis. J Oral Sci. 2024;66(2):102–106. doi: 10.2334/josnusd.23-0410. [DOI] [PubMed] [Google Scholar]
- 10.Tzach-Nahman R., Mizraji G., Shapira L., Nussbaum G., Wilensky A. Oral infection with Porphyromonas gingivalis induces peri-implantitis in a murine model: evaluation of bone loss and the local inflammatory response. J Clin Periodontol. 2017;44(7):739–748. doi: 10.1111/jcpe.12735. [DOI] [PubMed] [Google Scholar]
- 11.Baron R., Hesse E. Update on bone anabolics in osteoporosis treatment: rationale, current status, and perspectives. J Clin Endocrinol Metab. 2012;97(2):311–325. doi: 10.1210/jc.2011-2332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Karsenty G., Wagner E.F. Reaching a genetic and molecular understanding of skeletal development. Dev Cell. 2002;2(4):389–406. doi: 10.1016/s1534-5807(02)00157-0. [DOI] [PubMed] [Google Scholar]
- 13.Khoury M.I. Osteoporosis and inflammation: cause to effect or comorbidity? Int J Rheum Dis. 2024;27(10) doi: 10.1111/1756-185X.15357. [DOI] [PubMed] [Google Scholar]
- 14.Tan L., Miao Z., Zhao Y., Liang Y., Xu N., Chen X., et al. Dual regulation of phaseol on osteoclast formation and osteoblast differentiation by targeting TAK1 kinase for osteoporosis treatment. J Adv Res. 2025;76:761–779. doi: 10.1016/j.jare.2024.12.009. [DOI] [PubMed] [Google Scholar]
- 15.Liu S., Yan X., Guo J., An H., Li X., Yang L., et al. Periodontal ligament-associated protein-1 knockout mice regulate the differentiation of osteoclasts and osteoblasts through TGF-beta1/Smad signaling pathway. J Cell Physiol. 2024;239(3) doi: 10.1002/jcp.31062. [DOI] [PubMed] [Google Scholar]
- 16.Ye Y., Tang J., Ye J., Zhao B., Ma Y. Forkhead box O1 promotes osteogenic differentiation of periodontal ligament stem cells in hypoxia/reoxygenation environments by regulating heme oxygenase-1 scavenging of reactive oxygen species. Int Dent J. 2025;75(5) doi: 10.1016/j.identj.2025.100894. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zhan Y., Zhang S., Yang M., Wang Y., Li J., Nong X. Artesunate promotes bone remodeling through TRAF6-mediated NF-kappaB signaling under orthodontic stress in diabetic rats. Int Dent J. 2025;75(4) doi: 10.1016/j.identj.2025.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yu W., Zhu C., Xu W., Jiang L., Jiang S. Neuropeptide Y1 receptor regulates glucocorticoid-induced inhibition of osteoblast differentiation in murine MC3T3-E1 cells via ERK signaling. Int J Mol Sci. 2016;17(12) doi: 10.3390/ijms17122150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Xing Q., de Vos P., Faas M.M., Ye Q., Ren Y. LPS promotes pre-osteoclast activity by up-regulating CXCR4 via TLR-4. J Dent Res. 2011;90(2):157–162. doi: 10.1177/0022034510379019. [DOI] [PubMed] [Google Scholar]
- 20.Xing Q., Ye Q., Fan M., Zhou Y., Xu Q., Sandham A. Porphyromonas gingivalis lipopolysaccharide inhibits the osteoblastic differentiation of preosteoblasts by activating Notch1 signaling. J Cell Physiol. 2010;225(1):106–114. doi: 10.1002/jcp.22201. [DOI] [PubMed] [Google Scholar]
- 21.Kassem A., Henning P., Lundberg P., Souza P.P., Lindholm C., Lerner U.H. Porphyromonas gingivalis stimulates bone resorption by enhancing RANKL (receptor activator of NF-kappaB Ligand) through activation of toll-like receptor 2 in osteoblasts. J Biol Chem. 2015;290(33):20147–20158. doi: 10.1074/jbc.M115.655787. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Tang J., Wu T., Xiong J., Su Y., Zhang C., Wang S., et al. Porphyromonas gingivalis lipopolysaccharides regulate functions of bone marrow mesenchymal stem cells. Cell Prolif. 2015;48(2):239–248. doi: 10.1111/cpr.12173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bougas K., Ransjo M., Johansson A. Effects of Porphyromonas gingivalis surface-associated material on osteoclast formation. Odontology. 2013;101(2):140–149. doi: 10.1007/s10266-012-0068-z. [DOI] [PubMed] [Google Scholar]
