Reevaluation of whether histones are asymmetrically segregated during asymmetric divisions of stem cells in Drosophila

Significance

Previous studies utilizing an exogenous expression system with fluorescently tagged histones observed that during germline stem cell (GSC) and intestinal stem cell (ISC) divisions, preexisting histone subunit 3.1 (H3.1) was preferentially segregated to stem cells, while new H3.1 went to differentiated daughters, suggesting an epigenetic mechanism for fate asymmetry. By tracking H3.1 expressed under its normal controls, we find old and new H3.1 are symmetrically distributed during asymmetric ISC division. Such native H3.1 expression is blocked in GSCs via regulatory elements in its 3’UTR. However, when this regulation is bypassed, H3.1 segregation is symmetric and fate asymmetry is unaffected. We conclude that asymmetric segregation of preexisting H3.1 neither occurs nor plays a causal role in asymmetric stem cell divisions in Drosophila.

Abstract

Recent work suggests that asymmetric segregation of preexisting and newly synthesized canonical histone 3.1 (H3.1), but not variant histone 3.3A (H3.3A), plays an important role in the asymmetric outcome of Drosophila germline stem cell (GSC) and intestinal stem cell (ISC) divisions. However, this finding relied on the Gal4/UAS system and Flp-out technology to swap expression of exogenous fluorescent proteins—an approach that decouples H3.1 expression from the cell cycle and may be prone to artifacts. Here, by photoswitching photoconvertible H3-Dendra2 proteins expressed under their native controls in living flies, we find that preexisting and newly synthesized H3.1 and H3.3A are symmetrically segregated in dividing ISCs and somatic cyst stem cells (CySCs) in male testes. While H3.3A was found to be symmetrically segregated during GSC divisions, analysis of the H3.1 segregation in GSCs was complicated by our unexpected finding that H3.1-Dendra2 expressed under its normal control within the context of a histone transgene is not detectable in GSCs, owing to regulatory elements in the 3’UTR that mediate translational repression by the RNA-binding proteins Nanos and Pumilio. Nevertheless, when this repression is obviated by using a 3’UTR devoid of such elements, H3.1-Dendra2 is expressed in GSCs and symmetrically segregated without affecting lineage outcomes. We obtained similar results when the coding sequence of H3.3A was edited to encode H3.1 in the context of an H3.3A-Dendra2 knock-in allele. Our findings thus challenge the prevailing model of asymmetric histone segregation and reveal an unexpected molecular mechanism of posttranscriptional repression of H3.1 in GSCs.

When a stem cell in Drosophila undergoes an asymmetric division, it generates one stem cell and one daughter cell committed to differentiation (1–3). This asymmetry in cell fate determination plays a pivotal role in organogenesis, tissue homeostasis, and injury repair (2–5). It is known that cell polarity serves as a key determinant in mediating asymmetric divisions of neuroblasts (6, 7), male germline stem cells (GSCs) (8), and intestinal stem cells (ISCs) (9–11). In male GSCs, the Par3/Bazooka (Baz) polarity protein directs the division axis to align perpendicularly to the niche contact surface (12), ensuring that one daughter cell retains niche attachment (GSC) while the other detaches and initiates differentiation (8, 13, 14). Additionally, niche-derived BMP signaling forms a concentration gradient to maintain the fate of female and male GSCs adjacent to niche cells (15–17).

Recent studies have led to the striking conclusion that there is an additional layer of regulation: the asymmetric segregation of preexisting (“old”) and newly synthesized (“new”) histone H3.1 between daughter cells during asymmetric divisions of ISCs (18) and male GSCs (19). Specifically, preexisting H3.1 is retained in the stem cell, while newly synthesized H3.1 is segregated into the differentiating daughter (18, 19). It has also been reported that H3 threonine phosphorylation (20) and asymmetric replication fork progression (21) participate in establishing this asymmetric H3.1 distribution pattern. Most recently, the strand bias in old/new histone segregation has been revealed to be linked to the asymmetric activity of polymerase Polα (22). Significantly, overexpressing a symmetrically distributed H3.1T3A resulted in increased ISC-like cells and loss of GSCs (18, 19). On the basis of these findings, it has been argued that epigenetic modifications carried by asymmetrically segregated old and new H3.1 determine distinct cell fates of stem cells versus differentiating daughter cells (20, 23).

However, a fundamental question arises: If extrinsic niche signals and cell polarity machinery are sufficient to orchestrate asymmetric cell fates (2, 8, 12, 15, 24), why would an intrinsic mechanism based on biased histone segregation be necessary? While the coexistence of extrinsic and intrinsic mechanisms is theoretically possible, the requirement for epigenetic asymmetry in fate determination remains controversial, particularly given the robust role of niche signaling.

The case for asymmetric segregation of old versus new H3.1 is also challenged by a potential weakness in the experimental approach used in previous studies. These have depended on distinguishing between tissue-specific, exogenous expression of preexisting and newly synthesized H3 proteins, tagged respectively with GFP and mKO, via a heat shock-inducible dual-color system [hs-Flp; esg-Gal4 (ISC)/nos-Gal4 (GSC)>UAS-FRT-H3-GFP-FRT-H3-mKO] (18–20, 22, 23). This approach uses a single heat shock to irreversibly switch from the expression of exogenous H3-GFP to exogenous H3-mKO, both of which are produced continuously throughout the cell cycle. Endogenous H3.3A is also produced continuously throughout the cell cycle. Hence, exogenous expression of GFP and mKO tagged forms of H3.3A under Gal4/UAS control mimics that of native H3.3A. By contrast, endogenous H3.1 expression is tightly coupled to DNA replication during S phase (25–27), with its mRNA rapidly degraded by G2 phase (28–31). Accordingly, continuous production of exogenous tagged H3.1 throughout the cell cycle might result in abnormal accumulation and distribution patterns that do not reflect endogenous histone dynamics, potentially generating artifactual asymmetry and undermining confidence in this system as a means to detect asymmetric H3.1 segregation in stem cell lineages.

