Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Nov 8.
Published in final edited form as: Brain Behav Immun. 2025 Aug 28;130:106096. doi: 10.1016/j.bbi.2025.106096

Active coping mitigates the effects of stress on glucocorticoid levels in the prefrontal cortex

Matthew G Frank a,b,*, Emily S Levy a, Gianni N Bonnici a, Steven F Maier a, Michael V Baratta a
PMCID: PMC12593236  NIHMSID: NIHMS2121039  PMID: 40885498

Abstract

Exposure to stressors elevates glucocorticoid (GC) levels in the periphery and brain, directly impacting neurogenesis, neuronal morphology and function, as well as neuroinflammatory processes. The ability to exert behavioral control over an adverse event prevents many of the sequelae of stressor exposure; however, extensive evidence indicates that this protection occurs without concomitant reductions in hypothalamic–pituitary–adrenal (HPA) axis activity. Given that brain GC levels can be regulated independently of changes in HPA output, we investigated whether controllability might alter corticosterone (CORT) levels and CORT-sensitive gene expression in rat brain, even though it does not modulate peripheral CORT. We found that behavioral control (escapable shock, ES) selectively attenuated stress-induced CORT and modulated CORT-sensitive genes (Nr3c1, Ilb, Nlrp3, and Cd200r1), as well as IL-1β protein in the medial prefrontal cortex (PFC) relative to uncontrollable stress (inescapable shock, IS). Stress-induced expression of PFC 11β-hydroxysteroid dehydrogenase type 1, an enzyme that regulates local concentrations of CORT, was increased (mRNA) and decreased (protein) in ES relative to IS. These controllability effects were absent in other brain structures previously implicated in the differential behavioral outcomes of ES and IS. Together, the findings provide initial evidence that active coping with a stressor is a key determinant for regulating GC action, potentially shaping cognitive and neuroimmune responses to adverse events at a local tissue level.

Keywords: Coping, Stressor, Controllability, Glucocorticoid, Corticosterone, Prefrontal, Cortex, Neuroinflammation, Priming

1. Introduction

Exposure to stressors activates the hypothalamic–pituitary–adrenal (HPA) axis resulting in the secretion of glucocorticoids (GCs), which play a critical role in an organism’s ability to adapt to homeostatic challenge (Sapolsky, 1999). In brain structures that support the various cognitive and behavioral responses to challenge, excess levels of GCs, such as those elicited by stressors, have a profound impact on neuroinflammation and neural circuit function through regulation of transcriptional output, dendritic spine dynamics, and overall cellular activity (McEwen et al., 2015; Sorrells and Sapolsky, 2007). Thus, factors that mitigate stress-induced glucocorticoid release may attenuate the consequences of adverse events.

Adverse events produce outcomes that are determined not only by the physical nature of the event but also by complex cognitive factors including coping ability. Behavioral control over some aspect of a stressor (e.g., its termination) recruits a corticostriatal system involving the medial prefrontal cortex (PFC) and dorsomedial striatum (DMS) that potently blunts a number of outcomes typically produced by a physically-identical uncontrollable stressor (Baratta et al., 2023). That is, exposure to uncontrollable, but not controllable, stressors leads to a constellation of behavioral outcomes that include deficits in shuttle box escape (Seligman and Maier, 1967), increased social avoidance (Christianson et al., 2008), enhanced fear (Baratta et al., 2007), and potentiated drug seeking (Will et al., 1998). Moreover, a single experience of behavioral control protects against the behavioral consequences of future adverse events, even those that are uncontrollable and take place in a separate context from the original control experience (Amat et al., 2006). It is important to note that not all responses to adverse events are modulated by control. For example, the experimental parameters that produce the differential outcomes mentioned above do not produce different levels of HPA activity. Controllable and physically identical uncontrollable stressors lead to equivalent peak levels and decay rates of plasma corticosterone (CORT) and adrenocorticotropic hormone (Maier et al., 1986), along with an equivalent reduction in plasma corticosteroid-binding globulin (Deak et al., 1997). We and others have also demonstrated that acute exposure to uncontrollable stressors elevates GC levels in the brain (Frank et al., 2019); however, whether this increase (rather than peripheral CORT) is modulated by the controllability of the stressor – one of the few coping processes that can be experimentally manipulated in animals – has not been examined.

