Probiotic-enhanced chemotherapy: Lactobacillus fermentum synergizes with vincristine to induce apoptosis via dual pathway activation in human cancer cells

Abstract

Background

Probiotics, particularly Lactobacillus species, show promise as adjuvants in cancer therapy due to their pro-apoptotic effects. This study investigated the synergistic impact of Lactobacillus fermentum (Ab.RS23) and vincristine sulfate on colorectal (HT-29) and breast (MCF-7) cancer cells.

Methods

Cells were treated with vincristine, L. fermentum, or both. Cell viability was measured by MTT assay. Apoptosis was analyzed via Annexin V-FITC/PI flow cytometry. Gene expression changes were evaluated by RT-qPCR.

Results

Co-treatment reduced the IC₅₀ of vincristine by 8-fold in HT-29 and 13-fold in MCF-7 cells. Apoptotic signaling was enhanced, with pro-apoptotic pathways upregulated and survival pathways downregulated.

Conclusion

L. fermentum enhanced vincristine-induced apoptosis and reduced the required drug dose, which may contribute to lowering vincristine-associated toxicity. These findings require confirmation through in vivo studies.

Introduction

Colorectal and breast cancers are among the leading causes of cancer-related morbidity and mortality worldwide, representing a substantial global health burden. Despite advances in treatment strategies, conventional chemotherapeutic agents such as vincristine sulfate continue to play a central role in the management of these malignancies [1–3]. Vincristine, a vinca alkaloid, exerts its anticancer effect by inhibiting microtubule polymerization, thereby inducing mitotic arrest and promoting apoptosis. However, its clinical application is restricted by dose-limiting neurotoxic side effects, which highlight the need for novel approaches to enhance its therapeutic efficacy while reducing toxicity [4, 5]. In recent years, probiotics have emerged as promising adjuvant agents in cancer therapy. These beneficial microorganisms are known not only for their ability to modulate the gut microbiota and host immune responses but also for exerting direct anticancer effects through antiproliferative, pro-apoptotic, and immunomodulatory mechanisms [6, 7]. Among them, Lactobacillus fermentum has attracted considerable attention. Specifically, the Ab.RS23 strain (OP168796), isolated from traditional dairy products of Fars Province, Iran, has demonstrated notable anticancer potential. This strain produces bioactive metabolites such as short-chain fatty acids (SCFAs) and bacteriocins, which are thought to contribute to tumor suppression and regulation of molecular pathways involved in cancer progression. While probiotic–chemotherapy combinations have been explored in colorectal cancer, the molecular mechanisms underlying such interactions, particularly in breast cancer, remain poorly understood [8, 9]. Based on previous evidence, it has been proposed that Lactobacillus fermentum may modulate apoptotic signaling pathways and thereby enhance the therapeutic effect of chemotherapeutic agents. We hypothesized that combining L. fermentum Ab.RS23 with vincristine would potentiate cancer cell death through dual activation of intrinsic and extrinsic apoptotic pathways, particularly via the PTEN/AKT and caspase signaling cascades. Moreover, by lowering the required dose of vincristine, co-treatment with this probiotic may help to reduce vincristine-associated neurotoxicity and improve clinical applicability. To test this hypothesis, we investigated the anticancer effects of L. fermentum Ab.RS23 (OP168796) in combination with vincristine sulfate on two human cancer cell lines, HT-29 (colorectal adenocarcinoma) and MCF-7 (breast adenocarcinoma). A series of in vitro assays were performed, including MTT assays to assess cell viability, flow cytometry to evaluate apoptosis, and quantitative real-time PCR to analyze the expression of key genes associated with apoptosis, survival, and inflammation. These genes included PTEN/AKT, BAX/Bcl-2, Caspase-3, −8, and − 9, Fas, mTOR, and IκB, which provide mechanistic insights into how the combination treatment influences cellular fate. Our findings are expected to shed light on the anticancer potential of combining probiotics with chemotherapeutic agents and to suggest a novel strategy for enhancing the efficacy of vincristine while reducing its toxic side effects. A graphical abstract (Fig. 1) is provided to illustrate the study design and summarize the main findings.