To resolve these uncertainties, we have used a different approach to reevaluate histone segregation dynamics in both ISC and GSC lineages, by i) using photoswitching of Dendra2, a photoconvertible fluorescent protein tag (32–34), to distinguish preexisting and newly synthesized histone proteins, and ii) expressing the Dendra2-tagged histone proteins under their normal control, either from transgenes carrying all of the normal regulatory elements (H3.1) or by gene edited forms of the native locus (H3.3A).

Dendra2 undergoes irreversible photoconversion from green to red fluorescence upon 380-420 nm ultraviolet (UV) irradiation (32). The Amodeo lab generated an H3.3A-Dendra2 fusion protein via CRISPR-Cas9-mediated in situ knock-in (35) (SI Appendix, Fig. S1A). To accurately mimic the endogenous regulation of H3.1, they also constructed an H3.1-Dendra2 transgene embedded within a 5 kb histone complex unit (35). This unit includes the promoters, coding sequences, and untranslated regions (UTRs) of all replication-coupled histones, and as shown in other studies, when present in multiple copies fully rescues the requirement for the native histone genes (35–37). Two transgenic H3.1-Dendra2 strains were generated, each carrying a full histone unit integrated at the attp40 (25C6) and vk33 (65B2) sites, respectively (35) (SI Appendix, Fig. S1B). By combining the Amodeo lab’s H3-Dendra2 lines with our custom-designed 3D-printed FlyVAB device (38)—a transparent abdominal imaging platform—we were able to track the segregation patterns of old and new endogenous histones during asymmetric divisions in both somatic stem cells and GSCs (SI Appendix, Fig. S1C).

Results

Old and New H3-Dendra2 Undergo Symmetric Segregation During ISC Asymmetric Divisions.

To achieve in vivo photoswitching of H3-Dendra2 for distinguishing preexisting (old) and newly synthesized (new) H3 in Drosophila stem cells, we immobilized adult flies using the FlyVAB device under mild compression (SI Appendix, Fig. S2 A–C). After abdominal transparency treatment, a 395 nm LED UV light was applied to photoconvert H3-Dendra2 from green to red fluorescence in abdominal organs (e.g., midgut and testis) (Fig. 1A). The flies were subsequently released from the device and maintained on standard cornmeal food. Notably, FlyVAB-mediated Dendra2 photoswitching caused no significant effects on feeding, excretion, or GSCs numbers (SI Appendix, Fig. S2 D–F).

Fig. 1.

Old and newly synthesized H3 undergo symmetric segregation during asymmetric division of ISCs. (A) Dendra2 photoswitching in live flies. FlyVAB was utilized to immobilize and make the abdomen of flies transparent (38). The female fly was fed a 5% sucrose solution containing blue dye for 24 h to identify the location of the midgut. A 395 nm LED light was directed onto the fly’s abdomen from below for 900 s to initiate Dendra2 photoswitching from green to red fluorescence. See also SI Appendix, Fig. S2 (A–C). (B) Schematic representation of the Dendra2 photoswitching regime. (C) Change of H3.1-Dendra2 from green to red in the midgut “before” and “after” photoswitching. esg>BFP was used to label the cytoplasm of precursors (ISCs and EBs). To enhance the visibility of Baz, white fluorescent Anti-PH3 staining was adjusted to overexposure hereafter. (D) Statistics of the H3.1-Dendra2 photoswitching efficiency in the midgut. The ratio of red to green fluorescence in a single esg⁺ cell was measured “before” and “after” photoswitching. n, number of esg⁺ cells. (E and F) Old (red) and newly synthesized (green) H3.3A (E)/H3.1 (F) showed indistinguishable patterns in prophase and metaphase and symmetric segregation in anaphase and telophase of ISC mitosis. During asymmetric ISC divisions, Baz was localized to the apical membrane of the EB daughter. White dotted lines outline dividing cells, and the orange arrowheads point to Baz. (G and H) Statistics of the old and newly synthesized H3.3A- (G) and H3.1- (H) Dendra2 fluorescence intensity ratio between ISC and EB daughters. The intensity ratio between a pair of ISC and EB daughters was obtained from anaphase or telophase of asymmetric ISC divisions. n, number of scored dividing cells. Data are mean ± SD. Statistical significance was determined by the unpaired t test. [Scale bar, 200 μm in (A), 10 μm in (C) and 5 μm in (E and F).]

In midguts of 5-d-old mated females, green H3.1-Dendra2 and H3.3A-Dendra2 were uniformly expressed in epithelial nuclei and almost completely converted to red within 900 s of UV light exposure (Fig. 1 C and D and SI Appendix, Fig. S3 A and B). To allow some stem cells to undergo at least a full S phase for de novo H3-Dendra2 (green) production, flies were dissected 20 h later (Fig. 1B). In intestinal epithelial cells that had not undergone the S phase of the cell cycle, the expression of newly synthesized H3.1-Dendra2 was barely detectable, whereas the expression of newly synthesized H3.3A-Dendra2 was evident in all cells (SI Appendix, Fig. S3C). This indicates that H3.1-Dendra2 expression is cell cycle-dependent, as expected, while H3.3A-Dendra2 expression is not.

Dividing ISCs were labeled via the progenitor-specific driver esg-Gal4-driven (39) blue fluorescent protein (BFP) expression and mitotic marker phospho-Ser10-histone H3 (PH3) staining (40, 41). Furthermore, since Baz localizes asymmetrically to the enteroblast (EB) daughter cell during ISC division, Baz immunostaining was performed to distinguish ISC vs. EB daughters (9–11).

During asymmetric ISC division, consistent with conclusions drawn using the heat shock-inducible system (18), old (red) and new (green) H3.3A-Dendra2 exhibited indistinguishable distribution patterns in prophase and metaphase, followed by symmetric segregation at anaphase and telophase (Fig. 1E). Fluorescence quantification showed that the ratio of either old or new H3.3A-Dendra2 in ISC to EB was close to 1:1 (Fig. 1G). However, in contrast to published results (18), endogenous old and new H3.1-Dendra2 showed congruent localization during prophase and metaphase, followed by symmetric segregation at anaphase and telophase (Fig. 1F). Fluorescence quantification further validated the symmetric partitioning of H3.1-Dendra2 (Fig. 1H). These results suggest that both H3.3A-Dendra2 and H3.1-Dendra2 are symmetrically segregated during ISC asymmetric divisions.

