Ellagic Acid and Its Nanoparticles Mitigate Atherosclerosis by Elevating Low‐Density Lipoprotein Receptor Levels Through Targeting of the Epidermal Growth Factor Receptor

ABSTRACT

Atherosclerosis is a chronic vascular disease characterized by the accumulation of cholesterol‐rich lipids within the intima of large and medium‐sized arteries. It is a leading cause of morbidity and mortality worldwide, contributing to the majority of myocardial infarctions and strokes. Ellagic acid (EA), a naturally occurring polyphenolic compound found in various plant species, exhibits promising potential in enhancing cholesterol metabolism and reducing the risk of atherosclerosis. However, the precise mechanisms and molecular targets underlying EA's cholesterol‐regulating effects remain poorly understood. In this study, we demonstrate that EA effectively binds to the epidermal growth factor receptor (EGFR), exhibiting a dissociation constant (Kd) of 4.33 × 10⁻⁷ M and a binding energy of −7.1 kcal/mol. This binding activates EGFR and specifically engages the mitogen‐activated protein kinase (MAPK) pathway, leading to the upregulation of low‐density lipoprotein receptor (LDLR) expression in HepG2 cells. Furthermore, cetuximab, an EGFR‐blocking antibody, inhibits the LDLR upregulation induced by EA, confirming EGFR as a key target in the regulation of LDLR expression. To evaluate the in vivo effects of EA on atherosclerosis, we encapsulated EA within human serum albumin to form nanoparticles (EA‐NPs). This approach addresses poor water solubility and its tendency to convert into urolithin derivatives of EA following oral administration. In HepG2 cells, EA‐NPs significantly enhanced LDLR expression, accompanied by increased phosphorylation of EGFR and extracellular signal‐regulated kinase (ERK). In an ApoE⁻/⁻ mouse model, EA‐NPs exhibited potent anti‐atherosclerotic effects mediated through the EGFR and MAPK pathways. Additionally, EA‐NPs reduced hepatic lipid accumulation and attenuated the formation of aortic plaques. In conclusion, EA and its nanoparticle formulation effectively impede the progression of atherosclerosis, underscoring their therapeutic potential. These findings provide a robust foundation for the development of EA‐based strategies as a viable daily therapeutic intervention for atherosclerosis management.

Ellagic acid and its nano‐particles increase LDLR levels through targeting the EGFR.

Abbreviations

5‐Azac

5‐aztidine

AREs

Uridine‐rich elements

EA

Ellagic acid

EA‐naps

EA‐loaded HSA nanoparticles

EGFR

Epidermal growth factor receptor

EGFR‐ERK

EGFR‐extracellular signal‐regulated kinase

ERK‐RSK

ERK‐ribosomal protein S6 kinase

HSA

Human serum albumin

LDL

Low‐density lipoprotein

LDL‐c

Low‐density lipoprotein cholesterol

LDLR

Low‐density lipoprotein receptor

mRNA

Messenger RNA

1. Introduction

Atherosclerosis is a chronic vascular disease characterized by the accumulation of cholesterol‐laden lipids within the intima of large and medium‐sized arteries. This condition exhibits a high prevalence and is associated with significant morbidity and mortality rates, serving as a critical pathological foundation for cardiovascular diseases such as coronary heart disease, peripheral vascular disease, and other arterial disorders. Consequently, atherosclerosis poses a substantial threat to human health, longevity, and quality of life [1, 2]. Dyslipidemia is widely recognized by the global medical community as the primary driver of atherosclerosis. Research has demonstrated that reducing low‐density lipoprotein cholesterol (LDL‐C) levels can effectively mitigate the incidence of atherosclerosis [3]. This strategy has thus become a cornerstone of therapeutic interventions aimed at lowering atherosclerosis risk.

Currently, lipid‐lowering agents, such as statins, constitute the primary pharmacological approach for managing atherosclerosis in clinical settings. However, prolonged use of these drugs is associated with severe adverse effects, including hepatotoxicity, skeletal muscle damage, and an elevated risk of malignancy. As a result, existing therapeutic options for atherosclerosis remain limited, underscoring the urgent need for research and development of novel pharmacological agents [4].

The low‐density lipoprotein receptor (LDLR) is a pivotal membrane receptor in maintaining cholesterol homeostasis [5]. LDL‐C is predominantly cleared from the bloodstream via LDLR‐mediated endocytosis in the liver, accounting for over 70% of total LDL particle clearance [5, 6, 7, 8]. Consequently, the role of LDLR in regulating LDL‐C levels has garnered significant attention in recent years. Messenger RNA (mRNA) turnover is a critical mechanism for modulating protein expression, with adenosine‐ and uridine‐rich elements (AREs) in the 3′ untranslated region (3′ UTR) of mRNA playing a key role in controlling mRNA stability [9]. LDLR mRNA is inherently unstable, likely due to rapid degradation following interactions with ARE‐binding proteins. Studies have indicated that activation of the epidermal growth factor receptor‐extracellular signal‐regulated kinase (EGFR‐ERK) signaling pathway enhances LDLR mRNA stability. Additionally, ZFP36 ring finger protein‐like 1 (ZFP36L1) and ZFP36L2 regulate LDLR mRNA stability through the ERK‐ribosomal protein S6 kinase (ERK‐RSK) pathway [10]. Compounds such as berberine and 5‐azacytidine (5‐Azac) have been shown to stabilize LDLR mRNA by activating ERK signaling [11, 12]. However, the precise mechanisms underlying this post‐transcriptional regulation remain elusive.

Ellagic acid (EA) is a naturally occurring polyphenolic compound widely distributed in various berries (e.g., pomegranate, blueberry, grape, strawberry) and tea [13]. It exhibits a range of biological activities, including hepatoprotection, lipid reduction, and amelioration of cardiovascular diseases, highlighting its substantial potential in biomedical applications [14, 15]. Research has demonstrated that EA can mitigate obesity by inhibiting the expression of key adipogenic proteins in preadipocytes and preventing triglyceride accumulation in adipocytes, thereby reducing lipid deposition [16]. EA is regarded as a potent, non‐toxic natural compound with diverse pharmacological properties. However, its utility is hampered by poor water solubility (< 10 μg/mL), extremely low bioavailability (< 0.06%), and a limited blood concentration (0.1–0.4 μmol/L). In vivo, unabsorbed EA is metabolized by intestinal flora primarily into urolithins (A, B, C, D) and, to a lesser extent, urolithins M5 and M6, significantly constraining its pharmacological efficacy [17].

