Skip to main content
NCBI home page
JAC-Antimicrobial Resistance logoLink to JAC-Antimicrobial Resistance
. 2025 Nov 5;7(6):dlaf203. doi: 10.1093/jacamr/dlaf203

Molecular detection of carbapenemases in critical microorganisms since the onset of the COVID-19 pandemic in Peru

Maritza Mayta-Barrios 1,✉, Juan Ramírez-Illescas 2, Juan Pacori 3, Joshi Acosta 4, Luis Pampa-Espinoza 5, Javier Silva-Valencia 6, Alicia Núñez-Llanos 7, Celinda Bendezú 8, Kevin Serrano 9, Martín Yagui-Moscoso, on behalf of the10; Working group in the national surveillance of antimicrobial resistance b
PMCID: PMC12596109  PMID: 41210187

Abstract

Objective

Identify and characterize carbapenemase genes in bacterial isolates of Enterobacterales, Acinetobacter baumannii, and Pseudomonas aeruginosa collected through the National Surveillance of Antimicrobial Resistance (AMR) Program during the COVID-19 pandemic in Peru.

Methods

This retrospective, observational study analysed 2049 submitted due to suspected portability of carbapenemase genes, collected between January 2020 and August 2022. Samples were obtained from 61 hospitals in 18 of the 25 regions of Peru (72%) that participated in the National Surveillance AMR Program.

Results

Among the isolates, 860 were Enterobacterales, 771 were A. baumannii, and 418 were P. aeruginosa. Carbapenemase genes were detected in 1735 isolates (84,6%). The most prevalent genes identified were blaNDM (561, 78.13%) in Enterobacterales, blaOXA-24-like (488, 67.8%) in A. baumannii, and blaIMP (188, 63.3%) in P. aeruginosa. Notably, rare occurrences of blaNDM were identified in P. aeruginosa (5, 1.7%). Combinations of carbapenemase genes were identified including blaIMP + blaVIM  in P. aeruginosa, with a rising trend, but also blaKPC + blaNDM (7, 1%) blaNDM + blaOXA-48-like (1, 0.14%), blaNDM + blaIMP (2, 0.3%), and blaNDM + blaVIM (2, 0.3%) in Enterobacterales; and blaOXA-23 + blaOXA-24-like (11, 1.5%), blaNDM + blaOXA-24-like (2, 0.3%), and blaNDM + blaOXA-58-like (1, 0.1%) in A. baumannii.

Conclusion

This study highlights the significant detection of carbapenemase genes and their combinations in Peru during the COVID-19 pandemic. These findings underscore the urgent need for enhanced AMR surveillance, antimicrobial stewardship, and targeted infection control strategies to address this critical public health threat.

Introduction

Antimicrobial resistance (AMR) is a significant global threat to public health, leading to increased mortality rates, prolonged hospital stays, and rising healthcare costs. Beyond these direct human health impacts, AMR also indirectly affects societies by reducing productivity and increasing treatment expenses.1 The WHO recognizes Antimicrobial Resistance (AMR) as a critical global health threat and has established a global action plan with five strategic objectives aimed to enhance the treatment and prevention of infectious diseases. A key component of this plan is strengthening knowledge through surveillance and research.1 AMR surveillance of pathogen diversity and geographic distribution, including monitoring resistance patterns and treatment effectiveness, is vital for guiding clinical treatment, tracking outbreaks, and informing public health interventions at both local and national levels.1

In 2017, the WHO identified A. baumannii, P. aeruginosa, E. coli, and K. pneumoniae as critical priority pathogens due to their high levels of resistance to carbapenems, a class of broad-spectrum antibiotics considered essential for treating severe infections.2,3 Carbapenem resistance often arises from different mechanisms, with the production of carbapenemase enzymes being the most clinically significant.4 Carbapenemases are classified into Ambler classes A, B, and D based on their molecular structure.5 These carbapenemase genes are frequently plasmid-borne, facilitating their rapid spread of resistance across different bacterial species and genera.6–8

Bacteria isolated from healthcare settings often exhibit multidrug resistance, including resistance to β-lactam antibiotics. The expression of multiple carbapenemases simultaneously further limits treatment options and complicates patient management.9–11