H3.1-Dendra2 Is Undetectable in Male GSCs But Expressed in Associated Somatic Cyst Stem Cells (CySCs) in Testes.

To assess the histone segregation in GSCs, we have focused on males, where Vasa-positive GSCs are recognized by encircling Fas III-positive hub cells at the tip of the testes (42, 43). GSCs are also enclosed by Vasa-negative somatic CySCs which divide asymmetrically to generate cyst cells, which further encapsulate spermatogonia and serve as another stem cell lineage for analysis (Fig. 2A) (44, 45). Both H3.1-Dendra2 and H3.3A-Dendra2 are expressed in CySCs, but unexpectedly, only H3.3A-Dendra2 is detectable in male GSCs (Fig. 2B). To further confirm the absence of H3.1-Dendra2 in GSCs, we generated flies carrying four copies of the H3.1-Dendra2 transgene and analyzed testes from 1- to 10-d-old males. Despite these efforts, H3.1-Dendra2 signal was undetected in GSCs (Fig. 2B and SI Appendix, Fig. S4 A and B). By contrast, H3.3A-Dendra2 exhibited robust expression in both GSCs and somatic cells (Fig. 2B and SI Appendix, Fig. S4B).

Fig. 2.

Old and newly synthesized H3.1 and H3.3A undergo symmetric segregation during germline stem cells (GSCs) and somatic CySCs mitosis. (A) Schematic representation of the male GSCs niche. Germline stem cells (GSCs) are located adjacent to the hub cells, and each GSC is surrounded by two somatic CySCs. Gonialblasts (GBs) are positioned next to GSCs and each GB is enveloped by two cyst cells. (B) H3.1-Dendra2 was not detectable in male GSCs, whereas H3.3A-Dendra2 was expressed. Hub cells were marked using anti-Fas III staining, while germline cells were labeled by anti-Vasa staining. GSCs were identified as Vasa⁺ cells adjacent to hub cells and somatic cyst cells were identified as Vasa^- cells at the tip of the testis. White dotted lines outline GSCs. (C) Change of H3.3A-Dendra2 from green to red in the testis “before” and “after” photoswitching. Anti-Fas III staining was applied to the green channel to label hub cells. To enhance the visibility of the newly synthesized green Dendra2, green fluorescent Anti-Fas III staining was adjusted to overexposure hereafter. (D) Old (red) and newly synthesized (green) H3.3A showed indistinguishable patterns in prophase and metaphase of GSCs mitosis, followed by symmetric segregation in anaphase and telophase. White dotted lines outline dividing cells. (E and F) Old (red) and newly synthesized (green) H3.3A/H3.1 showed indistinguishable patterns in prophase and metaphase and symmetric segregation in telophase of somatic CySC divisions. The white dotted square indicates the region of the dividing cell. (G) Statistics of the H3.3A-Dendra2 photoswitching efficiency in the testis. The ratio of red to green fluorescence in a single Vasa⁺ cell was measured “before” or “after” photoswitching. n, number of scored Vasa⁺ cells. (H) Statistics of the old and newly synthesized H3.3A-Dendra2 fluorescence intensity ratio between GSC and GB daughters. The intensity ratio between a pair of GSC and GB daughters was obtained from anaphase or telophase of asymmetric GSC divisions. n, number of scored dividing cells. (I and J) Statistics of the old and newly synthesized H3.3A (I) and H3.1 (J) Dendra2 fluorescence intensity ratio between two somatic daughters. The ratio was obtained from anaphase or telophase of somatic CySC divisions. n, number of scored dividing cells. Data are mean ± SD. Statistical significance was determined by the unpaired t test. [Scale bar, 5 μm in (B) and (D–F) and 10 μm in (C).]

H3.1-Dendra2 and H3.3A-Dendra2 Undergo Symmetric Segregation During Asymmetric CySC Divisions as does H3.3A-Dendra2 in GSC Divisions.

After photoconversion, old H3.3A-Dendra2 and H3.1-Dendra2 in testes were almost completely converted to red fluorescence (Fig. 2 C and G and SI Appendix, Fig. S4C). After a 20-h recovery period to allow some stem cells to complete at least a full S phase (Fig. 1B), we dissected testes and performed PH3 staining to analyze the distribution of old and new H3 in mitotic GSCs and CySCs. Our results showed that during asymmetric divisions of GSCs and CySCs, old and new H3.3A-Dendra2 exhibited indistinguishable distribution patterns in prophase and metaphase, followed by symmetric segregation between daughter cells in anaphase and telophase (Fig. 2 D, E, H, and I). Given the absence of H3.1-Dendra2 expression in GSCs, we focused on its distribution in dividing CySCs. Our data showed that both old and new H3.1-Dendra2 were symmetrically distributed between CySC daughter cells (Fig. 2 F and J). These results reiterate our findings in ISCs, indicating that in both ISCs and CySCs, old and new H3.1-Dendra2 and H3.3A-Dendra2 are symmetrically segregated during asymmetric cell divisions.

H3.1-Dendra2 That Bypasses Repression During Asymmetric GSC Divisions Undergoes Symmetric Segregation.

The failure of H3.1-Dendra2 to be expressed in GSCs precludes assessing the segregation of native H3.1 in GSCs, and indeed, raises the question of whether H3.1 is normally expressed in these cells. We have used three approaches to bypass this unexpected repression to assess whether H3.1 that is expressed in GSCs is segregated symmetrically or asymmetrically.

The Drosophila genome contains two H3.3-encoding genes: H3.3A and H3.3B (46). H3.3A is located on the second chromosome, while H3.3B is located on the first. Despite this, both encode identical H3.3 proteins (46). In the first approach, we have taken advantage of the fact that in somatic cells, loss of both H3.3A and H3.3B triggers compensatory up-regulation of H3.1 to form replication-independent nucleosomes (47, 48). To determine whether H3.1-Dendra2 could be expressed in GSCs under H3.3-deficient conditions, we introduced two copies of H3.1-Dendra2 into H3.3B⁰; H3.3A^2X1 double mutants (47, 48). Although H3.3B⁰; H3.3A^2X1 homozygotes were previously reported as viable but sterile (47, 48), we obtained only four adult escapers (three males, one female) from thousands of progeny. Critically, even in these rare homozygous mutants, H3.1-Dendra2 remained undetectable in GSCs (SI Appendix, Fig. S5A), confirming germline-specific suppression of H3.1. The presence of GSCs in escapers suggests residual H3.1 expression below our detection limit may support germline survival.