Recent advancements in albumin‐based drug delivery systems have enabled the administration of EA via injection. Human serum albumin (HSA), a natural protein composed of 585 amino acids with 17 disulfide bonds and one free sulfhydryl group, is widely utilized in drug delivery and disease treatment. Its tertiary structure comprises three homologous domains (I, II, III) linked by disulfide bonds, with each domain consisting of two subdomains (A and B) [18]. HSA features two primary drug‐binding sites in subdomains IIA and IIIA, which facilitate the binding of hydrophobic drugs and enhance their bioavailability [19, 20]. As the most abundant protein in serum, HSA offers exceptional biocompatibility, biodegradability, and non‐immunogenicity, making it an ideal carrier for hydrophobic drugs and a staple in pharmaceutical applications [21].

The U.S. Food and Drug Administration has approved Abraxane, an albumin‐bound paclitaxel nanoparticle, for the treatment of metastatic breast cancer [22]. Similarly, Yang et al. developed HSA nanoparticles loaded with curcumin via self‐assembly, demonstrating efficacy in treating various diseases [23]. HSA's surface contains numerous functional carboxyl and amino groups, enabling covalent bonding with compounds [24]. Its ease of preparation, high yield, and ability to serve as a carrier for hydrophobic drugs further enhance its utility in drug delivery systems.

In this study, we employed HepG2 cells for in vitro experiments to investigate the effects of EA on LDLR expression and elucidate the underlying molecular mechanisms. To overcome EA's poor solubility and bioavailability, we prepared EA‐loaded HSA nanoparticles (EA‐NPs) via self‐assembly, utilizing HSA as a drug carrier to enhance safety for intravenous administration. Additionally, we conducted in vivo experiments using apolipoprotein E knockout (ApoE⁻/⁻) mice to evaluate the efficacy and mechanisms of EA in treating atherosclerosis.

2. Materials and Methods

2.1. Materials

Ellagic acid (EA; purity > 98%) was procured from Shanghai Yuanye Biotech Co. Ltd. (B21073, Shanghai, China). Human serum albumin (HSA; purity 96%–99%), 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT), dithiothreitol (DTT), 1,1′‐dioctadecyl‐3,3,3′,3′‐tetramethylindocarbocyanine‐low‐density lipoprotein (Dil‐LDL), and an enhanced Oil Red O staining kit were obtained from Solarbio (Beijing, China). SYBR Green Real‐Time PCR Master Mix was purchased from Takara (Beijing, China). Antibodies included anti‐LDLR (ET1606, Huabio, Hangzhou, China), anti‐EGFR (2085S, Cell Signaling Technology, MA, USA), anti‐phospho‐EGFR (48576SF, Cell Signaling Technology, MA, USA), anti‐ERK1/2 (4696S, Cell Signaling Technology, MA, USA), anti‐phospho‐ERK1/2 (4370S, Cell Signaling Technology, MA, USA), and anti‐β‐actin (66009–1‐IG, Proteintech, Wuhan, Hubei, China). Male C57BL/6 ApoE⁻/⁻ mice (6 weeks old, 18–20 g) were sourced from Changzhou Card Vince Laboratory Animal Co. Ltd. (Changzhou, China; license number: SCXK(SU)2016–0010). HepG2 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The recombinant EGFR extracellular domain (Cat: 10001‐H08H) was purchased from Sino Biological (Beijing, China).

2.2. Preparation of EA‐NPs

EA‐NPs were synthesized via the self‐assembly method [24]. Briefly, HSA (40 mg) was dissolved in Tris buffer (40 mL, pH 7.4, 5 mM) at 40°C. DTT was added to a final concentration of 5 mM, and the solution was stirred at 40°C for 5 min. Subsequently, EA (4 mg), dissolved in dimethyl sulfoxide (DMSO), was added under continuous stirring, and the mixture was agitated for 10 min. Low‐power ultrasound (300 W) was applied for 3 min to disperse aggregated particles. The resulting EA‐NPs were dialyzed extensively using a dialysis bag (molecular weight cutoff: 8 kDa) to remove residual DTT and unbound EA.

2.3. Morphology, Particle Size, Dispersion Index, and Zeta Potential

The morphology of EA‐NPs was characterized using a JEM‐2100 high‐resolution transmission electron microscope (JEOL, Tokyo, Japan). Samples were deposited onto a 200‐mesh carbon‐coated copper grid, negatively stained with phosphotungstic acid, and observed via scanning electron microscopy (SEM). Powder samples were mounted on a silicon wafer, sputtered with platinum, and examined under SEM. Particle size, polydispersity index (PDI), and Zeta potential were measured using a Malvern Laser Scattering Particle Size Analyzer (Malvern Instruments, Malvern, UK) at room temperature.

2.4. Encapsulation Efficiency and Loading Capacity of EA‐NPs

High‐performance liquid chromatography (HPLC) was performed using a C18 column (LC‐2010 CHT System, Shimadzu, Kyoto, Japan; column dimensions: 250 mm × 4.6 mm, 5 μm). The mobile phase consisted of acetonitrile and 0.03% trifluoroacetic acid (15:85, v/v), with a flow rate of 1.0 mL/min, a column temperature of 30°C, a detection wavelength of 254 nm, and a sample injection volume of 10 μL. To determine free EA (M_free), 1 mL of EA‐NP suspension was centrifuged in an ultrafiltration tube (molecular weight cutoff: 8 kDa; Millipore, Ireland) at 12,000 rpm for 20 min at −4°C, and the filtrate was analyzed via HPLC. Total EA (M_total) was assessed by disrupting 1 mL of suspension with 3 mL of methanol‐precipitated protein, followed by ultrasonication for 10 min, filtration through a 0.22 μm microporous membrane, and HPLC analysis.

Encapsulation efficiency (EE%) and loading capacity (LC%) were calculated as follows:

$$\mathrm{EE}\%=\left[\left(\mathrm{M}\_\text{total}—\mathrm{M}\_\text{free}\right)/\mathrm{M}\_\text{total}\right]\times 100\%$$

$$\mathrm{LC}\%=\left[\left(\mathrm{M}\_\text{total}—\mathrm{M}\_\text{free}\right)/\mathrm{W}\_\text{total}\right]\times 100\%$$

where M_total is the total EA content, M_free is the unbound EA in the supernatant, and W_total is the weight of lyophilized nanoparticles.