Fig. 1.

Schematic overview of the synergistic anticancer effects of Lactobacillus fermentum combined with Vincristine Sulfate on HT-29 and MCF-7 cancer cell lines. The probiotic strain, isolated and characterized in vitro, enhances apoptosis and downregulates survival-related genes, enabling significant reduction in chemotherapeutic dose

Materials & methods

Materials

MCF-7 and HT-29 cells (Pasture Institute, Iran). Filter (Whatman, Germany), Hood (Kimiascodaran, Iran), Dulbecco’s Modified Eagle Medium (Gibco, UK), Fetal bovine serum (FBS) (Gibco, UK), Penicillin-streptomycin antibiotics and Trypsin- Ethylenediaminetetraacetic acid (Gibco, UK), Vincristine Sulfate (Hospira, UK), Trizol (Abi TRIzol^® Reagent, USA), cDNA synthesis kit (Bio-Rad, USA), Real-time PCR reagent Master Mix (Ampliqon, Denmark), kit FACS Verse flow cytometer (eBioscience, Austria), MTT (Sigma Aldrich, UK), MRS broth (Man, Rogosa, and Sharp, Merck, Germany).

Culture of cancer cell lines

In this study, HT-29 and MCF-7 human cancer cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic solution (Penicillin-Streptomycin) to ensure optimal growth conditions. Cells were incubated at 37 °C in a humidified atmosphere containing 5% CO₂. The cells were monitored daily for confluency, and when they reached 80–90% confluency, they were subcultured or treated according to experimental protocols. Then, they were prepared for subsequent experiments involving treatment with Vincristine Sulfate or co-culture with Lactobacillus fermentum Ab.RS23 (OP168796).

Isolation and characterization of bacteria

To isolate Lactobacillus species, 70 samples of traditional dairy products, including yogurt, were collected from 10 different locations across Fars Province, Iran. The bacterial isolation process followed established protocols [10]. The dairy samples were suspended in peptone water and vortexed to ensure uniformity. Serial dilutions were plated onto MRS agar supplemented with 0.05% cysteine to promote anaerobic growth. The plates were incubated at 37 °C for 48 h. After incubation, colonies exhibiting characteristic morphology were selected and cultured in 15 mL broth for 24 h at 37 °C. Two isolates were randomly chosen for further analysis, which included tests for morphology, motility, catalase activity, oxidase activity, and Gram staining. The isolate displaying non-motile, Gram-positive bacillary morphology and negative catalase and oxidase activities was identified as Lactobacillus.

Molecular identification of the isolates

For molecular identification, genomic DNA was extracted from the selected Lactobacillus isolates following a standard DNA extraction protocol. PCR amplification was performed using specific primers for the 16 S rRNA gene, under the following conditions: initial denaturation at 94 °C for 2 min, followed by 30 cycles of 94 °C for 40 s, 50 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. The resulting amplicons were sequenced by Cinagene Company (Tehran, Iran). The sequences were compared with those in the NCBI database using the Basic Local Alignment Search Tool (BLAST). Based on the sequence analysis, the strain was confirmed as Lactobacillus fermentum and registered in the NCBI database under the accession number OP168796 as Lactobacillus fermentum Ab.RS23 [10].