While previous studies attributed germline defects in H3.3B⁰; H3.3A^2X1 mutants to meiotic failure (48), we observed reduced GSC numbers, increased hub cells, and occasional mini-testis phenotypes in H3.3B⁰; H3.3A^2X1/+ mutants (SI Appendix, Fig. S5B). Quantification revealed that homozygosity for H3.3B mutations had no effect on GSC numbers, whereas heterozygosity for the H3.3A null allele significantly reduced GSC populations, indicating a unique dose sensitive requirement for H3.3A in GSC maintenance (SI Appendix, Fig. S5 C and D). Regardless, the failure of H3.3 null mutations to bypass the block to H3.1 expression in GSCs, negated the use of these mutations as a means to analyze asymmetric segregation of new and old H3.1 in GSCs.

In the second approach, we exploited the fact that H3.1 differs from H3.3A in just four amino acids (49, 50) (Fig. 3A). Because H3.3A is robustly expressed in GSCs, we constructed an H3.3A^H3.1-Dendra2 allele by CRISPR/Cas9-mediated replacement of these four residues in H3.3A with H3.1 equivalent sequences (Fig. 3A). This H3.3A^H3.1-Dendra2 exhibited ubiquitous H3.1-Dendra2 expression in both testis and intestine (Fig. 3B and SI Appendix, Fig. S5E). During asymmetric division of GSCs and CySCs, old and new H3.3A^H3.1-Dendra2 showed indistinguishable distribution at prophase/metaphase and symmetric segregation at anaphase/telophase (Fig. 3 C and D and SI Appendix, Fig. S5 F and G). Notably, H3.3A^H3.1-Dendra2/+ flies phenocopied H3.3A^2X1/+ flies showing similar degrees of GSC loss and impaired mitotic activity (Fig. 3 E–G and SI Appendix, Fig. S5 C and D), indicating that H3.1 cannot functionally replace H3.3A in maintaining GSC fate and division capacity. Our results demonstrate that H3.3A is indispensable for GSC maintenance and that, when expressed from the native H3.3A locus, H3.3A^H3.1-Dendra2 undergoes symmetric segregation during asymmetric GSC division.

Fig. 3.

Old and newly synthesized H3.3A^H3.1-Dendra2 show symmetric segregation during asymmetric division of GSCs. (A) Schematic of the H3.3A amino acid substitution to the H3.1 amino acid sequence via CRISPR/Cas9-mediated in situ base editing. (B) H3.3A^H3.1-Dendra2 expression in the testis. (C) Old (red) and newly synthesized (green) H3.3A^H3.1-Dendra2 showed indistinguishable patterns in prometaphase, and symmetric segregation in anaphase and telophase of GSCs mitosis. White dotted lines outline dividing GSCs. (D) Statistics of the old and newly synthesized H3.3A^H3.1-Dendra2 fluorescence intensity ratio between GSC and GB daughters. The ratio was obtained from anaphase or telophase of asymmetric GSC divisions. n, number of scored dividing cells. (E) Representative images of GSCs surrounding the hub cells in the testes from each indicated genotype. White dotted lines outline GSCs. (F) Statistics of the number of GSCs in testes for each genotype. n, number of testes. (G) Division index of male GSCs. n, groups of testes (three testes per group). Data are mean ± SD. Statistical significance was determined by the unpaired t test. [Scale bar, 10 μm in (B) and (E) and 5 μm in (C).]

In the third approach, we sought to analyze H3.1-Dendra2 distribution during GSC asymmetric division without disrupting H3.3A by engineering H3.1-Dendra2 transgenic flies in which the regulatory element that normally mediates H3.1 repression in GSCs is no longer present. To do so, we first performed experiments to determine whether the relevant regulatory element resides in the H3.1 promoter, 5’UTR, CDS, or 3’UTR.

Replacing the H3.3A-Dendra2 promoter with the putative H3.1 promoter (185 bp, H3.1^P) drove H3.3A-Dendra2 expression in GSCs (Fig. 4A), ruling out the H3.1 promoter as the causal factor.

Fig. 4.

H3.1-Dendra2 undergoes symmetric segregation during asymmetric GSC divisions. (A) H3.1 promoter drives H3.3A-Dendra2 expression in male GSCs. (B) Table summarizing the effect of six different combinations of components on the expression of Dendra2 tagged H3.1 or H3.3A in GSCs of transgenic flies. (C) The H3.1-Dendra2 construct fused with the H3.3A 3’UTR showed Dendra2 expression in male GSCs. (D) Schematic representation of the 185 bp, 242 bp, and 2 kb regions selected from the putative H3.1 promoter. (E) The 242 bp H3.1 promoter drove H3.1-Dendra2 expression in GSCs and somatic cells. (F) Old (red) and newly synthesized (green) H3.1^PL1-H3.1^5U-H3.1-Dendra2-H3.3A^3U (H3.1’-Dendra2) showed symmetric segregation in telophase of GSC mitosis. White dotted lines outline dividing GSCs. (G) Statistics of the old and newly synthesized H3.1’-Dendra2 fluorescence intensity ratio between GSC and GB daughters. n, number of scored dividing cells. (H) Statistics on the number of male GSCs in control: H3.1-Dendra2 (H3.1-D) and H3.1’-Dendra2 (H3.1’-D). n, number of testis. (I) H3.1-Dendra2 was detectable in male GSCs after nanos or pumilio (pum) knockdown. Control: H3.1-Dendra2. The yellow arrowheads point to Vasa− somatic cells in (A), (C), and (E). White dotted lines outline GSCs in (A), (C), and (I). Data are mean ± SD. Statistical significance was determined by the unpaired t test. [Scale bar, 5 μm in (A), (C), (E), (F), and (I).]