2.5. SDS‐PAGE and Coomassie Brilliant Blue Staining

A vertical gel electrophoresis system (Bio‐Rad, Hercules, CA, USA) with 4% stacking gel and 8% resolving gel was used to run the SDS‐PAGE. Samples (2 μg/μL) were mixed with loading buffer, with or without β‐mercaptoethanol, and denatured at 95°C for 10 min. Electrophoresis was performed at 120 V for 80 min. Gels were stained with Coomassie Brilliant Blue R‐250 for 20 min, destained, and visualized using a ChemiDoc Imaging System (Bio‐Rad).

2.6. In Vitro Release Experiment

Drug release from EA‐NPs was assessed using the dialysis bag method. EA‐NPs were placed in a dialysis bag (molecular weight cutoff: 8 kDa) with 3 mL of dissolution medium (phosphate‐buffered saline [PBS] with 0.1% v/v Tween 80, pH 7.4, 200 mL). The system was maintained at 37°C ± 0.5°C with a rotational speed of 100 rpm. Samples (0.5 mL) were collected at 0, 2, 4, 8, 12, and 24 h, and the volume was replenished with fresh buffer. Drug concentrations were determined via HPLC.

2.7. MTT Assay

HepG2 cells were cultured in high‐glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin. The cells were maintained in a humidified atmosphere at 37°C with 5% CO₂. MTT assay was employed to assess cell viability and thereby evaluate the safety profile of EA. HepG2 cells were treated with varying concentrations of EA for 24 h. Subsequently, 20 μL of MTT solution (5 mg/mL) was added, and the cells were incubated at 37°C for 4 h. The culture medium was then discarded, and 100 μL of dimethyl sulfoxide (DMSO) was added to dissolve the resulting purple formazan crystals in each well. Absorbance was measured at 492 nm using a microplate reader (Synergy4, Multi‐Mode Microplate Reader; BioTek, Winooski, VT, USA).

2.8. Western Blotting

Total protein was extracted from HepG2 cells and liver tissues of ApoE⁻/⁻ mice using a cell lysis buffer. Protein concentrations were quantified using a bicinchoninic acid (BCA) assay kit (Beyotime, Shanghai, China), and sample volumes were adjusted accordingly. Protein samples were mixed with loading buffer, denatured by boiling at 95°C for 10 min, and loaded into the wells of a polyacrylamide gel. Following sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE), proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 5% non‐fat milk in Tris‐buffered saline with Tween 20 (TBST) for 1 h at room temperature and incubated overnight at 4°C with the following primary antibodies (all from HuaBio, Huangzhou, China): LDLR (1:1000), phosphorylated ERK (p‐ERK, 1:1000), ERK (1:1000), phosphorylated EGFR (p‐EGFR, 1:1000), EGFR (1:1000), and β‐actin (1:5000) on a shaking platform. The following day, the membrane was washed and incubated with a goat anti‐rabbit IgG secondary antibody for 1 h at room temperature on a shaking platform. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection system and imaged with an imaging system (Media Cybernetics Inc., Rockville, MD, USA).

2.9. Real‐Time Quantitative Polymerase Chain Reaction (qPCR)

Total RNA was extracted from HepG2 cells and liver tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A total of 1 μg RNA per sample was reverse‐transcribed into complementary DNA (cDNA) using SYBR Green Real‐Time PCR Master Mix (Takara, Beijing, China) according to the manufacturer's instructions. qPCR was performed with the following thermal cycling conditions: initial denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s and annealing/extension at 60°C for 30 s. Expression levels of target genes were normalized to β‐actin, and relative quantification was performed using the $2^{-\mathrm{\Delta \Delta }{C}_{\mathrm{t}}}$ method [25]. LDLR: Forward: 5′‐CTGAAATCGCCGTGTTACTG‐3′; Reverse: 5′‐GCCAATCCCTTGTGACATCT‐3′.

2.10. Dil‐LDL Uptake Assay

HepG2 cells were treated with EA for 20 h, after which 20 μg/mL of 1,1′‐dioctadecyl‐3,3,3′,3′‐tetramethylindocarbocyanine‐low‐density lipoprotein (Dil‐LDL) was added. The cells were incubated at 37°C in the dark for an additional period. Subsequently, cells were washed three times with phosphate‐buffered saline (PBS) and fixed with 4% paraformaldehyde for 20 min at room temperature. Cells were then mounted with an anti‐fluorescence quenching medium containing 4′,6‐diamidino‐2‐phenylindole (DAPI). Images were captured using a fluorescence microscope at 100 × magnification, and fluorescence intensity was quantified using Image‐Pro Plus 6.0 software (Media Cybernetics Inc., Rockville, MD, USA).

2.11. Identification of EA and Atherosclerosis Targets

The 2D structure and Simplified Molecular Input Line Entry System (SMILES) notation of EA were retrieved from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/). Potential target genes of EA were identified using the Swiss Target Prediction database (http://www.swisstargetprediction.ch/), with a probability threshold of > 0. Atherosclerosis‐related target genes were obtained from the GeneCards database (http://www.genecards.org/) using filters of a relevance score ≥ 1, “Reviewed” status, and restriction to “ Homo sapiens .” The search was conducted on October 29, 2024 (Keyword:Atherosclerosis). The intersection of EA targets and atherosclerosis‐related targets was determined and designated as “critical targets” for EA in atherosclerosis treatment, visualized via a Venn diagram.

2.12. Screening of Core Targets and Enrichment Analysis of GO and KEGG Pathways

A protein–protein interaction (PPI) network of the identified critical targets was constructed using the STRING online platform (http://cn.string‐db.org/). Core targets of EA in atherosclerosis intervention were screened from this network. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed using the DAVID platform (http://david.ncifcrf.gov/), with a significance threshold of p < 0.05. GO analysis encompassed three categories: biological process (BP), molecular function (MF), and cellular component (CC). Proteins implicated in key pathways of EA's action on atherosclerosis were further investigated.