2. Methods

2.1. Animals

Male Sprague-Dawley rats (60 –90 d of age; Envigo, Indianapolis, IN) were maintained on a 12-h light–dark cycle (lights on at 0700 h) with ad libitum access to food and water. Rats were pair-housed and allowed to acclimate to colony conditions for at least one week prior to experimentation. Experiments were approved by the IACUC of the University of Colorado Boulder in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals as well as the ARRIVE guidelines for animal use.

2.2. Wheel-turn escapable stress (ES)/yoked inescapable stress (IS) procedure

For manipulation of stressor controllability, subjects were run in a triadic design as previously described (Baratta et al., 2007). One subject of each triad received escapable stress (ES), a second received yoked inescapable stress (IS), and a third remained undisturbed in the colony (home cage control, HCC). Each ES and IS rat were placed in small individual plexiglass boxes with a wheel mounted in the front. The tail was secured to a Plexiglas rod extending from the back of the box and affixed with two copper electrodes and electrode paste. The single stress session consisted of 100 tailshock trials (1.0 mA) presented on a 60-s variable interval schedule. Initially, the shock could be terminated by a quarter turn of the wheel by the ES rat. When trials were completed in less than 5 s, the response requirement was increased by one-quarter turn of the wheel, up to a maximum of four full turns of the wheel. The requirement was reduced if the trial was not completed in less than 5 s. If the trial was not completed in 30 s, the shock was automatically terminated, and the requirement was reset to a one-quarter turn of the wheel. This procedure maintains consistent escape behavior in ES rats and shocks at durations (3–5 s range) sufficient to produce the typical outcomes in IS rats. For yoked IS rats, their behavior had no consequence; the onset and offset of each tailshock matched those of their ES partner.

2.3. Tissue collection

Immediately following the final shock trial, rats were anesthetized with isoflurane (2.5 %). Blood was collected from the heart and subjects underwent transcardial perfusion with ice-cold saline (0.9 %) to remove peripheral immune leukocytes from brain vasculature. Whole brain was dissected and flash frozen in isopentane and stored at −80 °C.

2.4. Micropunching of brain regions

Brains were sectioned on a Leica cryostat at −20 °C until the region of interest was reached. Tissue micropunches were extracted from discrete brain regions using a brain punch tool (1 mm diameter × 1 mm depth) and stored at −80 °C until assayed. Brain regions included the PFC and DMS, which are critical for the detection/processing of control, as well as the dorsolateral striatum (DLS) and ventral tegmental area (VTA), which are implicated in stress-dependent behaviors.

2.5. Corticosterone (CORT) and interleukin-1β (IL-1β) ELISA

Tissue micropunches were sonicated using a tissue extraction reagent (ThermoFisher, cat#: FNN0071) supplemented with a protease inhibitor cocktail (MilliporeSigma, cat#: P2714). Homogenate was centrifuged (10 min, 14,000 × g, 4 °C) and supernatant collected and stored at −80 °C. Total protein was quantified using a Bradford assay. CORT was measured using a competitive immunoassay (Enzo Life Sciences, cat#: ADI-900–097) and IL-1β using a standard sandwich ELISA (ThermoFisher, cat#: BMS630) as described in the manufacturer’s protocol. CORT and IL-1β levels are quantified as pg/mg total protein.