Using the H3.1^P promoter, we constructed transgenic plasmids 1-3 (containing the H3.3A-Dendra2 CDS with one intron) and plasmids 4 to 6 (containing the intronless H3.1-Dendra2 CDS) to investigate the cause of H3.1-Dendra2 absence in GSCs (Fig. 4B). Constructs 1, 3, 4, and 6 carried the H3.1 5’UTR, whereas constructs 2 and 5 utilized the H3.3A 5’UTR (Fig. 4B). For 3’UTR configurations, constructs 1, 2, 4, and 5 carried the H3.1 3’UTR, while constructs 3 and 6 utilized the H3.3A 3’UTR (Fig. 4B). Our results revealed that neither the 5’UTR nor the CDS sequences influenced H3.1-Dendra2 expression in GSCs (Fig. 4 B and C and SI Appendix, Fig. S6 A–E). However, transgenic flies carrying the H3.1 3’UTR exhibited no detectable Dendra2 signal in GSCs (Fig. 4B and SI Appendix, Fig. S6 A, B, D, and E), whereas those with the H3.3A 3’UTR consistently displayed robust Dendra2 expression in GSCs (Fig. 4 B and C and SI Appendix, Fig. S6C). Collectively, these experiments demonstrate that the suppression of H3.1-Dendra2 in GSCs is mediated specifically by the H3.1 3’UTR sequence.

Notably, H3.1^P failed to drive H3.1-Dendra2 in CySCs (Fig. 4 A and C and SI Appendix, Fig. S6C) suggesting that CySC expression of H3.1 depends on sequences not present in the 185 bp of H3.1^P. To resolve this and to define an extended the H3.1 promoter that is more likely to include all the regulatory elements that dictate normal H3.1 expression, we added adjacent H4 (242 bp, H3.1^PL1) or H2A (2 kb, H3.1^PL2) regions (Fig. 4D). Both extended promoters with the H3.3A 3’UTR enabled pan-testis H3.1-Dendra2 expression (Fig. 4E and SI Appendix, Fig. S6F). As we observed for the segregation of old and new H3.1-Dendra2 expressed in GSCs from the H3.3A^H3.1-Dendra2 allele, H3.1-Dendra2 expressed from the H3.1^PL1-H3.1^5U-H3.1-Dendra2-H3.3A^3U (H3.1’-Dendra2) transgene likewise showed symmetric segregation in GSCs, displaying indistinguishable prophase/prometaphase localization and symmetric telophase segregation (Fig. 4 F and G and SI Appendix, Fig. S6G), with no impact on GSC numbers (Fig. 4H).

Replication-dependent H3.1 lacks a poly-A tail but contains a stem-loop structure in its 3’UTR for SLBP-mediated S-phase translation (51–53). We hypothesized that the zinc-finger protein Nanos and the RNA-binding protein Pumilio, which function as a translational repression complex (54–57), are responsible for blocking both endogenous H3.1 and H3.1-Dendra2 translation in GSCs. Indeed, Nanos/Pumilio knockdown (nanos-Gal4>nanos RNAi or pumilio RNAi) restored H3.1-Dendra2 expression in Drosophila GSCs (Fig. 4I and SI Appendix, Fig. S7 A and B), suggesting that H3.1 translation is actively suppressed by Nanos/Pumilio complexes in GSCs.

Taken together, both successful approaches to bypassing the normal repression for H3.1-Dendra2 in GSCs yielded the same result: H3.1-Dendra2 segregated symmetrically during asymmetric GSC divisions. These results add to our analysis of H3.1-Dendra2 segregation in asymmetric ISC and CySC divisions and yield consistent results, namely, that in all contexts of asymmetric stem cell divisions that we have tested, H3.1-Dendra2, like H3.3A-Dendra2, segregates symmetrically. These results raise the question of why previous studies have led to the opposite conclusion of asymmetric H3.1 segregation in asymmetric stem cell divisions (18, 19). To address this, we have replicated prior experiments in female ISCs and male GSCs using the identical heat-shock-inducible dual-color system. Despite using the same reagents and protocols as previously described (18, 19), we failed to identify asymmetric H3.1 distribution in both ISC and GSC divisions (SI Appendix, Figs. S8–S10). Instead, our results with the dual color system are in accord with our present results using photoswitching.

Discussion

The idea that asymmetric segregation of cellular components during stem cell division could underlie fate differences between daughters has a long and contested history. Early microdissection studies in grasshopper neuroblasts demonstrated that cell fate was determined by cytoplasmic volume and cortical positioning, rather than by any intrinsic asymmetry between sister chromatids (58, 59). These foundational works argued against models in which epigenetic information preloaded onto chromosomes dictates cell fate. Nevertheless, the hypothesis that asymmetrically inherited “old” histones carrying specific modifications could intrinsically define stem cell identity has remained seductive (60–62), culminating in a series of studies proposing that replication-dependent histones (H3.1/H4) are asymmetrically segregated during Drosophila stem cell divisions to differentially program daughter cell fates (18–20). This model posits a complex coordination of numerous moving parts, from biased histone incorporation during DNA replication across thousands of replication forks to the specific recognition and segregation of “old histone-rich” chromatids by the mitotic machinery (63). However, the central experimental evidence for this model has relied on a non-native expression system, raising the possibility of artifact. Our study was designed to reassess the phenomenon of asymmetric histone segregation under conditions that closely mimic endogenous histone expression and regulation.

Using an in vivo photoconversion approach to track endogenously regulated H3.1 and H3.3A, we found that both old and new histones were symmetrically segregated during the asymmetric divisions of ISCs and GSCs. In the case of male GSCs, we found an unexpected layer of posttranscriptional repression that prevents H3.1 expression via its 3’UTR, mediated by Nanos and Pumilio. Critically, when we bypassed this repression through two independent strategies—by replacing the H3.1 3’UTR or converting the H3.3A coding sequence to H3.1—the resulting H3.1 protein was robustly expressed in GSCs yet still segregated symmetrically during division. Importantly, the symmetric inheritance of H3.1 generated by replacing the H3.1 3’UTR had no discernible effect on the ability of GSCs to self-renew or produce differentiated daughters, as GSC numbers and lineage outcomes remained normal. The failure of symmetrically inherited old and new H3.1 to perturb normal GSC stem cell lineages provides functional evidence against a causal role for their asymmetric inheritance in dictating asymmetric cell fate determination in this lineage.