2.13. Surface Plasmon Resonance (SPR) Analysis

The interaction between EA and the EGFR extracellular domain was assessed using a Biacore S200 instrument (GE Healthcare, Uppsala, Sweden) based on SPR principles. The purified recombinant EGFR extracellular domain was immobilized on a CM5 sensor chip (GE Healthcare Biosciences). Kinetic and affinity analyses were conducted by injecting EA over the EGFR‐immobilized sensor surface in PBS supplemented with 0.05% Tween 20 (v/v).

2.14. Molecular Docking Experiment

Molecular docking of EA to EGFR was performed using AutoDock (version 4.2) [26]. The EGFR protein structure (PDB ID: 3NJP) was retrieved from the Protein Data Bank. Docking parameters were set as follows: grid center coordinates (center_x = 11.5, center_y = 20.5, center_z = 18.1); search space dimensions (size_x = 50, size_y = 50, size_z = 50) with a grid spacing of 0.375 Å; and exhaustiveness set to 10. Other parameters remained at default settings. The 3D structure of EA was downloaded from the PubChem database in Scientific Data Format (SDF), imported into ChemBio3D Ultra 14.0 for energy minimization (minimum RMS gradient = 0.001), and saved in mol2 format. Optimized structures were converted to “pdbqt” format for docking. Docking results were analyzed, and visualizations were generated.

2.15. Animal Grouping and Treatment

Male C57BL/6J ApoE⁻/⁻ mice (6 weeks old) were obtained from Changzhou Card Vince Laboratory Animal Co. Ltd. (license number: SCXK(SU)2016–0010). Mice were housed under controlled conditions (temperature: 18°C–24°C; humidity: 40%–70%) with a 12‐h light/dark cycle and ad libitum access to food and water. All animal experiments complied with the Guidelines for the Care and Use of Experimental Animals of Yunnan Agricultural University and were approved by the Animal Ethics Committee of Yunnan Agricultural University (approval number: YNAU202103042). No adverse events were observed.

Mice were randomly assigned to three groups (n = 7 per group): the low‐fat diet (LFD) group, high‐fat diet (HFD) group, and EA‐NPs group. The LFD group received a standard diet (HFHC; Deitz), while the HFD and EA‐NPs groups were fed a high‐fat diet (ASLF4; Deitz). The EA‐NPs group received daily tail intravenous injections of EA (25 mg/kg), whereas the LFD and HFD groups received equivalent volumes of normal saline, administered daily for 12 consecutive weeks. Body weights were monitored weekly. After 12 weeks, mice were euthanized, and liver and aortic tissues were collected. Blood samples were obtained from the retro‐orbital plexus, centrifuged at 3500 rpm for 15 min to separate serum, and stored at −80°C. Liver tissues were preserved in liquid nitrogen and tissue fixative, while aortic tissues were stored in tissue fixative.

2.16. Hematoxylin–Eosin (H&E) Staining and Immunofluorescence

Liver and aortic samples were fixed, embedded in paraffin, and sectioned (5 μm thickness). Sections were stained with H&E (Solarbio, Beijing, China), mounted with neutral gum, and examined under a Leica DM2500 microscope (Wetzlar, Germany). Microscopic analysis was performed at 50 × and 200 × magnification for aortic root sections and at 200 × magnification for liver sections. For immunofluorescence staining, sections were deparaffinized, subjected to antigen retrieval in sodium citrate buffer using microwave heating, and cooled to room temperature. Non‐specific binding was blocked with 10% goat serum for 30 min at room temperature. Sections were incubated overnight at 4°C with primary antibodies against α‐smooth muscle actin (αSMA; 1:200), and CD68 (1:200). The following day, sections were incubated with secondary antibodies for 30 min at room temperature, nuclei were counterstained with DAPI. Sections were mounted with neutral gum and images were acquired using a fluorescence microscope (Eclipse Ti‐E; Nikon, Tokyo, Japan) at 200 × and 400 × magnification.

2.17. Oil Red O Staining

Liver, gross aorta, and aortic sinus tissues from ApoE⁻/⁻ mice were stained using a modified Oil Red O kit (Solarbio, Beijing, China). Tissues were immersed in 60% isopropanol for 5 min, followed by Oil Red O staining solution for 10 min. Differentiation was achieved by brief immersion (2–3 s) in 60% isopropanol, and the reaction was terminated with tap water rinsing. Liver and aortic sinus tissues were mounted with glycerol gelatin and examined under a Leica DM2500 microscope (Wetzlar, Germany). Aortic root tissues were performed at 50× and 200 × magnification.

2.18. Elastic Van Gieson (EVG) Staining

Aortic sinus tissue sections from ApoE⁻/⁻ mice were stained using an EVG‐Verhoeff staining kit (G1597, Solarbio, Beijing, China). Sections were immersed in EVG dye solution for 30 min, rinsed with tap water, and differentiated with ferric chloride solution. Background and elastic fiber colors were observed under a Leica DM2500 microscope (Wetzlar, Germany) at 200 × magnification, with elastic fibers appearing purple‐black.

2.19. Statistical Analysis

All data are expressed as mean ± standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). Intergroup comparisons were analyzed using unpaired Student's t‐test, with *p < 0.05 and **p < 0.01 considered statistically significant. For multiple‐group comparisons, one‐way analysis of variance (ANOVA) was used, with significance set at *p < 0.05, **p < 0.01, and ***p < 0.001.

3. Results

3.1. Network Pharmacological Analysis Identifies EGFR and MAPK Pathways as Potential Intervention Targets in Atherosclerosis

Using the GeneCards database, we identified 5649 targets highly correlated with atherosclerosis, while the Swiss Target Prediction database yielded 100 targets associated with EA. By intersecting the compound targets with disease targets, we identified 80 key targets shared between EA and atherosclerosis (Figure 1A). A protein–protein interaction (PPI) network for these key targets was constructed using the STRING database (Figure 1B). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed via the DAVID database to screen potential pathways and processes. The GO enrichment analysis revealed 369 BP, 61 CC, and 81 MF. From these, the top ten terms with the lowest P‐values were selected to highlight the most significant categories, including phosphorylation, protein tyrosine kinase activity, transmembrane receptor protein tyrosine kinase activity, positive regulation of kinase activity, cell surface receptor protein tyrosine kinase signaling pathway, and protein phosphorylation (Figure 1C). KEGG pathway analysis further identified significant enrichment in pathways such as the EGFR tyrosine kinase signaling pathway, MAPK signaling pathway, and cancer‐related pathways (Figure 1D). These findings suggest that EA may exert its anti‐atherosclerotic effects primarily through modulation of the EGFR pathway.