MTT cell viability assay

Cell viability was assessed using the MTT assay to determine IC₅₀ values. HT-29 and MCF-7 cells were seeded in appropriate plates and treated with various concentrations of Lactobacillus fermentum, converted from optical density to colony-forming units per milliliter (CFU/ml), as follows: for HT-29 cells: 0.2 × 10^8, 0.5 × 10^8, 1.0 × 10^8, and 1.5 × 10^8 CFU/ml; for MCF-7 cells: 0.5 × 10^8, 1.0 × 10^8, 1.5 × 10^8, and 1.8 × 10^8 CFU/ml. Vincristine Sulfate was prepared at the following concentrations: for HT-29 cells: 5, 10, 15, and 20 µg/ml; for MCF-7 cells: 7.5, 15, 20, and 25 µg/ml. For combination treatments, selected concentrations of Vincristine Sulfate and Lactobacillus fermentum were combined based on preliminary single-treatment IC₅₀ results. The combinations were as follows: for HT-29 cells: 1.25 µg/ml + 1.5 × 10^8 CFU/ml, 1.5 µg/ml + 1.5 × 10^8 CFU/ml, 2.0 µg/ml + 1.5 × 10^8 CFU/ml, and 2.5 µg/ml + 1.5 × 10^8 CFU/ml; for MCF-7 cells: 0.135 µg/ml + 1.8 × 10^8 CFU/ml, 0.75 µg/ml + 1.8 × 10^8 CFU/ml, 0.95 µg/ml + 1.8 × 10^8 CFU/ml, and 1.9 µg/ml + 1.8 × 10^8 CFU/ml. All treatments were performed under live co-culture conditions using a transwell system, which allowed metabolite-mediated interaction between bacteria and cancer cells without direct contact. This system provided a controlled environment for studying the effects of secreted bacterial factors; however, it may not fully capture effects that require direct cell–bacteria interactions, representing a limitation of this approach. After 24 h of incubation, cell viability was assessed by the reduction of MTT to formazan, and absorbance was measured spectrophotometrically. IC₅₀ values were calculated using logarithmic regression analysis. Dose selection for combination treatments was based on sub-lethal concentrations designed to reveal potential synergistic or additive effects [11].

Real-time PCR

After determining the IC₅₀ values, MCF-7 and HT-29 cells were seeded into 6-well plates. For each cell line, three treatment groups were prepared: (1) Vincristine Sulfate, (2) Lactobacillus fermentum (OP168796), and (3) a combination of Vincristine Sulfate + Lactobacillus fermentum. Treatments were performed under live co-culture conditions using a specialized transwell filter system to separate bacteria and cells while allowing metabolite exchange. Each group was treated with the appropriate IC₅₀ concentration for 24 h. Following treatment, total RNA was extracted from each group using Abi TRIzol^® Reagent and chloroform according to the manufacturer’s protocol. RNA concentration and purity were measured using a NanoDrop1000 spectrophotometer (Thermo Scientific, Wilmington, USA), and cDNA synthesis was carried out using a commercial cDNA synthesis kit. Quantitative real-time PCR (qRT-PCR) was conducted using gene-specific primers (Table 1). and SYBR Green Master Mix on a Bio-Rad IQ5 thermocycler (Bio-Rad, Hercules, CA, USA). The expression levels of the following genes were analyzed: PTEN, AKT, BAX, Bcl-2, Caspase-3, Caspase-8, Caspase-9, Fas, mTOR, and IκB. GAPDH served as the internal control gene. The relative expression levels of target genes were calculated using the ΔΔCt method, and fold changes were used for comparison between treatment groups [12].

Table 1.

Primer sequences of genes

Primer	Forward (5̍ to 3̍)	Reverse (5̍ to 3̍)
Caspase-3	TGGTTCATCCAGTCGCTTTGT	CCCGGGTAAGAATGTGCATAAA
Caspase-9	CTCAGACCAGAGATTCGCAAAC	GCATTTCCCCTCAAACTCTCAA
Caspase-8	GACAGAGCTTCTTCGAGACAC	GCTCGGGCATACAGGCAAAT
AKT	CATCACACCACCTGACCAAT	CTCAAATGCACCCGAGAAAT
PTEN	TCCCAGTCAGAGGCGCTATG	CAAACTGAGGATTGCAAGTTC
mTOR	GACAACAGCCAGGGCCGCAT	ACGCTGCCTTTCTCGACGGC
IκB	GCTGAAGAAGGAGGCGGCTAC	TCGTACTCCTCGTCTTTTCAT
Fas	ATGCTGGGCATCTGGACCC	TCTAGACCAAGCTTTGGATTT
BAX	ATCCAGGATCGAGCAGGGCG	GGTTCTGATCAGTTCCGGCA
Bcl-2	GTTCCCTTTCCTTCCATCC	GACGGTAGCGACGAGAG
GAPDH	ATGATGATATCGCCGGCCGCTC	CCCACCATCACGCCCTGG
16 s rRNA	AACTGGAGGAAGGTGGGGAT	AGGAGGTGATCCAACCGCA