- 24.Usui M., Okamatsu Y., Sato T., Hanatani T., Moritani Y., Sano K., et al. Thymus-expressed chemokine enhances Porphyromonas gingivalis LPS-induced osteoclast formation via NFATc1 activation. Arch Oral Biol. 2016;66:77–85. doi: 10.1016/j.archoralbio.2016.02.011. [DOI] [PubMed] [Google Scholar]
- 25.Wu F., Jiang Z. Long noncoding RNA MIR4435-2HG is involved in osteogenic differentiation and inflammation in human dental pulp stem cells. Int Dent J. 2025;75(4) doi: 10.1016/j.identj.2025.100866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chen J., Deng L. KLF2 promotes osteogenic differentiation of human periodontal ligament stem cells by regulating Nrf2 expression. Int Dent J. 2025;75(3):1554–1563. doi: 10.1016/j.identj.2025.02.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yoshimoto T., Kittaka M., Doan A.A.P., Urata R., Prideaux M., Rojas R.E., et al. Osteocytes directly regulate osteolysis via MYD88 signalling in bacterial bone infection. Nat Commun. 2022;13(1):6648. doi: 10.1038/s41467-022-34352-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yu X., Hu J., Yang X., Xu Q., Chen H., Zhan P., et al. Sesamin inhibits RANKL-induced osteoclastogenesis and attenuates LPS-induced osteolysis via suppression of ERK and NF-kappaB signalling pathways. J Cell Mol Med. 2024;28(2) doi: 10.1111/jcmm.18056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Feng J., Huang Z., Lu J., Chan L., Feng X., Lei L., et al. Loss of signal transducer and activator of transcription 3 in osteoblasts impaired the bone healing in inflammatory microenvironment. Mol Oral Microbiol. 2024;39(3):136–151. doi: 10.1111/omi.12425. [DOI] [PubMed] [Google Scholar]
- 30.Yekani M., Dastgir M., Fattahi S., Shahi S., Maleki Dizaj S., Memar M.Y. Microbiological and molecular aspects of periodontitis pathogenesis: an infection-induced inflammatory condition. Front Cell Infect Microbiol. 2025;15 doi: 10.3389/fcimb.2025.1533658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Behar O., Golden J.A., Mashimo H., Schoen F.J., Fishman M.C. Semaphorin III is needed for normal patterning and growth of nerves, bones and heart. Nature. 1996;383(6600):525–528. doi: 10.1038/383525a0. [DOI] [PubMed] [Google Scholar]
- 32.Gu C., Yoshida Y., Livet J., Reimert D.V., Mann F., Merte J., et al. Semaphorin 3E and plexin-D1 control vascular pattern independently of neuropilins. Science. 2005;307(5707):265–268. doi: 10.1126/science.1105416. [DOI] [PubMed] [Google Scholar]
- 33.Yang H., Zhou Y., Wang L., Lv M., Sun J., Luo Z., et al. Sema3A alleviates the malignant behaviors of gastric cancer cells by inhibiting NRP-1. Curr Mol Med. 2024;24(7):931–939. doi: 10.2174/1566524023666230801124826. [DOI] [PubMed] [Google Scholar]
- 34.Eiza N., Sabag A.D., Kessler O., Neufeld G., Vadasz Z. CD72-semaphorin3A axis: a new regulatory pathway in systemic lupus erythematosus. J Autoimmun. 2023;134 doi: 10.1016/j.jaut.2022.102960. [DOI] [PubMed] [Google Scholar]
- 35.Hayashi M., Nakashima T., Taniguchi M., Kodama T., Kumanogoh A., Takayanagi H. Osteoprotection by semaphorin 3A. Nature. 2012;485(7396):69–74. doi: 10.1038/nature11000. [DOI] [PubMed] [Google Scholar]
- 36.Zhang Y., Shi H., Dai X., Shen J., Yin J., Xu T., et al. Semaphorin 3A on osteoporosis: an overreview of the literature. Calcif Tissue Int. 2025;116(1):43. doi: 10.1007/s00223-025-01350-4. [DOI] [PubMed] [Google Scholar]