The emergence and spread of carbapenem-resistant bacteria due to carbapenemase production is driven by multiple factors, including population density, hygiene practices, antibiotic consumption patterns, and global population mobility.9 Despite regional variations, the global burden of carbapenem-resistant bacterial infections is significant, with resistance rates reaching approximately 60% in nonfermenting bacteria and generally remaining below 10% in fermenting bacteria isolated from clinical samples. Carbapenemases spanning all Amber classes (A, B, and D) have been detected across nearly all geographical regions.4 Highlighting their widespread dissemination and public health implications, this study aims to characterize the specific carbapenemase genes present in clinical isolates of A. baumannii, P. aeruginosa, and Enterobacterales submitted to the National Reference Laboratory of the National Institute of Health (NRLNIH) in Peru. By identifying the specific genes involved, we seek to contribute with valuable insights into the region's molecular epidemiology of carbapenem-resistant bacteria.

Materials and methods

Ethics considerations

The study was prepared within the framework of the National Surveillance of Antimicrobial Resistance (AMR) Program approved by the National Center for Public Health (FOR-CNSP-158), with samples sent to the INS from the Hospitals nationwide. The data for the study were deidentified and kept confidential following the regulations of the Declaration of Helsinki. Finally, approval from a Research Ethics Committee was not required because the work was performed in accordance with the approved laboratory surveillance protocol.

Study design and bacterial isolates

This observational, retrospective, cross-sectional, and descriptive study analysed secondary data from the registry of the NRLNIH. The study analysed Gram-negative bacterial isolates submitted to the NRLNIH due to suspected portability of a carbapenemase gene, based on phenotypical and clinical characteristics. These isolates were collected as part of the National Surveillance AMR Program, conducted by the NRLNIH during the initial stage of the COVID-19 pandemic, from January 2020 to August 2022. The study focused on isolates of A. baumannii, P. aeruginosa, and Enterobacterales (K. pneumoniae, E. coli, Klebsiella aerogenes, Klebsiella oxytoca, and Enterobacter cloacae complex). Exclusion criteria included contaminated isolates, isolates without growth, those with discordant results compared to the source hospital, isolates without results of any carbapenemase genes, environmental isolates, and duplicate isolates from the same patient within the initial 7-day period.12 The NRLNIH of Peru is responsible for external quality control, for verifying and confirming the results of tests conducted by participating laboratories, to ensure the reliability of their testing processes.

Bacterial identification and detection of resistance genes

Bacterial identification involved culturing on MacConkey selective medium and Trypticase Soy Agar (Becton Dickinson-BD), followed by analysis using MALDI-TOF. Additional confirmation was achieved through biochemical tests, including citrate, TSI, LIA, MIO, and urea (Becton Dickinson).13 Also, the blaOXA-51-like chromosomal gene in A. baumannii was confirmed.13,14

Bacterial DNA extraction was conducted by thermal shock treatment on all isolates. The supernatant was amplified by multiplex PCR using specific primers designed for class A, B, and D carbapenemase genes (Table 1).14,15 The PCR products were visualized on a 1.5% agarose gel using a UV transilluminator and Sybr Green dye (Figure 1). The genes evaluated were selected based on phenotypic results and the resources available in the national laboratory. Positive and negative controls were obtained from the internal strain repository through participation in the Latin American Quality Control Program by the Antimicrobial Service of the INEI-ANLIS, Dr. Carlos Malbran, Argentina.

Table 1.

Primer sequences for carbapenemase gene amplification

Gen Sequence (5′ à 3′) Size(bp) Reference
bla KPC F: AACAAGGAATATCGTTGATG 916 bp 15
R: AGATGATTTTCAGAGCCTTA
bla NDM F: AGCACACTTCCTATCTCGAC 512 bp 15
R: GGCGTAGTGCTCAGTGTC
bla IMP UF1: GGYCTTTWTGTTCATACWTCKTTYGA 404 bp 15
UR1: GGYARCCAAACCACTASGTTATCT
bla VIM F: AGTGGTGAGTATCCGACAG 261 bp 15
R: ATGAAAGTGCGTGGAGAC
bla OXA-48-like F: ATGCGTGTATTAGCCTTATCGG 775 bp 15
R2: TGAGCACTTCTTTTGTGATG
bla OXA-58-like F: AAGTATTGGGGCTTGTGCTG 599 bp 14
R: CCCCTCTGCGCTCTACATAC
bla OXA-23-like F: GATCGGATTGGAGAACCAGA 501 bp 14
R: ATTTCTGACCGCATTTCCAT
bla OXA-51-like F: TAATGCTTTGATCGGCCTTG 353 bp 14
R: TGGATTGCACTTCATCTTGG
bla OXA-24-like F: GGTTAGTTGGCCCCCTTAAA 246 bp 14
R: AGTTGAGCGAAAAGGGGATT
Open in a new tab