Importantly, our findings are also consistent with a large body of evidence in yeast and mammalian cells showing symmetric distribution of parental histones to sister chromatids during replication (64–66). They also align with the extensive literature demonstrating that extrinsic signals from the niche and intrinsic polarity machinery are sufficient to orchestrate asymmetric cell fates in Drosophila stem cells (8, 9, 12). The fact that we observed symmetric histone segregation under endogenous labeling conditions, and furthermore, that symmetric inheritance did not disrupt lineage asymmetry, poses a significant challenge to the model that biased histone segregation is a fundamental mechanism for stem cell fate determination.

An obvious question is why our results differ from prior studies that reported asymmetric H3.1 segregation. We note that we have repeated the key experiments from these studies using the same heat-shock-induced Flp-out system and failed to observe asymmetry (SI Appendix, Figs. S8–S10). This suggests that the technical concerns associated with the Gal4/UAS system—such as continuous, cell cycle-uncoupled expression of histones and potential overexpression artifacts—may not be the primary source of the discrepancy, as we did not observe asymmetry even when using this system. The reason for the difference between our results and the previously published findings remains unresolved. However, our data, generated under physiological conditions with endogenously regulated histones, provides a robust and compelling body of evidence that calls for a reevaluation of the asymmetric histone segregation hypothesis.

In this study, we utilized H3-Dendra2 to visualize the segregation patterns of H3. While this endogenous labeling strategy avoids the nonphysiological, continuous expression inherent to the Gal4/UAS system, it is important to note that the Dendra2 tag may alter certain aspects of native H3 behavior, such as protein stability or incorporation kinetics. Future studies employing untagged endogenous labeling strategies could further validate these findings.

Materials and Methods

Drosophila Culture and Maintenance.

Drosophila strains and reagents used in this study are listed in SI Appendix, Tables S1 and S2. Standard cornmeal food was prepared according to the following recipe: 210 g dry inactivated yeast (Angel Yeast Co., Ltd.), 900 g yellow cornmeal, 120 g soybean meal, 100 g agar (Solarbio, Cat#A8190), 800 ml light corn syrup, 150 ml propionic acid (Aladdin, Cat#P110444), and 12 L water. Drosophila strains used in this study and their sources are listed in the Key Resources Table. All flies were cultured and crossed at 25 °C and 65% humidity with a 12-h light:12-h dark daily cycle, unless otherwise indicated. 3-5 d flies were collected after eclosion. Mated females were used for midgut experiments, and mated males were used for testes experiments.

Experiments Using the Heat-Shock-Inducible Dual-Color System.

ISC.

The female flies were kept at 25 °C until adulthood (18). After eclosion, the flies were collected to new vials and aged for 10 d. On day 10, the flies were transferred to new empty vials and heat shocked for 90 min at 37 °C in a water bath. The flies were then recovered at 29 °C for 18 h before dissection.

GSC.

The male flies were kept at 18 °C until adulthood (19). After eclosion, 0- to 3-d-old males were collected to new empty vials. Then, the flies were transferred into the 37 °C water bath for 2 h and recovered in the 29 °C incubator for 20 h before dissection and immunostaining experiments.

Quantification of GFP, mKO, and Dl-nLacZ Fluorescent Signals.

Values of GFP, mKO, and Dl-nLacZ were measured using the “Draw Spline Contour” tool in Zen 2.3. The volume of dividing cells was determined from Z-stack images using a Zeiss800 confocal microscope. The interval between Z-stack images was 1.2 μm. Images were processed by orthogonal projection. Then, a cell region was outlined, and the fluorescence intensity was recorded for each channel. A background measurement was then taken in an area with no fluorescence signal, using the same-sized region that had been measured previously. This background measurement was then subtracted from the initial one. The fluorescence intensity of GFP, mKO, or Dl-nLacZ in a cell was calculated as follows: (Mean fluorescence intensity in the cell - Background fluorescence intensity) × Cell area. The ratio of GFP/mKO/Dl-nLacZ fluorescence intensity between two cells was calculated as fluorescence in stem cell/fluorescence in daughter cell.

Distinguish Between ISC–ISC Pairs and ISC–EB Pairs by Using Dl-nLacZ.

To quantify the relative abundance of old and new histones in postmitotic ISC–ISC and ISC–EB cell pairs, we adhere to the standards set out in previous studies (18). The nuclei of both cells were required to be within a 5 μm distance, and their size difference could not exceed 1.5-fold to exclude polyploid ECs. Additionally, the cell pairs needed to exhibit quantifiable levels of H3.1-GFP and H3.1mKO. Using the established methodology, we measured H3.1-GFP, H3.1-mKO, and Dl-nLacZ levels in the cell pairs. The cell displaying higher Dl-nLacZ expression was designated as Cell 1, with its counterpart labeled Cell 2. Ratios were calculated by dividing Cell 1 values by Cell 2 values for each parameter. Pairs exhibiting Dl-nLacZ ratios >2 were classified as Delta asymmetric cell pairs (ISC–EB), while those with ratios <2 were deemed Delta symmetric cell pairs (ISC–ISC). The Cell 1/Cell 2 ratios for H3.1-GFP and H3.1-mKO were subsequently quantified separately for ISC–EB and ISC–ISC pairs.

Dendra2 Photoswitching in Live Flies.

Flies carrying the Dendra2 cassette were collected in a vial shortly after eclosion and cultured at 25 °C with fresh food changed daily. 3 to 5 d later, wings were removed to avoid hyaluronic acid or water residue on the fly’s wings to prevent sticking to the food.

The device for Dendra2 photoswitching consists of 2 parts: the FlyVAB and the UV light system. FlyVAB is made by 3D printing to press and immobilizing the abdomen of the fly with wings removed. The abdominal cuticle of flies was coated with hyaluronic acid or water, which fits tightly to the coverslip under pressure, thus making the abdominal cuticle transparent (SI Appendix, Fig. S2A) (38). The 395 nm LED light source was placed directly underneath the abdomen of Drosophila located in the FlyVAB and the organs in the abdomen were irradiated through the coverslip (Fig. 1A). To fully photoswitch Dendra2 in both midgut and testis, the abdomen of the fly was irradiated for 900 s. The 3D printing models of FlyVAB were designed by Tinkercad (https://www.tinkercad.com) and the model files were deposited in figshare: https://figshare.com/s/3cacfe16a631d3ba6352.