- 37.Huang B., Zhang Q., Yuan Y., Xin N., He K., Huang Y., et al. Sema3a inhibits the differentiation of Raw264.7 cells to osteoclasts under 2Gy radiation by reducing inflammation. PLoS One. 2018;13(7) doi: 10.1371/journal.pone.0200000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhang L., Zheng L., Li C., Wang Z., Li S., Xu L. Sema3a as a novel therapeutic option for high glucose-suppressed osteogenic differentiation in diabetic osteopathy. Front Endocrinol (Lausanne) 2019;10:562. doi: 10.3389/fendo.2019.00562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Xing Q., Feng J., Zhang X. Glucocorticoids suppressed osteoblast differentiation by decreasing Sema3A expression via the PIK3/Akt pathway. Exp Cell Res. 2021;403(1) doi: 10.1016/j.yexcr.2021.112595. [DOI] [PubMed] [Google Scholar]
- 40.Fukuda T., Takeda S., Xu R., Ochi H., Sunamura S., Sato T., et al. Sema3A regulates bone-mass accrual through sensory innervations. Nature. 2013;497(7450):490–493. doi: 10.1038/nature12115. [DOI] [PubMed] [Google Scholar]
- 41.Li Y., Yang L., He S., Hu J. The effect of semaphorin 3A on fracture healing in osteoporotic rats. J Orthop Sci. 2015;20(6):1114–1121. doi: 10.1007/s00776-015-0771-z. [DOI] [PubMed] [Google Scholar]
- 42.Li Y., He D., Liu B., Hu J. SEMA3A suspended in matrigel improves titanium implant fixation in ovariectomized rats. J Biomed Mater Res B Appl Biomater. 2017;105(7):2060–2065. doi: 10.1002/jbm.b.33730. [DOI] [PubMed] [Google Scholar]
- 43.Yang K., Miron R.J., Bian Z., Zhang Y.F. A bone-targeting drug-delivery system based on Semaphorin 3A gene therapy ameliorates bone loss in osteoporotic ovariectomized mice. Bone. 2018;114:40–49. doi: 10.1016/j.bone.2018.06.003. [DOI] [PubMed] [Google Scholar]
- 44.Kenan S., Onur O.D., Solakoglu S., Kotil T., Ramazanoglu M., Celik H.H., et al. Investigation of the effects of semaphorin 3A on new bone formation in a rat calvarial defect model. J Craniomaxillofac Surg. 2019;47(3):473–483. doi: 10.1016/j.jcms.2018.12.010. [DOI] [PubMed] [Google Scholar]
- 45.Liu Y.Q., Han X.F., Bo J.X., Ma H.P. Wedelolactone enhances osteoblastogenesis but inhibits osteoclastogenesis through Sema3A/NRP1/PlexinA1 pathway. Front Pharmacol. 2016;7:375. doi: 10.3389/fphar.2016.00375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Sun Z., Yan K., Liu S., Yu X., Xu J., Liu J., et al. Semaphorin 3A promotes the osteogenic differentiation of rat bone marrow-derived mesenchymal stem cells in inflammatory environments by suppressing the Wnt/beta-catenin signalling pathway. J Mol Histol. 2021;52(6):1245–1255. doi: 10.1007/s10735-020-09941-1. [DOI] [PubMed] [Google Scholar]
- 47.Tian T., Tang K., Wang A., Li Y., Li S. The effects of Sema3A overexpression on the proliferation and differentiation of rat gingival mesenchymal stem cells in the LPS-induced inflammatory environment. Int J Clin Exp Pathol. 2019;12(10):3710–3718. [PMC free article] [PubMed] [Google Scholar]
- 48.Zhang D., Xu H., Qin C., Cai K., Zhang J., Xia X., et al. Reduced expression of semaphorin 3A in osteoclasts causes lymphatic expansion in a Gorham-Stout disease (GSD) mouse model. J Zhejiang Univ Sci B. 2024;25(1):38–50. doi: 10.1631/jzus.B2300180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Saad S., Dharmapatni A., Crotti T.N., Cantley M.D., Algate K., Findlay D.M., et al. Semaphorin-3a, neuropilin-1 and plexin-A1 in prosthetic-particle induced bone loss. Acta Biomater. 2016;30:311–318. doi: 10.1016/j.actbio.2015.11.025. [DOI] [PubMed] [Google Scholar]
- 50.Togari A., Mogi M., Arai M., Yamamoto S., Koshihara Y. Expression of mRNA for axon guidance molecules, such as semaphorin-III, netrins and neurotrophins, in human osteoblasts and osteoclasts. Brain Res. 2000;878(1-2):204–209. doi: 10.1016/s0006-8993(00)02700-1. [DOI] [PubMed] [Google Scholar]