OXA-type β-lactamase groups, intrinsic blaOXA-51-like and acquired carbapenem-resistant enzymes blaOXA-48-like, blaOXA-58-like, blaOXA-23-like, blaOXA-24-like.

F, forward primer; R, reverse primer; KPC, Klebsiella pneumoniae carbapenemase; NDM, New Delhi metallo-β-lactamase; IMP, imipenemase metallo-B-lactamase; VIM, verona integron-encoded metallo-β-lactamase.

Figure 1.

Figure 1.

Open in a new tab

Conventional multiplex PCR electrophoresis gel for the detection of carbapenemase genes. M: 100 bp molecular weight marker; lane 1: blaVIM positive control (261 bp); lane 2: blaIMP positive control (404 bp); lane 3: blaNDM positive control (512 bp); lane 4: blaOXA-48-like positive control (775 bp); lane 5: blaKPC positive control (916 bp); lane 6: clinical isolate 01 (blaNDM positive); lane 7: clinical isolate 02 (blaKPC positive); lane 8: clinical isolate 03 (blaIMP positive); lane 9: Escherichia coli ATCC 25922 negative control; lane 10: master mix negative control (System Control). 1.5% agarose gel stained with RedSafe™, run at 100 V for 60 min, and visualized under UV light.

Data analysis

Data were accessed from the NRLNIH computer system using WHONET software and cross-validated against laboratory records for accuracy. Statistical analyses were performed using the R commander interface. The results included the detection of carbapenemase genes and their geographic distribution, categorized by bacterial species or families, as well as the locations of the referring hospitals. Geographic trends and patterns in carbapenemase gene distribution were examined to identify potential hotspots and inform public health strategies.

Results

In the period of the study, 2809 isolates categorized as Gram-negative bacteria were submitted to the NRLNIH. There were 65 isolates excluded due to lack of growth, contamination, or discordant results compared to the source hospital; 04 because they were environmental samples; and 66 duplicate isolates from the same patient. After, 138 isolates corresponding to gram-negative bacteria not included in the study and 487 isolates without at least one carbapenemase gene result (susceptible to carbapenems, lack of resources during the COVID-19 pandemic), were excluded (Figure S1, available as Supplementary data at JAC-AMR Online). A total of 2049 carbapenem-resistant isolates were analysed, with Enterobacterales being the most frequently isolated bacterial group (n = 860). This group included K. pneumoniae (n = 592), E. coli (n = 215), K. aerogenes (n = 29), E. cloacae complex (n = 19), and K. oxytoca (n = 5). A. baumannii (n = 771) and P. aeruginosa (n = 418) isolates were included in the study. Most isolates were collected from hospitals in the region of Lima (n = 1140), with smaller numbers from Madre de Dios (n = 9), Junín (n = 5), and Ucayali (n = 2). These isolates were obtained from 61 hospitals across 18 of the 25 regions of Peru, representing 72% of the country’s regions (Figure 2).

Figure 2.

Figure 2.

Open in a new tab

Geographic distribution of carbapenemase-encoding genes in isolates of Enterobacterales, A. baumannii, and P. aeruginosa.

Over the study period, there was a steady annual increase in the number of isolations. A. baumannii was the predominant pathogen in 2020 (47%) and 2021 (40%), whereas Enterobacterales became the most frequently isolated group in 2022 (42%). Most isolates were obtained from critical care units (52%), with A. baumannii being the most common, followed by general hospital wards (24%), where Enterobacterales were predominant. Lower proportions of isolations were from laboratories and other sources (9%) and outpatient clinics (1%) (Table 2).

Table 2.