Flow cytometry

Apoptosis was evaluated in MCF-7 and HT-29 cells seeded in 6-well plates and treated for 24 h with the IC₅₀ combination of Lactobacillus fermentum and Vincristine Sulfate. Treatments were performed using a transwell co-culture system, allowing exchange of bacterial metabolites without direct contact between cells and bacteria. After incubation, cells were harvested, washed twice with cold phosphate-buffered saline (PBS), and resuspended in binding buffer. Apoptotic cells were stained with Annexin V-FITC and propidium iodide using the Annexin V-FITC/PI Apoptosis Detection Kit (BioLegend, USA) following the manufacturer’s instructions. Flow cytometry analysis was performed immediately on a BD FACSCalibur™ flow cytometer (BD Biosciences, San Jose, CA, USA). Early apoptotic cells were defined as Annexin V positive and PI negative, whereas late apoptotic or necrotic cells were both Annexin V and PI positive. Data were analyzed using FlowJo software (version 10), and the percentages of early and late apoptotic cells were calculated to quantify the apoptosis-inducing effect of the combined treatment [13].

Statistical analysis

All statistical analyses were carried out using SPSS Statistics version 24. The normality of the data distributions was assessed using the Shapiro–Wilk test, which confirmed a Gaussian distribution for all datasets (p > 0.05). To evaluate differences among the experimental groups, a one-way analysis of variance (ANOVA) was performed, followed by Tukey’s post hoc test for pairwise comparisons. Each experimental condition was tested in three independent biological replicates, conducted on different days using separate passages of cells, and each replicate was measured in triplicate. Data are reported as mean ± standard deviation (SD). A p-value of less than 0.05 was considered statistically significant, with the following levels of significance reported: (p < 0.05, p < 0.01, and p < 0.001).

Results

Cell proliferation

MTT assay was used to determine IC₅₀ values after 24 h of treatment. In HT-29 cells, Lactobacillus fermentum at ODs 0.5, 0.75, 1.0, and 1.5 (≈ 0.5–1.5 × 10⁸ CFU/ml) reduced viability in a dose-dependent manner (Fig. 2A). Vincristine sulfate alone (1.75–10 µg/ml) exhibited cytotoxicity with an IC₅₀ of 10 µg/ml (Fig. 2B). Combination treatment with vincristine (0.125–1 µg/ml) plus L. fermentum at OD 0.5 (0.5 × 10⁸ CFU/ml) markedly decreased the IC₅₀ compared to monotherapy (Fig. 2C). A similar trend was observed in MCF-7 cells. L. fermentum induced dose-dependent inhibition (Fig. 3A), vincristine alone showed IC₅₀ at 10 µg/ml (Fig. 3B), and co-treatment significantly reduced the IC₅₀ (Fig. 3C). IC₅₀ values were calculated by nonlinear regression (logarithmic dose–response) in GraphPad Prism, based on three independent biological replicates in triplicate. One-way ANOVA with Tukey’s post hoc test was applied (p < 0.05 considered significant).

Fig. 2.

Cell viability after HT-29 cell treatment. (A) Cell viability measured after treatment with Lactobacillus fermentum at ODs of 0.5, 0.75, 1.0, and 1.5, equivalent to 0.5 × 10^8, 0.75 × 10^8, 1.0 × 10^8, and 1.5 × 10^8 CFU/ml (10 µl/ml). (B) Cell viability measured after treatment with Vincristine Sulfate at concentrations of 1.75, 2.5, 5.5, and 10 µg/ml. (C) Cell viability measured after co-treatment with Vincristine Sulfate (0.125, 0.25, 0.5, and 1 µg/ml) and Lactobacillus fermentum (OD 0.5, 0.5 × 10^8 CFU/ml, 10 µl/ml). Data are presented as mean ± SD of three independent experiments (n = 3, ***p < 0.001; **p < 0.01; *p < 0.05)

Fig. 3.