2.6. Real time RT-PCR measurement of gene expression

Total RNA was isolated from micropunches using TRI Reagent (MilliporeSigma, cat#: 93289) and phenol:chloroform extraction (Chomczynski and Sacchi, 1987). Total RNA was quantified using a NanoDrop 2000 spectrophotometer (ThermoFisher). cDNA synthesis was performed using the SuperScript IV Reverse Transcriptase kit (ThermoFisher, cat#: 18064014). cDNA sequences were obtained from Genbank at the National Center for Biotechnology Information (NCBI; https://www.ncbi.nlm.nih.gov). Primer sequences were designed using the Operon Oligo Analysis Tool (https://www.operon.com/tools/oligo-analysis-tool.aspx) and tested for sequence specificity using the Basic Local Alignment Search Tool at NCBI (Altschul et al., 1997). Primers were obtained from ThermoFisher. Primer specificity was verified by melt curve analyses. All primers were designed to span exon-exon boundaries and thus exclude amplification of genomic DNA. Primer sequences for CORT-related regulatory genes and CORT-responsive genes were as follows: β-actin (Actb), F: TTCCTTCCTGGGTATGGAAT, R: GAGGAGCAATGATCTTGATC; CD200 receptor 1 (Cd200r1), F: TAGAGGGGGTGACCAATTAT, R: TACATTTTCTGCAGCCACTG; Glucocorticoid receptor or Nuclear Receptor Subfamily 3 Group C Member 1 (Nr3c1), F: TCTCTCCTCAGTTCCTAAGG, R: GATTCTCAACCACCTCATGC; 11β-hydroxysteroid dehydrogenase type 1(Hsd11b1), F: TCCATGGCTGGGAAAATGAC, R: AGAGTGATGGACACGTTGAC; Interleukin-1β (Il1b), F: CCTTGTGCAAGTGTCTGAAG, R: GGGCTTGGAAGCAATCCTTA; NOD-like receptor family pyrin domain-containing 3 (Nlrp3), F: AGAAGCTGGGGTTGGTGAATT, R: GTTGTCTAACTCCAGCATCTG. PCR amplification of cDNA was performed using the QuantiTect SYBR Green PCR Kit (Qiagen, cat#: 204145). Formation of PCR product was monitored in real time using the CFX96 Touch Real-Time PCR Detection System (BioRad). Relative gene expression was determined using Actb as the housekeeping gene and the 2−ΔΔCT method (Livak and Schmittgen, 2001).

2.7. 11β-hydroxysteroid dehydrogenase type I (11β-HSD1) western blot

Tissue homogenates (10 μg total protein) were diluted in lithium dodecyl sulfate (1x) sample buffer (ThermoFisher, cat#: NP0007) and dithiothreitol (50 mM, ThermoFisher, cat#: NP0004), heated to 70 °C for 10 min, and loaded into a standard polyacrylamide 4–12 % Bis-Tris gel (ThermoFisher, cat#: NP0323BOX). SDS-PAGE was performed in NuPAGE MES SDS Running Buffer (ThermoFisher, cat#: NP0002) at 175 V for ~45 min. Protein was transferred onto a nitrocellulose membrane using an iBlot dry transfer system (ThermoFisher, cat#: IB001). The membrane was then blocked with Odyssey Blocking Buffer (LI-COR Biosciences, cat#: 927–4000) for 1 h and incubated overnight at 4 °C in Odyssey Blocking Buffer with the following primary antibodies: rabbit polyclonal to 11β-HSD1 (1:1,000 dilution, ThermoFisher, cat#: PA5–21586) and mouse monoclonal to β-actin (1:100,000, Sigma-Aldrich, cat#: A5316). The membrane was washed 4x in 1x PBS + 0.1 % Tween and then incubated in Odyssey Blocking Buffer containing goat anti-rabbit (LI-COR Biosciences, cat#: 925–32211) and goat anti-mouse (LI-COR Biosciences, cat#: 925–32210) IRDye 800CW secondary antibodies at a concentration of 1:10,000 for 1 h at room temperature and the membrane was washed 4x in 1x PBS + 0.1 % Tween. Protein expression was quantified using an Odyssey Infrared Imager (LI-COR Biosciences) and expressed relative to the housekeeping protein β-actin.

2.8. Statistical analysis

All data are presented as mean ± SEM. Statistical analyses consisted of ANOVA followed by post-hoc tests (Benjamini FDR procedure) using GraphPad Prism Version 10.4. Threshold for statistical significance was set at α = 0.05. Sample sizes are provided in figure captions.

3. Results

3.1. Effect of stressor controllability on brain region CORT concentration

All ES subjects learned the instrumental controlling response with proficiency similar to prior studies (Coleman et al., 2024). To measure the quality of escape performance, both the response requirement attained across trials (number of quarter turns to terminate the shock) and the time taken to terminate each tailshock (escape latency) were recorded (Fig. 1A). The mean latency to terminate shock during the final block of 10 trials was 2.48 s, which was significantly shorter than the mean latency of 4.75 s during the first block of 10 trials (t(13) = 3.51, p < 0.001).

Fig. 1. Effect of controllability on brain and serum CORT levels.

Fig. 1.