Dissection Timing After the Photoswitching.

After photoswitching, flies were allowed to recover at 25 °C to allow some stem cells to undergo a complete S phase and obtain newly synthesized His-Dendra2. For ISCs, female flies were allowed to recover at 25 °C for 20 h. For GSCs, male flies were allowed to recover at 25 °C for 20 h prior to dissection for immunofluorescence staining.

Quantitative Statistics of Histone Distribution.

ISC–EB cell pairs were marked by esg>BFP and identified by the cell polarity protein Bazooka (Baz) (6, 67, 68). An ISC was identified as the Baz⁻/BFP⁺ daughter at the basal side of the mitotic division; an enteroblast (EB) was identified as the Baz⁺/BFP⁺ daughter at the apical side of the mitotic division. Fas III staining was used to label hub cells, and Vasa staining was used to label germline cells. GSCs were identified as Vasa⁺ cells adjacent to hub cells, and gonialblasts (GBs) were identified as germline cells next to GSCs. Somatic cyst cells were identified as Vasa^- cells at the tip of the testis. The cell division antibody Phospho-Ser10-histone 3 (PH3) staining was used to label dividing cells. The phase of cell division was determined by the morphology of the chromosomes and the shape of dividing cells.

The fluorescence intensity of old (red) and newly synthesized (green) His3.1-Dendra2 were then quantified using the method described as follows: The volume of dividing GSCs or ISCs was determined from Z-stack images using a Zeiss800 confocal microscope. The interval between Z-stack images was 1.2 μm. Images were processed by orthogonal projection. The cell region was outlined using the “Draw Spline Contour” tool in ZEN 2.3. The cell area and the mean fluorescence intensity of Dendra2 were calculated using the ZEN 2.3 Measurement Feature function. Background fluorescence intensity was measured in the no fluorescence signal regions next to the outlined cells. The fluorescence intensity of red or green Dendra2 in a cell was calculated as follows: (Mean fluorescence intensity in the cell - Background fluorescence intensity) × Cell area. The ratio of old (or newly synthesized) histones between two cells was calculated as fluorescence in stem cell/fluorescence in daughter cell.

The Impact of Dendra2 Photoswitching on Drosophila.

Male and female flies were collected in a vial shortly after eclosion and maintained at 25 °C with fresh food changed daily. 3 to 5 d later, flies were processed by wing removal. After wing removal, flies were divided into 3 groups, each subjected to distinct treatments followed by subsequent experiments.

• 1)Control Group 1 (Ctrl 1): Wings were removed.
• 2)Control Group 2 (Ctrl 2): After wing removal, flies were fixed and pressed using FlyVAB for 900 s.
• 3)UV Treatment Group (UV): After wing removal, flies were fixed and pressed using FlyVAB and irradiated with UV LEDs for 900 s.

Food intake measurement.

Genotype: hs-flp; H3.1-Dendra2/ Cyo; H3.1-Dendra2/ TM6B

Dye-based food intake measurement was employed to assess the food intake of mated females. After treatment, the flies were then transferred to an incubator containing 0.5% erioglaucine disodium salt (Sigma, Cat# 861146) for 12 h. To account for potential interference from food and fly tissue, 21 flies of the same genotype and age were placed on normal food without erioglaucine disodium salt as a reference group. After the incubation period, flies were collected in 1.5 mL EP tubes and frozen at −20 °C for 2 h. They were then snap-frozen in liquid nitrogen for 1 min and vigorously shaken to remove the heads, legs, and wings. The remaining fly bodies were transferred to new 1.5 mL EP tubes, with 3 flies per tube. Next, 400 μL of 1× PBS solution was added to each tube, and the samples were homogenized and centrifuged at 15,900×g for 30 min. The supernatant (100 μL) was pipetted into a 96-well plate, and the absorbance at 620 nm was measured three times per sample. Food intake was quantified by calculating the difference in absorbance: (Average absorbance of flies fed blue food) – (Average absorbance of flies fed normal food).

Defecation assay.

Genotype: hs-flp; H3.1-Dendra2/ Cyo; H3.1-Dendra2/TM6B

After treatment, the female flies were transferred to vials containing a 5% sucrose solution mixed with food dye (royal blue, AmeriColor® Soft Gel Paste™) and fed at 25 °C for 12 h. After this feeding period, flies were moved to new vials, each containing filter paper soaked in the same sucrose/blue dye solution at the bottom, with 3 flies per vial. The flies were then maintained for a further 12 h at 25 °C. Finally, the number of blue dotted deposits (excretions) on the walls of the vials and foam caps was counted.

Counting the number of GSCs.

Genotype: hs-flp; H3.3A-Dendra2/ Cyo; MKRS/TM6B

Following treatment, male flies were maintained at 25 °C with fresh food changed daily. Flies were dissected and fixed 5 d later. GSCs were identified by immunofluorescence staining for Vasa and Fas III, and GSC numbers were quantified as described in the section above “Quantitative statistics of Histone distribution.”

Counting the Number of GSCs in His3.3 Mutant Flies.

Male and female flies were collected in a vial shortly posteclosion and maintained at 25 °C with fresh food changed daily. No additional treatments were applied. Five days later, male flies were dissected, and the number of GSCs was counted as described in the section above “Quantitative statistics of Histone distribution.”

H3.3A^H3.1-Dendra2 construction.

There are 4 amino acid differences between His3.3A and His3.1. H3.3A^H3.1-Dendra2 construct was generated using CRISPR/Cas9-mediated seamless genome editing, in which the H3.3A-Dendra2 amino acid sequence was replaced with the H3.1 amino acid sequence through base substitution. Details of the base substitution are provided in the underlined section of SI Appendix, Table S3.

Two small guide RNA (sgRNA, His3.3A-g1: CATCGGGGGTATTCCGTATA; Dendra2-g2: CGCCTTCGTGATCGAGGGCG) were designed by CCTop (https://cctop.cos.uni-heidelberg.de:8043) to induce double-strand breaks (DSBs). To introduce mutations through DNA homologous repair, a plasmid carrying four His3.1 amino acid substitutions from His3.3A with two flanking homologous arms (~1 k and ~0.6 k respectively) was constructed, as well as the two nonsense mutations on the sgRNA NGG sites (His3.3A-g1’: CATCGGGGGTATTCCGTATAat^(g-t)g; Dendra2-g2’: CGCCTTCGTGATCGAGGGCGaa^(g-a)g). The primers used to amplify PCR products are listed in SI Appendix, Table S3. Lowercase letters are bases present in the plasmid.