Cell viability after MCF-7 cell treatment. (A) Cell viability measured after treatment with Lactobacillus fermentum at ODs of 0.5, 0.75, 1.0, and 1.5, equivalent to 0.5 × 10^8, 0.75 × 10^8, 1.0 × 10^8, and 1.5 × 10^8 CFU/ml (10 µl/ml). (B) Cell viability measured after treatment with Vincristine Sulfate at concentrations of 1.75, 2.5, 5.5, and 10 µg/ml. (C) Cell viability measured after co-treatment with Vincristine Sulfate (0.125, 0.25, 0.5, and 1 µg/ml) and Lactobacillus fermentum (OD 0.5, 0.5 × 10^8 CFU/ml, 10 µl/ml). Data are expressed as mean ± SD of three independent experiments (n = 3, ***p < 0.001; **p < 0.01; *p < 0.05)

Gene expression

qRT-PCR demonstrated significant modulation of apoptosis- and survival-related genes. In HT-29 cells, vincristine (2.5 µg/ml) combined with L. fermentum (1.5 × 10⁸ CFU/ml, OD 1.5) upregulated PTEN, BAX, Caspase-3, Caspase-8, Caspase-9, Fas, and IκB, while downregulating AKT, Bcl-2, and mTOR (Fig. 4). In MCF-7 cells, vincristine (1.9 µg/ml) plus L. fermentum (1.8 × 10⁸ CFU/ml, OD 1.8) produced a comparable pattern (Fig. 5). Relative expression was determined by the ΔΔCt method using GAPDH as reference. One-way ANOVA confirmed statistical significance (p < 0.05). These results highlight that the combination enhances apoptotic signaling while suppressing pro-survival pathways at reduced vincristine concentrations.

Fig. 4.

Quantitative analysis of gene expression in HT-29 colon cancer cells.Cells were treated for 24 h with Lactobacillus fermentum (OD 1.5, 1.5 × 10^8 CFU/ml) and Vincristine Sulfate (2.5 µg/ml). The mRNA expression levels of pro-apoptotic genes (PTEN, BAX, Caspase-3, Caspase-8, Caspase-9, Fas, and IκB) were significantly upregulated, whereas anti-apoptotic and survival-related genes (AKT, Bcl-2, and mTOR) were downregulated compared to untreated controls and monotherapy groups. Data are normalized to GAPDH and expressed as fold change (mean ± SD, p < 0.05, p < 0.01, p < 0.001)

Fig. 5.

Gene expression profile in MCF-7 breast cancer cells. Cells were treated for 24 h with Lactobacillus fermentum (OD 1.8, 1.8 × 10^8 CFU/ml) and Vincristine Sulfate (1.9 µg/ml). Treatment resulted in significant upregulation of apoptosis-inducing genes (PTEN, BAX, Caspase-3, Caspase-8, Caspase-9, Fas, and IκB) and downregulation of AKT, Bcl-2, and mTOR, indicating enhanced activation of both intrinsic and extrinsic apoptotic pathways. Results are shown as fold changes relative to untreated controls, normalized to GAPDH (mean ± SD, p < 0.05, p < 0.01, p < 0.001)

Apoptosis analysis

Flow cytometry using Annexin V-FITC/PI staining further confirmed apoptosis induction. In HT-29 cells, viability decreased from 97.64% (control) to 51.27% with co-treatment, accompanied by 17.38% apoptotic and 3.17% necrotic cells (Fig. 6). In MCF-7 cells, viability dropped from 96.52% to 48.48%, with 24.15% apoptotic and 0.49% necrotic cells (Fig. 7). Statistical analysis supported the significance of these differences (p < 0.05). Overall, the MTT, qRT-PCR, and flow cytometry data consistently demonstrate that L. fermentum potentiates vincristine-induced cytotoxicity by enhancing apoptosis and reducing the effective drug concentration.

Fig. 6.