Open in a new tab

Rats were exposed to escapable stress (ES), inescapable stress (IS), or served as home cage controls (HCC). (A) The mean (± SEM) number of quarter turns of the wheel attained as the escape requirement on each trial (left panel) and the mean (± SEM) time to reach escape criterion per trial (right panel) for ES subjects in all experiments (N = 14). (B) Schematic illustration of micropunch locations taken from brains collected immediately after the stress procedure. Corticosterone (CORT) levels were subsequently measured in (C) medial prefrontal cortex (PFC), (D) dorsomedial striatum (DMS), (E) dorsolateral striatum (DLS), (F) ventral tegmental area (VTA), and (G) serum. Data in C-G are presented as % of HCC. N = 6–8 animals per group. Experimental group post-hoc comparisons, ** p < 0.01, **** p < 0.0001.

CORT levels were measured in brain structures selectively engaged by ES (PFC, DMS) and other stress-responsive but not controllability sensitive regions (VTA, DLS) (Fig. 1B). In the PFC (Fig. 1C), controllability differentially modulated CORT levels (F = 23.28(2,19), p < 0.0001). Post-hoc comparisons revealed that both ES (t(19) = 3.57, p < 0.01) and IS (t(19) = 6.81, p < 0.0001) increased CORT concentrations relative to HCC. However, stress-induced CORT levels were significantly reduced in ES compared to IS (t(19) = 3.5, p < 0.01). Controllability failed to modulate stress-induced CORT levels in other structures examined, with only a main effect of stress on CORT reaching significance in DMS (F(2,20) = 22.57, p < 0.0001) (Fig. 1D), DLS (F(2,18) = 17.61, p < 0.0001) (Fig. 1E), and VTA (F(2,21) = 23.14, p < 0.0001) (Fig. 1F).

Serum concentrations of CORT were also measured to determine if the effects of controllability extended to peripheral CORT. Consistent with prior studies (Helmreich et al., 1999; Maier et al., 1986), stress increased serum CORT relative to HCC (F(2,21) = 21.50, p < 0.001), however ES (727 % of HCC) and IS (731 % of HCC) produced comparable increases (t(21) = 0.03, p = 0.97) (Fig. 1G).

3.2. Effect of stressor controllability on CORT-sensitive genes in the PFC and DMS

To determine whether the PFC and DMS CORT differences between ES and IS subjects produce functional consequences, we examined the effects of controllability on CORT-sensitive gene expression. Genes involved in neuroinflammatory processes (Il1b, Nlrp3, and Cd200r1) were selected based on our prior data showing that both a single session of IS and systemic administration of CORT modulates expression of these genes (Frank et al., 2019; Nguyen et al., 1998). Genes that modulate CORT signaling (Nr3c1) and local concentrations (Hsd11b1) were also examined (Herman, 2022; Seckl, 1997).

3.2.1. PFC

Stress-induced CORT suppresses the expression of the proinflammatory cytokine Il1b (Nguyen et al., 1998) and the microglial checkpoint receptor Cd200r1 (Frank et al., 2019), thus lower PFC CORT levels in ES subjects should mitigate the effects of IS on these genes. Consistent with CORT differences between ES and IS subjects, we found that ES resulted in reduced suppression of Il1b expression compared to IS subjects (F(2,15) = 20.76, p < 0.0001; ES vs IS, p < 0.05) (Fig. 2A). A similar pattern was observed for Cd200r1 (F(2,15) = 5.63, p = 0.01; ES vs IS, p < 0.01) (Fig. 2B). The NLRP3 inflammasome is a multiprotein complex involved in IL-1β production (Swanson et al., 2019), and consistent with the effects of ES on PFC Il1b and Cd200r1 expression, ES attenuated the suppressive effects of IS on Nlrp3 expression (F(2,15) = 51.18, p < 0.0001; ES vs IS, p < 0.01) (Fig. 2C). GCs activate the glucocorticoid receptor (Nr3c1), which translocates to the nucleus when bound by GCs and functions as a transcription factor to regulate an array of biological processes including inflammation, metabolism, and neuroplasticity (Myers et al., 2014; Weikum et al., 2017). GCs also regulate a key enzyme in the brain (11β-HSD1) that mediates the interconversion of cortisone and CORT, thereby modulating local concentrations of GCs (Seckl, 1997). Therefore, we explored the effects of stressor control on expression of these genes. ES upregulated Nr3c1 expression compared to HCC and IS subjects (F(2,15) = 4.83, p < 0.05) (Fig. 2D). Regarding Hsd11b1 expression, ES blocked the IS-induced reduction of expression to levels comparable to HCC (F(2,15) = 6.35, p < 0.05; ES vs IS, p < 0.01, IS vs HCC, < 0.01) (Fig. 2E). Since 11β-HSD1 typically drives the conversion of cortisone to increased tissue concentrations of CORT, the effect of ES increasing 11β-HSD1 mRNA is not consistent with the observed effect of ES decreasing CORT levels in the PFC. However, the correlation between mRNA and protein levels is relatively low (Perl et al., 2017). Therefore, we examined the effect of controllability on 11β-HSD1 protein levels in the PFC. ES reduced 11β-HSD1 protein compared to IS, while IS increased levels relative to HCC (F(2,19) = 4.70, p = 0.02; ES vs IS, p < 0.05; IS vs HCC, p < 0.01; ES vs HCC, p = 0.62) (Fig. 2F). Consistent with controllability effects on Il1b gene expression, ES attenuated the suppressive effect of IS on IL-1β protein levels (F(2,21) = 4.96, p = 0.02; ES vs IS, p < 0.05; IS vs HCC, p < 0.05; ES vs HCC, p = 0.86) (Fig. 2G). IL-1β protein was also assayed in serum but was undetected in all samples.