FIGURE 1.

Network pharmacological analysis of EA anti‐AS targets and pathways. (A) AS target and EA target intersect. (B) PPI diagram. (C) GO. (D) KEGG.

3.2. EA Directly Binds to the Extracellular Domain of EGFR

The interaction between EA and the extracellular domain of EGFR was evaluated using SPR assays and molecular docking simulations. SPR analysis demonstrated that EA binds directly to the EGFR extracellular domain with a dissociation constant (K_D) of 4.33 × 10⁻⁷ M (Figure 2A). Molecular docking was performed using AutoDock (version 4.2) with the EGFR structure (Protein Data Bank ID: 3NJP) (25), revealing a binding energy of −7.1 kcal/mol (Figure 2B–D). Specifically, the hydroxyl groups of EA form hydrogen bonds with residues GLU221 and HIS209 of chain B, and GLU221, THR239, and ASP238 of chain A of the EGFR protein, with bond lengths of 2.07 Å, 1.93 Å, 2.21 Å, 2.6 Å, and 2.27 Å, respectively (Figure 2E,F). These hydrogen bonds are critical to the stability of the EA‐EGFR interaction. Additionally, hydrophobic interactions involve residues HIS209, GLU211, CYS236, and LYS237 of chain A, and LYS237 of chain B, contributing to the stable binding of EA within the “pocket” region of EGFR. These results indicate that EA directly interacts with the extracellular domain of EGFR, stabilizing the complex structure.

FIGURE 2.

EA Directly Binds to the Extracellular Domain of EGFR. (A) SPR sensorgrams showing the binding affinity of EA to the extracellular domain of EGFR. The traces represent real‐time interactions at EA concentrations of 2, 1, 0.5, and 0.2 μM. (B) Three‐dimensional (3D) computer simulation depicting the docking of EA with the extracellular domain of EGFR. (C) 3D docking diagram illustrating EA binding to the extracellular segment of EGFR. (D) Magnified view of the EA binding pocket within EGFR. (E) 3D model of the interaction between EA and EGFR, with green and yellow dotted lines representing hydrogen bonds and hydrophobic interactions, respectively. (F) Two‐dimensional (2D) model of the interaction between EA and EGFR. 2D, two‐dimensional; 3D, three‐dimensional; EA, ellagic acid; EGFR, epidermal growth factor receptor; SPR, surface plasmon resonance.

3.3. EA Promotes LDLR Expression by Targeting EGFR

Given the pivotal role of LDLR in atherosclerosis development and progression, we assessed the effects of EA on LDLR protein levels and HepG2 cell viability. The MTT assay revealed that EA did not impair HepG2 cell viability (Figure 3A). Western blot analysis demonstrated that EA significantly increased LDLR protein levels in HepG2 cells (Figure 3B,C). Furthermore, EA enhanced the uptake of 1,1′‐dioctadecyl‐3,3,3′,3′‐tetramethylindocarbocyanine‐low‐density lipoprotein (Dil‐LDL) by HepG2 cells, indicating improved LDLR functionality at the cell membrane surface (Figure 3D). These findings suggest that EA induces an increase in LDLR protein levels, thereby promoting LDL uptake.

FIGURE 3.

EA Induces Elevation of LDLR Protein Levels and Promotes LDL Uptake in HepG2 Cells. (A) Chemical Structure of EA and its cytotoxicity assessment on HepG2 cells. Cell viability was assessed by MTT assay after 24‐h treatment with EA at 10, 20, and 40 μM concentrations. (B) Effects of EA at varying concentrations (10, 20, and 40 μM) on low‐density lipoprotein receptor (LDLR) expression in HepG2 cells, evaluated by Western blotting. (C) Time‐dependent effects of EA (20 μM) on LDLR expression in HepG2 cells at 3, 6, 9, 12, and 24 h, assessed by Western blotting. (D) Fluorescence microscopy images showing the uptake of Dil‐LDL by HepG2 cells treated with EA for 20 h. Data are presented as mean ± standard error of the mean (SEM; n = 3). Statistical significance: *p < 0.05, **p < 0.01. EA, ellagic acid; LDL, low‐density lipoprotein; LDLR, low‐density lipoprotein receptor; SEM, standard error of the mean.

3.4. EA Enhanced LDLR mRNA Stability by Activating the EGFR‐ERK Signaling Pathway

To elucidate the mechanism underlying EA's upregulation of LDLR, we examined its effect on LDLR mRNA levels. qPCR analysis revealed a significant increase in LDLR mRNA levels in HepG2 cells following EA treatment (Figure 4A). Enhanced mRNA stability is a potential mechanism for increased LDLR expression. Using actinomycin D to inhibit transcription, we found that EA significantly prolonged the half‐life of LDLR mRNA from approximately 1.5–2.3 h (Figure 4B). Previous studies have linked EGFR activation and the EGFR‐ERK signaling pathway to increased LDLR mRNA stability [27, 28]. To investigate this, we evaluated the effect of EA on EGFR‐ERK signaling. Western blot analysis showed that EA treatment significantly elevated the phosphorylation levels of EGFR and ERK in HepG2 cells (Figure 4C). Moreover, the EGFR‐specific monoclonal antibody cetuximab, which binds to the extracellular domain of EGFR, blocked EA‐induced EGFR‐ERK activation and significantly suppressed the increase in LDLR protein levels (Figure 4D). These results confirm that EA upregulates LDLR expression by targeting EGFR and activating the EGFR‐ERK signaling pathway.

FIGURE 4.

EA Enhances LDLR Expression via the EGFR‐ERK Signaling Pathway. (A) Effect of EA treatment (24 h) on LDLR mRNA levels in HepG2 cells, determined by real‐time quantitative PCR. (B) Impact of EA on LDLR mRNA stability in HepG2 cells, assessed following inhibition of mRNA synthesis with actinomycin D. (C) Effects of EA at concentrations of 10, 20, and 40 μM on phosphorylated ERK (p‐ERK) and phosphorylated EGFR (p‐EGFR) levels in HepG2 cells after 1‐h treatment, as evaluated by Western blotting analysis. (D) Effects of EA on p‐ERK, p‐EGFR, and LDLR levels in HepG2 cells following after 1‐h treatment with or without EGFR pathway blockade by cetuximab, as assessed by Western blotting analysis. Data are presented as mean ± SEM (n = 3). Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001. EA, ellagic acid; EGFR, epidermal growth factor receptor; ERK, extracellular signal‐regulated kinase; LDLR, low‐density lipoprotein receptor; p‐EGFR, phosphorylated EGFR; p‐ERK, phosphorylated ERK; SEM, standard error of the mean.