- 51.Hashemi S.M., Hassan Z.M., Pourfathollah A.A., Soudi S., Shafiee A., Soleimani M. In vitro immunomodulatory properties of osteogenic and adipogenic differentiated mesenchymal stem cells isolated from three inbred mouse strains. Biotechnol Lett. 2013;35(1):135–142. doi: 10.1007/s10529-012-1051-z. [DOI] [PubMed] [Google Scholar]
- 52.Dong Q., Zhou J., Feng M., Kong L., Fang B., Zhang Z. A review of bacterial and osteoclast differentiation in bone infection. Microb Pathog. 2024;197 doi: 10.1016/j.micpath.2024.107102. [DOI] [PubMed] [Google Scholar]
- 53.Hosseini Hooshiar M., Salari S., Nasiri K., Salim U.S., Saeed L.M., Yasamineh S., et al. The potential use of bacteriophages as antibacterial agents in dental infection. Virol J. 2024;21(1):258. doi: 10.1186/s12985-024-02510-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Nair S.P., Meghji S., Wilson M., Reddi K., White P., Henderson B. Bacterially induced bone destruction: mechanisms and misconceptions. Infect Immun. 1996;64(7):2371–2380. doi: 10.1128/iai.64.7.2371-2380.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Li Z., Hao J., Duan X., Wu N., Zhou Z., Yang F., et al. The role of semaphorin 3A in bone remodeling. Front Cell Neurosci. 2017;11:40. doi: 10.3389/fncel.2017.00040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Yamashita Y., Hayashi M., Saito M., Nakashima T. Osteoblast lineage cell-derived Sema3A regulates bone homeostasis independently of androgens. Endocrinology. 2022;163(10):1–7. doi: 10.1210/endocr/bqac126. [DOI] [PubMed] [Google Scholar]
- 57.Shi J., Zhang B., Wu Z., Zhang Y., Gupta A., Wang X., et al. Peripheral nerve-derived Sema3A promotes osteogenic differentiation of mesenchymal stem cells through the Wnt/β-catenin/Nrp1 positive feedback loop. J Cell Mol Med. 2024;28(8) doi: 10.1111/jcmm.18201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Akiyama T. Wnt/beta-catenin signalling. Cytokine Growth Factor Rev. 2000;11(4):273–282. doi: 10.1016/s1359-6101(00)00011-3. [DOI] [PubMed] [Google Scholar]
- 59.Tang Y., Sun F., Li X., Zhou Y., Yin S., Zhou X. Porphyromonas endodontalis lipopolysaccharides induce RANKL by mouse osteoblast in a way different from that of Escherichia coli lipopolysaccharide. J Endod. 2011;37(12):1653–1658. doi: 10.1016/j.joen.2011.08.015. [DOI] [PubMed] [Google Scholar]
- 60.Tominari T., Matsumoto C., Tanaka Y., Shimizu K., Takatoya M., Sugasaki M., et al. Roles of toll-like receptor signaling in inflammatory bone resorption. Biology. 2024;13(9) doi: 10.3390/biology13090692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Kirikae T., Nitta T., Kirikae F., Suda Y., Kusumoto S., Qureshi N., et al. Lipopolysaccharides (LPS) of oral black-pigmented bacteria induce tumor necrosis factor production by LPS-refractory C3H/HeJ macrophages in a way different from that of Salmonella LPS. Infect Immun. 1999;67(4):1736–1742. doi: 10.1128/iai.67.4.1736-1742.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Darveau R.P., Pham T.T., Lemley K., Reife R.A., Bainbridge B.W., Coats S.R., et al. Porphyromonas gingivalis lipopolysaccharide contains multiple lipid A species that functionally interact with both toll-like receptors 2 and 4. Infect Immun. 2004;72(9):5041–5051. doi: 10.1128/IAI.72.9.5041-5051.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Dou C., Zhen G., Dan Y., Wan M., Limjunyawong N., Cao X. Sialylation of TLR2 initiates osteoclast fusion. Bone Res. 2022;10(1):24. doi: 10.1038/s41413-022-00186-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Gou Y., Qi K., Wei Y., Gu Z., Xie H. Advances of calcium phosphate nanoceramics for the osteoinductive potential and mechanistic pathways in maxillofacial bone defect repair. Nano TransMed. 2024;3 [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data supporting this study's findings are available from the corresponding author upon reasonable request.