Fig. 2. Effect of controllability on CORT-sensitive genes in the medial prefrontal cortex (PFC).

Fig. 2.

Open in a new tab

Rats were exposed to escapable stress (ES), inescapable stress (IS), or served as home cage controls (HCC). Immediately after termination of stress, (A) Il1b, (B) Cd200r1, (C) Nlrp3, (D) Nr3c1, (E) Hsd11b1 gene expression, and (F) Hsd11b1 and (G) IL-1β protein was measured in PFC. RGE = relative gene expression. Data are presented as % of HCC. N = 6–8 animals per group. Experimental group post-hoc comparisons, * p < 0.05, ** p < 0.01, **** p < 0.0001.

3.2.2. DMS

In DMS, CORT levels did not differ between ES and IS subjects; therefore, we examined if CORT-sensitive gene expression would follow this pattern of tissue CORT change. While stress per se reduced Il1b (F(2,15) = 129.6, p < 0.0001; ES vs IS, p = 0.40) (Fig. 3A), Cd200r1 (F(2,15) = 11.66, p < 0.001; ES vs IS, p = 0.81) (Fig. 3B), Nlrp3 (F(2,15) = 42.6, p < 0.0001; ES vs IS, p = 0.47) (Fig. 3C), and Hsd11b1 (F(2,15) = 9.5, p < 0.01; ES vs IS, p > 0.05) (Fig. 3E), expression did not differ between ES and IS subjects. Stressor exposure failed to alter expression of Nr3c1 (F(2,15) = 1.37, p = 0.28) (Fig. 3D) and IL-1β protein (F(2,20) = 1.05, p = 0.37) (Fig. 3F).

Fig. 3. Effect of controllability on CORT-sensitive genes in the dorsomedial striatum (DMS).

Fig. 3.

Open in a new tab

Rats were exposed to escapable stress (ES), inescapable stress (IS), or served as home cage controls (HCC). Immediately after termination of stress, (A) Il1b, (B) Nlrp3, (C) Cd200r1, (D) Hsd11b1, (E) Nr3c1 gene expression and (F) IL-1β protein was measured in DMS. RGE = relative gene expression. Data are presented as % of HCC. N = 6–8 animals per group. Experimental group post-hoc comparisons, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

4. Discussion

The present findings suggest that instrumental control over a stressor differentially regulates levels of GCs across corticostriatal and midbrain regions. We found that CORT levels in the PFC were uniquely sensitive to the effects of control, and this effect was reflected in changes in CORT-sensitive gene expression. The impact of behavioral control on GC levels was not observed in other brain regions including the DMS, DLS, and VTA. Consistent with prior studies (Helmreich et al., 1999; Maier et al., 1986), ES and IS produced an equivalent increase in serum concentrations of GCs. Because GCs are lipophilic and can readily cross the blood–brain barrier (Timmermans et al., 2019), it is often presumed that local tissue concentrations of GCs should reflect systemic concentrations (Salehzadeh and Soma, 2021). However, local concentrations of GCs often do not reflect blood concentrations due to local metabolic processes (Salehzadeh and Soma, 2021). 11β-HSD1 is a key enzyme in the brain that mediates the metabolic process of converting cortisone to corticosterone, thereby increasing local concentrations of GCs (Seckl, 1997). Importantly, the proportion of cells expressing 11β-HSD1 differs widely across different brain regions (Pelletier et al., 2007). ES decreased protein levels of 11β-HSD1 compared to IS in the PFC, which might mediate the effect of ES on GCs and account for the disconnect between the effect of behavioral control on GC levels in serum and PFC. It must be noted that ES decreased 11β-HSD1 gene expression at this timepoint, but increased gene expression could have occurred earlier, a possibility that awaits further study.