Flow cytometry analysis of HT-29 colon cancer cells after 24-hour treatment with the combination of Lactobacillus fermentum and Vincristine Sulfate. Cell viability was detected by Annexin V-FITC/PI staining in (A) untreated HT-29 cells and (B) HT-29 cells treated with the combination. (C) Bar chart summarizing the percentages of live, early apoptotic, late apoptotic, and necrotic cells in each group. Q1: Necrotic cells, Q2: Late apoptotic cells, Q3: Early apoptotic cells, and Q4: Live cells. The combination treatment significantly reduced viable cells and increased apoptosis compared to untreated controls

Fig. 7.

Flow cytometry analysis of MCF-7 breast cancer cells after 24-hour treatment with Lactobacillus fermentum and Vincristine Sulfate. Cell viability was detected by Annexin V-FITC/PI staining in (A) untreated MCF-7 cells and (B) treated MCF-7 cells. (C) Bar chart showing the quantitative distribution of live, early apoptotic, late apoptotic, and necrotic cell populations in each condition. Q1: Necrotic cells, Q2: Late apoptotic cells, Q3: Early apoptotic cells, and Q4: Live cells. The results indicate a clear increase in apoptosis and a decrease in viability following the combination treatment

Discussion

The present study comprehensively investigated the combinational anticancer effects of Lactobacillus fermentum and Vincristine Sulfate on HT-29 (colorectal adenocarcinoma) and MCF-7 (breast adenocarcinoma) cells using a multi-tiered in vitro approach comprising MTT cell viability assays, quantitative gene expression analysis, and flow cytometric apoptosis detection. Our findings demonstrate a robust synergistic effect between the probiotic and chemotherapeutic agent, reflected in enhanced apoptotic gene expression, decreased cell viability, and increased apoptotic populations at markedly reduced Vincristine concentrations. The MTT assay revealed a substantial reduction in the effective dose of Vincristine when combined with L. fermentum. Specifically, in HT-29 cells, the IC₅₀ of Vincristine decreased from 20 µg/ml to 2.5 µg/ml in the presence of L. fermentum (1.5 × 10^8 CFU/ml, OD 1.5) (Fig. 2C), representing an 8-fold reduction. Similarly, in MCF-7 cells, the IC₅₀ dropped from 25 µg/ml to 1.9 µg/ml with L. fermentum (1.8 × 10^8 CFU/ml, OD 1.8) (Fig. 3C), corresponding to a 13-fold reduction. These results indicate that L. fermentum enhances the cytotoxic efficacy of Vincristine while potentially mitigating its systemic toxicity, aligning with prior studies demonstrating the adjuvant potential of probiotics in cancer therapy [11, 14, 15]. Quantitative real-time PCR analysis further elucidated the underlying molecular mechanisms. In both HT-29 and MCF-7 cells, combinational treatment significantly upregulated pro-apoptotic genes including PTEN, BAX, Caspase-3, Caspase-8, Caspase-9, Fas, and IκB, while concurrently downregulating anti-apoptotic and survival-promoting genes such as AKT, Bcl-2, and mTOR (Figs. 4 and 5). This gene expression pattern suggests activation of both intrinsic (mitochondrial) and extrinsic (death receptor-mediated) apoptotic pathways. Moreover, suppression of the PI3K/AKT/mTOR signaling axis, a well-established regulator of cell proliferation and survival, further reinforces the anti-proliferative effect of the combination therapy [16–18]. The involvement of PTEN as a central tumor suppressor aligns with previous evidence indicating that probiotics can upregulate PTEN, thereby inhibiting the PI3K/AKT pathway and inducing cell cycle arrest and apoptosis [19, 20]. Flow cytometry analysis corroborated these findings at the cellular level. Annexin V-FITC/PI staining revealed that combinational treatment significantly increased early and late apoptotic populations in HT-29 and MCF-7 cells (Figs. 6 and 7). Specifically, treated HT-29 cells exhibited 17.38% apoptotic cells compared to 2.36% in untreated controls, while MCF-7 cells showed 24.15% apoptotic cells versus 3.48% in controls. These observations confirm that L. fermentum potentiates Vincristine-induced apoptosis. The anticancer mechanisms of L. fermentum may involve multiple pathways, including modulation of tumor microenvironment, enhancement of host immune responses, production of bioactive metabolites such as short-chain fatty acids (SCFAs), and downregulation of oncogenic transcription factors like NF-κB and STAT3 [21, 22]. Previous studies have also demonstrated that specific Lactobacillus strains can suppress epithelial–mesenchymal transition (EMT), inhibit metastasis, and improve chemotherapeutic sensitivity in various cancer models [23, 24]. Our prior work with L. fermentum Ab.RS22 further supports this mechanism, showing downregulation of p53/AKT/PTEN signaling in HeLa cells, leading to apoptosis and reduced viability [25, 26]. Taken together, the current findings provide compelling evidence that L. fermentum can serve as a potent adjuvant to Vincristine therapy, enabling lower drug dosages while maintaining or enhancing therapeutic efficacy. The combination therapy not only promotes apoptosis through intrinsic and extrinsic pathways but also disrupts survival signaling, highlighting a multi-faceted mechanism of action that may translate into improved clinical outcomes.