3.5. Characterization of EA‐NPs and Their Effects on EGFR Signaling and LDLR Levels in HepG2 Cells

To address EA's poor water solubility, we prepared EA‐NPs using the self‐assembly method with HSA (Figure 5A) and characterized their properties. Visual inspection revealed that HSA powder was white, whereas EA‐NP powder was yellow, indicating the incorporation of EA into the nanoparticles. TEM and SEM analyses showed that, unlike the rod‐like structure of free EA, EA‐NPs exhibited a spherical morphology (Figure 5B,C). Particle size analysis and Zeta potential measurements indicated an average EA‐NP diameter of 218.5 nm, a polydispersity index (PDI) of 0.342, and a Zeta potential of −26.4 mV, suggesting suitability for in vivo transport and good stability. In vitro release studies demonstrated an initial burst release of 37% within 2 h, followed by a sustained release profile (Figure 5D). Sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) analysis under non‐reducing conditions revealed a primary HSA band at approximately 66 kDa and an EA‐NP band at approximately 70 kDa in lanes L2–L4, suggesting that the increased molecular weight of EA‐NPs correlates with the number of EA molecules bound to HSA (Figure 5E, right). Under reducing conditions, no significant molecular weight differences were observed between HSA and EA‐NPs, likely due to the reduction of disulfide bonds and release of EA (Figure 5E, left). These data confirm that EA is effectively encapsulated, with HSA serving as an efficient drug carrier. Given LDLR's critical role in atherosclerosis, we evaluated the effects of EA and EA‐NPs on LDLR protein levels. Both EA and EA‐NPs significantly increased LDLR mRNA and protein levels in HepG2 cells (Figure 5F,G). Additionally, treatment with EA and EA‐NPs markedly enhanced the phosphorylation levels of EGFR and ERK (Figure 5F), indicating that EA‐NPs activate the EGFR/ERK signaling pathway and elevate LDLR levels in a manner comparable to free EA.

FIGURE 5.

Characterization of EA‐NPs. (A) Schematic diagram of EA‐NPs composition. (B) Visual appearance of HSA and EA‐NP powders. (C) SEM images of free EA and EA‐NPs. (D) TEM images of HSA and EA‐NPs. (E) In vitro release profile of EA‐NPs, expressed as percentage release at 0, 2, 4, 6, 8, 12, and 24 h. (F) Differential scanning calorimetry (DSC) analysis of EA, human serum albumin (HSA), and EA‐NPs. (G) Sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) of HSA and EA‐NPs in loading buffer with or without β‐mercaptoethanol. Lanes: (L0) protein marker; (L1) HSA; (L2–L4) EA‐NPs (n = 3). EA, ellagic acid; EA‐NPs, ellagic acid‐loaded nanoparticles; HSA, human serum albumin; SEM, scanning electron microscopy; TEM, transmission electron microscopy; DSC, differential scanning calorimetry; SDS‐PAGE, sodium dodecyl sulfate‐polyacrylamide gel electrophoresis.

3.6. EA‐NPs Significantly Ameliorate Atherosclerosis in ApoE ⁻/⁻ Mice

To validate the in vivo effects of EA on LDLR expression and atherosclerosis via the EGFR‐ERK signaling pathway, we utilized a C57BL/6J ApoE⁻/⁻ mouse model of atherosclerosis to assess the anti‐atherosclerotic efficacy and mechanism of EA‐NPs. Plasma EA concentrations reached 6.29 μmol/L following administration. Oil Red O staining of gross aorta and aortic sinus tissues revealed a significantly larger atherosclerotic plaque area in the HFD group compared to the LFD group. Notably, EA‐NP treatment significantly reduced plaque deposition in the gross aorta and aortic sinus of HFD‐fed mice (Figure 6A,B).

FIGURE 6.

EA‐NPs Ameliorate Atherogenesis in HFD‐Fed ApoE⁻/⁻ Mice. (A) Oil Red O staining of atherosclerotic plaques in the whole aorta of ApoE⁻/⁻ mice, with statistical analysis of plaque area. (B) Oil Red O staining of the aortic root, with plaque area quantified using ImageJ software. Data are presented as mean ± SEM of six biological replicates. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001. Experimental groups: LFD group (chow diet); HFD group (high‐fat and high‐cholesterol diet with uncoated EA nanoparticles); HFD + EA‐NPs group (high‐fat and high‐cholesterol diet with coated EA‐NPs). ApoE, apolipoprotein E; EA, ellagic acid; EA‐NPs, ellagic acid‐loaded human serum albumin nanoparticles; HFD, high‐fat diet; LFD, low‐fat diet; SEM, standard error of the mean.

Atherosclerosis progression involves macrophage infiltration from the lumen, migration of vascular smooth muscle cells (VSMCs) from the media to the intima, and a reduction in elastic fibers at the aortic root [29]. Immunofluorescence staining for the macrophage marker CD68 demonstrated that EA‐NPs significantly reduced CD68 levels in the aortic roots of HFD‐fed ApoE⁻/⁻ mice, effectively alleviating macrophage infiltration in atherosclerotic plaques (Figure 7A). Similarly, staining for αSMA, a VSMC marker, showed that EA‐NPs significantly decreased VSMC levels in the aortic root (Figure 7B). H&E staining further revealed that EA‐NPs reduced the necrotic area in the aortic root of HFD‐fed mice (Figure 7C). EVG staining indicated that EA‐NPs significantly increased elastic fiber content in the aortic roots (Figure 7D). These findings collectively demonstrate that EA‐NPs effectively mitigate the development and progression of atherosclerosis.

FIGURE 7.