The present study found that behavioral control selectively modulated CORT-sensitive genes in the PFC that are involved in neuroinflammatory processes. Stress-induced GCs modulate expression of Ilb, Cd200r1, and Nlrp3 (Frank et al., 2019; Nguyen et al., 1998) and GCs are both necessary and sufficient to prime neuroinflammatory processes to future proinflammatory insults (Frank et al., 2013). Thus, the suppressive effect of behavioral control on GCs in the PFC might attenuate the priming effects of uncontrollable stress, thereby mitigating the neuroinflammatory and ensuing sickness response to future immune challenges.

In addition to priming mechanisms, local tissue regulation of stress-induced GCs may be advantageous in conditions where PFC function is needed to thrive. Effective coping requires evaluation of environmental contingencies, such as detecting the contingency between the controlling response (wheel turn) and stressor termination (outcome) in the present paradigm. Evidence suggests that glucocorticoid action during acute stress rapidly attenuates the excitability of neurons within the main output layer of the PFC (Franco-Villanueva et al., 2025), which might result in reduction of PFC coordination with structures that support the cognitive operations of behavioral control (Baratta et al., 2023). Thus, local regulation of GC levels within the PFC may serve to maintain and/or optimize its engagement during exposure to significant adversity.

Acknowledgments

This research was supported by grants from the National Institutes of Health (R01 MH050479; MVB, SFM). Fig. 1B was created with BioRender.com.

Footnotes

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

CRediT authorship contribution statement

Matthew G. Frank: Writing – review & editing, Writing – original draft, Supervision, Project administration, Methodology, Investigation, Formal analysis, Conceptualization. Emily S. Levy: Investigation, Formal analysis. Gianni N. Bonnici: Investigation. Steven F. Maier: Writing – review & editing, Funding acquisition, Formal analysis, Conceptualization. Michael V. Baratta: Writing – review & editing, Writing – original draft, Supervision, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Conceptualization.

Data availability

Data will be made available on request.