Study limitations and future research directions

Despite the promising in vitro findings of this study, several limitations should be acknowledged. All experiments were conducted using only two human cancer cell lines, HT-29 and MCF-7, and responses in in vivo systems may differ due to factors such as immune interactions, systemic metabolism, and the complexity of the tumor microenvironment. Additionally, only a single probiotic strain, Lactobacillus fermentum, and a single chemotherapeutic agent, Vincristine Sulfate, were evaluated, which limits the generalizability of the results. Future research should expand the scope to include multiple probiotic strains, such as L. rhamnosus, L. casei, and Bifidobacterium species, as well as other chemotherapeutic agents like doxorubicin and cisplatin. In vivo studies using xenograft or syngeneic animal models are recommended to validate the synergistic anticancer effects observed in vitro, to examine immune modulation, and to assess potential toxicity and pharmacokinetics. Moreover, further investigations into the underlying molecular mechanisms, including the roles of bioactive metabolites, antioxidant responses, and modulation of apoptotic and survival signaling pathways, could provide deeper insight into the therapeutic potential of probiotic–chemotherapy combinations. This integrated approach would support the development of optimized combinational therapies aimed at enhancing anticancer efficacy while minimizing drug-associated toxicity.

Conclusion

This study demonstrates that the combination of Lactobacillus fermentum Ab.RS23 with Vincristine Sulfate significantly enhances anticancer activity against HT-29 and MCF-7 cells by promoting apoptosis and inhibiting survival signaling pathways. The combinational approach led to a substantial reduction in Vincristine dosage, highlighting its potential to mitigate chemotherapy-associated toxicity. These findings support the integration of specific probiotic strains as adjuvant therapies in oncology and warrant further preclinical and clinical investigations to establish their efficacy and safety profiles.

Author contributions

Abbas Asoudeh-Fard designed the study. Data were collected by Mohadeseh Asoudeh-Fard and Asghar Parsaei. Data analysis was performed by Abbas Asoudeh-Fard. The manuscript was written by Abbas Asoudeh-Fard and Asghar Parsaei. The written manuscript was reviewed and finalized by Mohadeseh Asoudeh-Fard. All authors approved the final manuscript. Graphical abstract was drawn by Abbas Asoudeh-Fard.

Funding

The author’s acknowledge Niko Gene Saba Biotech Company for providing support through equipment and technical assistance (grant NO.14404).

Data availability

The datasets generated and/or analyzed during the current study are not publicly available due to institutional regulations and ongoing further analyses but are available from the corresponding author upon reasonable request.

Declarations

Ethics approval

There is none to be disclosed.

Name of the institution where the work was done

Niko Gene Saba Biotech Company (NGB), Shiraz, Iran. All information is correctly placed and consistent with the manuscript metadata.

Compliance with ethical guidelines

The study does not contain any experiments on humans or animals.

Competing interests

The authors declare no competing interests.