EA‐NPs Mitigate Atherogenesis in HFD‐Fed ApoE⁻/⁻ Mice. Immunofluorescence analysis of aortic root atherosclerotic lesions in ApoE⁻/⁻ mice stained for (A) CD68 or (B) αSMA. (C) Aortic root lesions stained with H&E and EVG. Data are presented as mean ± SEM of six biological replicates. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001. Experimental groups: LFD group (chow diet); HFD group (high‐fat and high‐cholesterol diet with uncoated EA nanoparticles); HFD + EA‐NPs group (high‐fat and high‐cholesterol diet with coated EA‐NPs). ApoE, apolipoprotein E; αSMA, alpha‐smooth muscle actin; DAPI, 4′,6‐diamidino‐2‐phenylindole; EA‐NPs, ellagic acid‐loaded human serum albumin nanoparticles; EVG, elastic Verhoeff‐Van Gieson; HE, hematoxylin–eosin; HFD, high‐fat diet; LFD, low‐fat diet; SEM, standard error of the mean.

3.7. EA‐NPs Enhance LDLR Expression and Activate the EGFR‐ERK Signaling Pathway in ApoE ⁻/⁻ Mice

To determine whether EA‐NPs replicate the in vitro effects on LDLR expression and EGFR‐ERK signaling in vivo, we analyzed their impact in ApoE⁻/⁻ mice using Western blotting and real‐time qPCR. EA‐NPs significantly increased LDLR mRNA and protein levels in the livers of ApoE⁻/⁻ mice (Figure 8A,B) and markedly elevated the phosphorylation levels of EGFR and ERK (Figure 8B). These in vivo results align with the in vitro findings, confirming the consistency of EA‐NP effects across experimental models.

FIGURE 8.

EA‐NPs Activate the EGFR Pathway to Enhance LDLR Expression in HFD‐Fed ApoE⁻/⁻ Mice. (A) LDLR mRNA levels in the liver of ApoE⁻/⁻ mice, determined by real‐time quantitative PCR. (B) Protein levels of LDLR, p‐ERK, and p‐EGFR in the liver of ApoE⁻/⁻ mice, assessed by Western blotting. Data are presented as mean ± SEM of six biological replicates. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001. Experimental groups: HFD group (high‐fat and high‐cholesterol diet with uncoated EA nanoparticles); HFD + EA‐NPs group (high‐fat and high‐cholesterol diet with coated EA‐NPs). ApoE, apolipoprotein E; EA‐NPs, ellagic acid‐loaded human serum albumin nanoparticles; EGFR, epidermal growth factor receptor; ERK, extracellular signal‐regulated kinase; HFD, high‐fat diet; LDLR, low‐density lipoprotein receptor; p‐EGFR, phosphorylated EGFR; p‐ERK, phosphorylated ERK; SEM, standard error of the mean.

3.8. EA‐NPs Improve Blood Lipid Profiles and Reduce Hepatic Lipid Accumulation

Elevated blood lipid levels are a key risk factor for atherosclerosis. Blood lipid analysis revealed that EA‐NPs significantly reduced total cholesterol (TC; p < 0.05, Figure 9A) and low‐density lipoprotein cholesterol (LDL‐C; p < 0.05, Figure 9C) levels in HFD‐fed ApoE⁻/⁻ mice. However, no significant effect was observed on triglyceride levels (p > 0.05, Figure 9B). Additionally, macroscopic liver examination and Oil Red O staining demonstrated that EA‐NPs alleviated HFD‐induced lipid accumulation in the livers of ApoE⁻/⁻ mice (Figure 9D,E), further supporting their lipid‐lowering efficacy.

FIGURE 9.

EA‐NPs Improve Blood Biochemical Parameters and Reduce Hepatic Lipid Accumulation in HFD‐Fed ApoE⁻/⁻ Mice. Serum levels of (A) total cholesterol (TC), (B) triglycerides (TG), and (C) low‐density lipoprotein cholesterol (LDL‐C) in ApoE⁻/⁻ mice. (D) Macroscopic appearance of ApoE⁻/⁻ mouse livers and analysis of liver index. (E) Oil Red O staining of ApoE⁻/⁻ mouse livers. Data are presented as mean ± SEM of seven biological replicates. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001. Experimental groups: LFD group (chow diet); HFD group (high‐fat and high‐cholesterol diet with uncoated EA nanoparticles); HFD + EA‐NPs group (high‐fat and high‐cholesterol diet with coated EA‐NPs). ApoE, apolipoprotein E; EA‐NPs, ellagic acid‐loaded human serum albumin nanoparticles; HFD, high‐fat diet; LDL‐C, low‐density lipoprotein cholesterol; LFD, low‐fat diet; SEM, standard error of the mean; TC, total cholesterol; TG, triglycerides.

4. Discussion

Atherosclerotic cardiovascular disease remains a leading cause of mortality worldwide [30]. Elevated low‐density lipoprotein (LDL) levels are a primary risk factor for atherosclerosis development. LDLR facilitates the reduction of LDL levels by mediating its internalization from the bloodstream into cells and subsequent degradation [31, 32]. Consequently, enhancing LDLR protein expression has emerged as a critical therapeutic strategy for atherosclerosis management. Previous studies have demonstrated that EA upregulates LDLR expression in HepG2 cells through activation of the extracellular signal‐regulated kinase (ERK) signaling pathway [33]. However, the precise mechanism by which EA activates this pathway has remained elusive until now.

The regulation of mRNA stability is a fundamental mechanism governing gene expression [34, 35]. ERK kinase orchestrates gene expression via complex signaling cascades, modulating a variety of intracellular biological processes. In the context of LDLR gene regulation, ERK stabilizes the promoter region, preventing epigenetic silencing and ensuring robust LDLR expression in cells [10, 36]. Under physiological conditions, ERK effectively maintains LDLR gene expression and cholesterol homeostasis in the blood. However, in pathological states such as inflammation, infection, or tumorigenesis, impaired ERK activity may reduce LDLR expression, compromising cholesterol clearance and exacerbating disease progression [37]. Elucidating the mechanistic role of ERK kinase in LDLR regulation offers valuable insights into cholesterol metabolism and presents novel therapeutic targets for related disorders.