Geographical distribution, annual percentage, and localization of hospital-acquired bacteria recovered during the COVID-19 pandemic and included in the study

All Enterobacterales A. baumannii P. aeruginosa
n (%) n (%) n (%) n (%)
2049 (100.0) 860 (42.0) 771 (37.0) 418 (20.4)
Geographical distribution of hospital-acquired bacteria across regions
Lima 1140 (55.6) 556 64.7 364 (47.2) 220 (52.6)
Callao 186 (9.1) 36 (4.2) 123 (16.0) 27 (6.5)
La Libertad 132 (6.4) 17 (2.0) 45 (5.8) 70 (16.7)
Arequipa 97 (4.7) 90 (10.5) 7 (0,9) 0 —
Ayacucho 97 (4.7) 67 (7.8) 6 (0,8) 24 (5.7)
Lambayeque 91 (4.4) 24 (2.8) 53 (6.9) 14 (3.3)
Tacna 65 (3.2) 10 (1.2) 53 (6.9) 2 (0,5)
Apurímac 56 (2.7) 29 (3.4) 12 (1.6) 15 (3.6)
Ica 35 (1.7) 8 (0,9) 22 (2.9) 5 (1.2)
Huánuco 31 (1.5) 6 (0,7) 8 (1.0) 17 (4.1)
Ancash 30 (1.5) 3 (0.3) 15 (2.0) 12 (2.9)
Loreto 29 (1.4) 3 (0.3) 23 (3.0) 3 (0,7)
Cuzco 20 (1.0) 9 (1.0) 7 (0,9) 4 (1.0)
Amazonas 14 (0,7) 0 — 13 (1.7) 1 (0.2)
Moquegua 10 (0,5) 0 — 7 (0,9) 3 (0,7)
Madre de Dios 9 (0.4) 0 — 9 (1.2) 0 —
Junín 5 (0.2) 0 — 4 (0,5) 1 (0.2)
Ucayali 2 (0.1) 2 (0.2) 0 — 0 —
Annual percentage of hospital-acquired bacteria and critical priority strainsa
2020 643 (31.4) 231 (26.8) 360 (46.7) 52 (12.4)
2021 702 (34.2) 270 (31.4) 310 (40.2) 122 (29.2)
2022 704 (34.4) 359 (41.7) 101 (13.1) 244 (58.4)
Localization type or Service of hospital-acquired bacteria and critical priority strains b
ICU 799 (52.4) 260 (41.3) 409 (67,8) 130 (44.4)
HOSP 366 (24.0) 174 (27.7) 93 (15.4) 99 (33.8)
ER 211 (13.8) 137 (21.8) 54 (9.0) 20 (6.8)
OUT 133 (8.7) 51 (8.1) 47 (7.8) 35 (11.9)
OPD 16 (1.1) 7 (1.1) 0 — 9 (3.1)
Open in a new tab

aFor 2022, isolates from January to August were included.

bInformation available for 1525 isolates; ICU, intensive care unit; HOSP, hospitalization; ER, emergency room; OPD, outpatient department; OUT, laboratory, outpatient services, and other sources.

Carbapenemase genes were detected in 84.7% (1735) of isolates, as follows: in 83.5% (718) of Enterobacterales isolates, in 93.4% (720) of A. baumannii isolates, and in 71.1% (297) of P. aeruginosa isolates. Carbapenemase-positive strains were primarily isolated from respiratory secretions (759 positive of 912 respiratory secretion isolates, (83.2%), and A. baumannii accounted for 443/759 (59%); followed by blood 377/409, (92.2%) where Enterobacterales accounted for 198/377(53%); and urine 371/467 (79.4%) where Enterobacterales accounted for 214/371 (58%). Strains isolated from rectal swabs recovered due to hospital AMR surveillance in the context of outbreaks accounted for 36 isolates, and in 32, a carbapenemase gene was detected (Table 3).

Table 3.