References

  1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ, 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amat J, Paul E, Zarza C, Watkins LR, Maier SF, 2006. Previous experience with behavioral control over stress blocks the behavioral and dorsal raphe nucleus activating effects of later uncontrollable stress: role of the ventral medial prefrontal cortex. J. Neurosci. 26, 13264–13272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baratta MV, Christianson JP, Gomez DM, Zarza CM, Amat J, Masini CV, Watkins LR, Maier SF, 2007. Controllable versus uncontrollable stressors bi-directionally modulate conditioned but not innate fear. Neuroscience 146, 1495–1503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baratta MV, Seligman MEP, Maier SF, 2023. From helplessness to controllability: toward a neuroscience of resilience. Front. Psych. 14, 1170417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chomczynski P, Sacchi N, 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. [DOI] [PubMed] [Google Scholar]
  6. Christianson JP, Paul ED, Irani M, Thompson BM, Kubala KH, Yirmiya R, Watkins LR, Maier SF, 2008. The role of prior stressor controllability and the dorsal raphe nucleus in sucrose preference and social exploration. Behav. Brain Res. 193, 87–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Coleman PT, Costanza-Chavez GW, Martin HN, Amat J, Frank MG, Sanchez RJ, Potter GJ, Mellert SM, Carter RK, Bonnici GN, Maier SF, Baratta MV, 2024. Prior experience with behavioral control over stress facilitates social dominance. Neurobiol. Stress 28, 100597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Deak T, Meriwether JL, Fleshner M, Spencer RL, Abouhamze A, Moldawer LL, Grahn RE, Watkins LR, Maier SF, 1997. Evidence that brief stress may induce the acute phase response in rats. Am. J. Phys. Anthropol. 273, R1998–R2004. [DOI] [PubMed] [Google Scholar]
  9. Franco-Villanueva A, Ford NC, Morano RL, Packard BA, Baccei ML, Herman JP, 2025. Time-dependent Actions of Corticosterone on Infralimbic Cortex Pyramidal Neurons of Adult Male Rats. J. Neurosci. 45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Frank MG, Annis JL, Watkins LR, Maier SF, 2019. Glucocorticoids mediate stress induction of the alarmin HMGB1 and reduction of the microglia checkpoint receptor CD200R1 in limbic brain structures. Brain Behav. Immun. 80, 678–687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Frank MG, Watkins LR, Maier SF, 2013. Stress-induced glucocorticoids as a neuroendocrine alarm signal of danger. Brain Behav. Immun. 33, 1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Helmreich DL, Watkins LR, Deak T, Maier SF, Akil H, Watson SJ, 1999. The effect of stressor controllability on stress-induced neuropeptide mRNA expression within the paraventricular nucleus of the hypothalamus. J. Neuroendocrinol. 11, 121–128. [DOI] [PubMed] [Google Scholar]
  13. Herman JP, 2022. The neuroendocrinology of stress: Glucocorticoid signaling mechanisms. Psychoneuroendocrinology 137, 105641. [DOI] [PubMed] [Google Scholar]
  14. Livak KJ, Schmittgen TD, 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408. [DOI] [PubMed] [Google Scholar]
  15. Maier SF, Ryan SM, Barksdale CM, Kalin NH, 1986. Stressor controllability and the pituitary-adrenal system. Behav. Neurosci. 100, 669–674. [DOI] [PubMed] [Google Scholar]
  16. McEwen BS, Bowles NP, Gray JD, Hill MN, Hunter RG, Karatsoreos IN, Nasca C, 2015. Mechanisms of stress in the brain. Nat. Neurosci. 18, 1353–1363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Myers B, McKlveen JM, Herman JP, 2014. Glucocorticoid actions on synapses, circuits, and behavior: implications for the energetics of stress. Front. Neuroendocrinol. 35, 180–196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nguyen KT, Deak T, Owens SM, Kohno T, Fleshner M, Watkins LR, Maier SF, 1998. Exposure to acute stress induces brain interleukin-1beta protein in the rat. J. Neurosci. 18, 2239–2246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pelletier G, Luu-The V, Li S, Bujold G, Labrie F, 2007. Localization and glucocorticoid regulation of 11beta-hydroxysteroid dehydrogenase type 1 mRNA in the male mouse forebrain. Neuroscience 145, 110–115. [DOI] [PubMed] [Google Scholar]
  20. Perl K, Ushakov K, Pozniak Y, Yizhar-Barnea O, Bhonker Y, Shivatzki S, Geiger T, Avraham KB, Shamir R, 2017. Reduced changes in protein compared to mRNA levels across non-proliferating tissues. BMC Genomics 18, 305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Salehzadeh M, Soma KK, 2021. Glucocorticoid production in the thymus and brain: Immunosteroids and neurosteroids. Brain Behav Immun Health 18, 100352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sapolsky RM, 1999. Glucocorticoids, stress, and their adverse neurological effects: relevance to aging. Exp. Gerontol. 34, 721–732. [DOI] [PubMed] [Google Scholar]
  23. Seckl JR, 1997. 11beta-Hydroxysteroid dehydrogenase in the brain: a novel regulator of glucocorticoid action? Front. Neuroendocrinol. 18, 49–99. [DOI] [PubMed] [Google Scholar]
  24. Seligman ME, Maier SF, 1967. Failure to escape traumatic shock. J. Exp. Psychol. 74, 1–9. [DOI] [PubMed] [Google Scholar]
  25. Sorrells SF, Sapolsky RM, 2007. An inflammatory review of glucocorticoid actions in the CNS. Brain Behav. Immun. 21, 259–272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Swanson KV, Deng M, Ting JP, 2019. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat. Rev. Immunol. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Timmermans S, Souffriau J, Libert C, 2019. A General Introduction to Glucocorticoid Biology. Front. Immunol. 10, 1545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Weikum ER, Knuesel MT, Ortlund EA, Yamamoto KR, 2017. Glucocorticoid receptor control of transcription: precision and plasticity via allostery. Nat. Rev. Mol. Cell Biol. 18, 159–174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Will MJ, Watkins LR, Maier SF, 1998. Uncontrollable stress potentiates morphine’s rewarding properties. Pharmacol. Biochem. Behav 60, 655–664. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

RESOURCES