This study demonstrates that EA enhances LDLR mRNA stability by activating the EGFR‐ERK signaling pathway, leading to increased LDLR mRNA and protein expression, and promoting LDL‐C uptake in HepG2 cells. This mechanism parallels the action of 5‐azacytidine (5‐Azac), which stabilizes LDLR mRNA via ERK signaling activation [12]. However, unlike EA, 5‐Azac induces sustained activation of the inositol‐requiring enzyme 1α (IRE1α) kinase domain and c‐Jun N‐terminal kinase (JNK), which in turn activate the ERK pathway and stabilize LDLR mRNA. In contrast, our findings reveal that EA directly binds to the extracellular domain of EGFR through hydrogen bonding and hydrophobic interactions, triggering EGFR‐ERK signaling and enhancing LDLR mRNA stability.

While EA's potential has been extensively documented in vitro, its effective delivery in vivo remains challenging due to its low bioavailability and degradation in the gastrointestinal tract [14, 38]. These limitations prevent EA from being transported intact within the body, hindering its therapeutic efficacy. Consequently, assessing EA's in vivo effects on atherosclerosis and clarifying its mechanism of action have proven difficult. Several studies have sought to address EA's poor solubility and bioavailability. For instance, Gu et al. utilized ethanol as a protic solvent to prepare an EA‐phospholipid complex [39], though the recombination efficiency was low. Baghel et al. [40] explored the use of cellulose derivatives (e.g., carboxymethyl cellulose butyrate acetate, cellulose adipate propionate, and hydroxypropyl methyl cellulose acetate succinate) to form amorphous solid dispersions with EA via solvent evaporation, but the resulting polymers exhibited instability. Similarly, Savic et al. [41] developed EA inclusion complexes with β‐cyclodextrin and hydroxypropyl β‐cyclodextrin, yet these efforts were less successful in improving solubility, and cyclodextrin‐based formulations remain costly.

To overcome these challenges, we employed HSA as a carrier for hydrophobic drugs and prepared EA‐NPs via the self‐assembly method [24]. In this approach, the hydrophobicity of HSA is enhanced by the addition of DTT, enabling EA to bind to HSA's hydrophobic domains for encapsulation. The resulting EA‐NPs exhibited a particle size of 218.5 nm, suitable for intravenous administration, with high encapsulation efficiency and stability (Zeta potential: −26.4 mV). We further confirmed that EA‐NPs retain EA's pharmacological properties, demonstrating their ability to activate the EGFR signaling pathway and increase LDLR levels in HepG2 cells. In ApoE⁻/⁻ mice, EA‐NPs significantly improved atherosclerosis‐related indices. Consistent with in vitro findings, in vivo experiments revealed that EA‐NPs activate the EGFR‐ERK signaling pathway and enhance LDLR mRNA and protein expression. This study has several limitations. The need for daily intravenous administration of EA‐NPs, although essential to circumvent the complex gut metabolism and unambiguously demonstrate the direct atheroprotective effects of intact ellagic acid, poses a substantial challenge for clinical translation. Future studies should directly compare the efficacy of orally administered ellagic acid—and its gut microbiota‐derived metabolites, urolithins—with that of intravenously delivered intact EA. Such comparisons would help evaluate their relative therapeutic potential and inform the development of more clinically viable delivery strategies.

The control of mRNA stability is a critical regulatory mechanism for gene expression, mediated by adenosine‐ and uridine‐rich elements (AREs) in the 3′ untranslated region (3′ UTR) of mRNA [42]. ARE‐binding proteins (AUBPs) play a key role in modulating the stability of ARE‐containing mRNAs. For example, human antigen R (HuR), a member of the embryonic lethal abnormal vision (ELAV) family, binds to AREs and stabilizes mRNA [43]. Conversely, other AUBPs, such as tristetraprolin (TTP), butyrate response factor 1 (BRF1), and KH‐type splicing regulatory protein (KHSRP), destabilize their target ARE‐mRNAs [44, 45]. Our results indicate that EA enhances LDLR mRNA stability at the post‐transcriptional level via EGFR‐ERK signaling activation. However, further research is needed to elucidate the precise mechanisms of this regulation and identify the specific AUBPs involved in stabilizing LDLR mRNA.

Molecular docking analysis was employed to investigate the binding interactions between EA and EGFR. Typically, ligand binding to polar and non‐polar amino acid residues in a receptor's active site generates hydrogen bonds and hydrophobic interactions, respectively, which are essential for drug‐receptor interactions [46, 47]. Our findings reveal that EA forms hydrogen bonds and hydrophobic interactions with multiple EGFR residues, potentially inducing conformational changes in the extracellular domain and activating the EGFR‐ERK signaling pathway. Nevertheless, the specific binding sites and downstream effects of EGFR‐ERK activation require further exploration. Additionally, as EGFR is a proto‐oncogene involved in cell growth, signal transduction, and angiogenesis, the potential impact of EA‐mediated EGFR‐ERK activation on other cellular processes merits further investigation to assess any unintended consequences.

5. Conclusion

This study demonstrates that EA attenuates atherosclerosis by directly binding to the extracellular domain of EGFR, thereby activating the EGFR‐ERK signaling pathway, stabilizing LDLR mRNA, and enhancing LDLR protein expression. Furthermore, EA‐NPs, prepared via the self‐assembly method, enable effective intravenous administration in animal models. In vivo experiments corroborated EA's effects, confirming activation of the EGFR‐ERK pathway, increased LDLR levels, and amelioration of atherosclerosis‐related indices. These findings provide valuable insights into EA's potential role in the prevention and treatment of atherosclerosis and suggest new avenues for the development of natural anti‐atherosclerotic agents.

Author Contributions

Xuan‐Jun Wang and Jun Sheng designed the project. Xuan‐Jun Wang, Jun Sheng, Ye‐Wei Huang participated in the conception, review, and editing. Li‐Tian Wang is responsible for research, software, formal analysis, writing of original manuscripts and verification. Shuang‐Qing Zhao, Huai‐Liu Yin, and Li‐Tian Wang conducted investigations, data collation, and visualization. All data were generated in‐house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy.

Conflicts of Interest

The authors declare no conflicts of interest.

Li G.‐T., Wang L.‐T., Yin H.‐L., et al., “Ellagic Acid and Its Nanoparticles Mitigate Atherosclerosis by Elevating Low‐Density Lipoprotein Receptor Levels Through Targeting of the Epidermal Growth Factor Receptor,” FASEB BioAdvances 7, no. 11 (2025): e70069, 10.1096/fba.2025-00178.

Data Availability Statement

The data that support the findings of this study are available in Sections 2 and 3 of this article.