Sample classification based on the presence of any carbapenemases in Enterobacterales, A. baumannii, and P. aeruginosa isolates

All isolates categorized by sample type Total Isolatesa Positive Enterobacterales A. baumannii P. aeruginosa
n (%) n (%) n (%) n (%)
Respiratory secretion 912 759 (83.2) 189 (24.9) 443 (58.4) 127 (16.8)
Urine 467 371 (79.4) 214 (57.7) 45 (12.1) 112 (30.2)
Blood 409 377 (92.2) 198 (52.5) 158 (41.9) 21 (5.6)
Another secretion b 171 150 (87.7) 74 (49.3) 45 (30.0) 31 (20.7)
Rectal swab 36 32 (88.9) 31 (96.9) 1 (3.1) 0 —
Sterile fluid c 19 17 (89.5) 7 (41.2) 7 (41.2) 3 (17.6)
Open in a new tab

aInformation available from 2014 isolates.

bAbdominal abscess, abscess, mouth, catheter, central catheter, pharynx, wound, surgical wound, nasopharynx, nose, discharge, unspecified, urethra.

cAbdominal fluid, bile, joint bursa, cerebrospinal fluid, bone, abdominal fluid, cerebrospinal fluid, abdominal fluid, pleural fluid.

The blaKPC gene was detected in Enterobacterales (95/718, 13.23%), predominantly in K. pneumoniae (n = 89), and a smaller number in the E. cloacae complex (n = 6). Among P. aeruginosa isolates, only 4/297 (1.3%) were positive for blaKPC. No A. baumannii isolates were found to be positive for this gene in this study. Within Ambler Class B carbapenemase genes, blaNDM was the most frequently detected, primarily in Enterobacterales (561/718, 78.13%), including 430 K. pneumoniae, 90 E. coli, 28 K. aerogenes, 11 E. cloacae complex, and 2 K. oxytoca. In P. aeruginosa, only 5/297 (1.7%) were positive for blaNDM. blaIMP was predominantly found in P. aeruginosa (188/297, 63.3%), with rare occurrences in Enterobacterales (7/718, 1%), specifically in 5 in K. pneumoniae and 2 in K. oxytoca. blaVIM was primarily detected in P. aeruginosa (44/297, 15%), with no instances in Enterobacterales nor A. baumannii. For Ambler Class D carbapenemase genes, blaOXA-24-like (488/720, 68%) and blaOXA-23-like (211/720, 29%) were the most prevalent in A. baumannii. In Enterobacterales, blaOXA-48-like was found in 43/718 isolates (6%), including 38 E. coli and 5 K. pneumoniae. No blaOXA genes were detected in P. aeruginosa.

Combinations of carbapenemase genes were identified among Enterobacterales. K. pneumoniae exhibited combinations such as blaNDM + blaKPC (7/718, 1%), blaNDM + blaIMP (2/718, 0.3%), and blaNDM + blaVIM (1/718, 0.3%), and E. coli with blaNDM + blaOXA-48-like (1/718, 0.14%) and blaNDM + blaVIM (1/718, 0.14%). In A. baumannii, notable combinations included blaOXA-23-like + blaOXA-24-like (11/720, 2%), blaNDM + blaOXA-24-like (2/720, 0.3%), and blaNDM + blaOXA-58-like (1/720, 0.1%). In P. aeruginosa, a significant proportion of isolates (56/297, 19%) exhibited the combination of blaIMP + blaVIM. The distribution of carbapenemase genes or combinations detected in each bacterial group is shown in Table 4.

Table 4.

Distribution of carbapenemase genes or combinations detected in each bacterial group

Enterobacterales
N = 860		 A. baumannii
N = 771		 P. aeruginosa
N = 418
N (% of isolates with the gene or gene combination)
Any gene 718 (83.5%) 720 (93.4%) 297 (71.1%)
Ambler Classes A
bla KPC 95 (13.2) 0 (0.0) 4 (1.3)
Ambler Classes B
bla IMP 7 (1.0) 0 (0.0) 188 (63.3)
bla NDM 561 (78.1) 7 (1.0) 5 (1.7)
bla VIM 0 (0.0) 0 (0.0) 44 (14.8)
Ambler Classes D
bla OXA-23-like 0 (0.0) 211 (29.3) 0 (0.0)
bla OXA-24-like 0 (0.0) 488 (67.8) 0 (0.0)
bla OXA-48-like 43 (6.0) 0 (0.0) 0 (0.0)
Combination of carbapenemase genes
bla KPC + blaNDM 7 (1.0) 0 (0.0) 0 (0.0)
bla IMP + blaVIM 0 (0.0) 0 (0.0) 56 (18.9)
bla NDM + blaIMP 2 (0.3) 0 (0.0) 0 (0.0)
bla NDM + blaVIM 2 (0.3) 0 (0.0) 0 (0.0)
bla NDM + blaOXA24-like 0 (0.0) 2 (0.3) 0 (0.0)
bla NDM + blaOXA48-like 1 (0.1) 0 (0.0) 0 (0.0)
bla NDM + blaOXA58-like 0 (0.0) 1 (0.1) 0 (0.0)
bla OXA24-like + blaOXA23-like 0 (0.0) 11 (1.5) 0 (0.0)
Open in a new tab