To generate the His3.3A^H3.1 construct with 4 amino acid substitutions, five PCR product segments (seg1, seg2, seg3, seg4, and Dendra2) were assembled into the Kpn I site of the pUASt-attB vector (a kind gift from Dr. Zhaohui Wang’s lab, Institute of Genetics and Developmental Biology Chinese Academy of Sciences) using the ClonExpress® MultiS One Step Cloning Kit (Vazyme, C117).

To construct the His3.3A-Dendra2 transgenic sgRNA plasmid, sgRNA was amplified from the PCR8 vector (a kind gift from Dr. Chen Haiyang’s lab, West China School of Medicine) with the U6 promoter modified by our laboratory. PCR fragments were amplified from the modified PCR8 vector using the primers listed in SI Appendix, Table S4. Lowercase letters are bases present in the plasmid.

sgRNA-1 and sgRNA-2 were generated through ligation PCR. Subsequently, sgRNA-1 was integrated into the pUAST-attB vector via homologous recombination using the Gateway™ LR Clonase™ II Kit (Invitrogen, 11791100). The second sgRNA, sgRNA-2, was inserted into the Kpn I site of the pUAST-sgRNA-1 vector using the ClonExpress® II One Step Cloning Kit (Vazyme, C112).

The His3.3A-Dendra2 sgRNA transgenic fly was obtained by microinjecting pUAST-sgRNA-1-sgRNA-2 into the 89E11 locus (vk27) (performed by Unihuaii Ltd.). The transgenic fly was crossed with opposite-sex yw; nanos-Cas9 (II-attP40) flies to induce DSBs in the germline cells of F1 embryos. The base substitution plasmid of pUASt-attB-His3.3A^H3.1-Dendra2 was injected into these F1 embryo germline cells to achieve His3.1 amino acid substitution. After eclosion, F1 adult flies were single-crossed with hs-flp; If/ CyO; MKRS/ TM6B opposite-sex flies. And then the F2 flies were continued to be single-crossed with opposite-sex hs-flp; If/ CyO; MKRS/ TM6B flies and the substitution events were identified by PCR (Primers containing the His3.3A mutation site-F: TCCAGTCGTCGGCCGTTATG/ Dendra2-3’-R: TTACCACACCTGGCTGGGCA; total 980 bp). One successful seamless repaired allele was selected from 118 crosses.

GSC Division Index.

Mated male flies were collected 3 d after eclosion. Testes were then dissected and stained for PH3. Fas III and Vasa antibody staining was used to identify dividing GSCs. The number of dividing GSCs and the total number of GSCs were counted in groups of 3 testes. The GSC division index was then calculated using the formula: (number of PH3⁺ GSCs)/(total GSCs number).

Generation of Transgenic Flies to Investigate H3.1 Nonexpression in GSCs.

The primers listed in SI Appendix, Table S5 were used for PCR amplification of target fragments. These fragments were subsequently integrated into the pUASt-attB vector using the ClonExpress® MultiS One Step Cloning Kit (Vazyme, C113-02/C117). Prior to integration, the vector was modified by removing the UAS, hsp70, and sv40 sequences through Hind III and Sac II digestion. Lowercase letters are bases present in the plasmid in SI Appendix, Table S5.

All plasmids were integrated into the 25C6 site (attP40) by microinjection (performed by Unihuaii. Ltd) to generate transgenic flies. Genotypes are listed in SI Appendix, Table S6.

Immunostaining and Fluorescence Microscopy.

Intestines or testes from flies were dissected in 1 × PBS (BOSTER, Cat#AR0030), and then fixed in 1 × PBS with 4% formaldehyde (Sigma-Aldrich, Cat#F8775) for 50 min (midgut) or 20 min (testis). Fixed samples were rinsed three times with 0.3% Triton-100 (Sangon Biotech, Cat# A110694-0500) in PBS (PBST) and then washed in PBST for 15 min at room temperature (25 °C) with gentle shaking. After PBST removal, samples were incubated with primary antibodies for 2 h at room temperature or overnight at 4 °C. Primary antibody dilutions were as follows: guinea pig anti-Vasa at 1:4000 (DSHB, AB_366032); mouse anti-Fas III 1:200 (DSHB, AB_528238); rabbit anti-Baz 1:10,000 [Guo lab (10)]; rabbit anti-PH3 1:4,000 (H3S10P, Millipore #2465253). After primary antibody incubation, samples were rinsed three times with PBST and washed for 15 min at room temperature with shaking. Subsequently, samples were incubated for 2 h with Alexa Fluor-conjugated secondary antibodies listed in SI Appendix, Table S1 at a 1:4,000 dilution. Nuclei were stained with 1 μg/mL DAPI (Sigma-Aldrich, 28718-90-3) for 15 min, followed by three PBST washes and a final rinse with shaking for 30 min. Samples were then mounted in 70% glycerol (Sinopharm, Cat#10010618) and imaged using a confocal microscope (Zeiss LSM800) with Plan-Apochromat 10×/0.45 M27 20×/0.8 M27, 63×/1.40 Oil DIC M27 objectives (imaging medium: immersol^TM 518 F obtained from Zeiss). Imaging temperature was at room temperature (25 °C). Image acquisition and processing were conducted using ZEN 2.3 software, while merging and resizing of images were performed using Adobe Photoshop CC and Illustrator CS6.

Statistical Analysis.

Statistical analyses were performed using GraphPad Prism 9 (GraphPad Software). Data were analyzed using two-tailed unpaired t-tests, and results were expressed as P values. All statistical outcomes are presented as mean ± SD. Detailed statistical information for each experiment is provided in the corresponding figures and figure legends.

Supplementary Material

Appendix 01 (PDF)

Dataset S01 (XLSX)

Data, Materials, and Software Availability

All study data are included in the article and/or supporting information.