Figure 2 provides a detailed overview of carbapenemase-positive isolates across the regions of Peru, categorized by the type of carbapenemase gene detected. The blaKPC gene was found in 8 out of 25 regions, primarily in Enterobacterales and P. aeruginosa, but not in A. baumannii. The highest concentration of positive isolates was observed in Lima, Arequipa, and Lambayeque. The blaIMP gene was identified in 13 regions, with Lima accounting for the majority of isolates (n = 96), predominantly in P. aeruginosa. Only seven isolates in Enterobacterales were detected, distributed between Lima and Arequipa. blaNDM was identified in 14 regions, in Enterobacterales, A. baumannii and P. aeruginosa isolates, with the majority of positive isolates originating from Lima (n = 447). The presence of blaVIM was confirmed in P. aeruginosa (n = 44) from Lima, Apurimac, and La Libertad (3 out of 25 regions). Oxacillinases were primarily detected in A. baumannii. The blaOXA-23-like gene was detected in isolates from 8 regions, predominantly in Callao and Lima. The blaOXA-24-like gene was detected in 17 regions, with the highest prevalence in Lima. In contrast, Enterobacterales exhibited blaOXA-48-like genes in isolates from 6 regions, with Arequipa and Lima showing the highest numbers of positive isolates.

In this study, eight distinct carbapenemase combinations were identified: four in Enterobacterales circulating in Lima, Arequipa, and Tacna; three combinations in A. baumannii found in Lima, Junín, Lambayeque, and Callao, and one combination in P. aeruginosa circulating across seven regions since 2019. The geographical distribution of bacterial groups according to carbapenemase genes detected is reported in Table S1 (available as Supplementary data).

Discussion

The national antimicrobial resistance (AMR) surveillance program, initiated in 2019, has played a pivotal role in forwarding bacterial strains to the NRLNIH for verification and characterization of carbapenemase genes.16 This effort underscores the critical importance of monitoring AMR in pathogens of public health concern.

A descriptive analysis of the dataset revealed a progressive increase in the number of isolates submitted between January 2020 and August 2022, during the COVID-19 pandemic. This trend reflects the active engagement and firm commitment of healthcare facilities to the AMR surveillance program, despite limited hospital resources and significant shipping challenges between regions and Lima, particularly during the first year of the pandemic. A total of 2049 isolates were analysed, comprising Enterobacterales (n = 860), A. baumannii (n = 771), and P. aeruginosa (n = 418). Among these, 1735 isolates were confirmed to harbour carbapenemase genes, including gene combinations.

The observed expansion in the number and diversity of carbapenemase genes and their combinations coincided with the onset of the COVID-19 pandemic.17–21 This period likely influenced AMR patterns due to increased antibiotic use, changes in infection control practices, and heightened surveillance efforts. In response, the Ministry of Health published the National Technical Standard Document for the Surveillance of Healthcare-Associated Infections (HAIs) during the pandemic.22 Collaborative efforts with the Pan American Health Organization (PAHO) further bolstered surveillance capacity by introducing tools for rapid gene detection. This study highlights the progress achieved in AMR surveillance, the importance of inter-institutional collaboration, and the critical need for continued investment in diagnostic tools and laboratory capacity to combat the growing challenge of AMR effectively.

Most isolates were sourced from the ICU, accounting for 799 (52.4%) cases, with A. baumannii comprising the largest proportion (n = 409). This finding aligns with previous studies that have identified ICU admission as a significant risk factor for infections caused by carbapenem-resistant Enterobacterales and A. baumannii,2,4 particularly during the COVID-19 pandemic. The critical care environment, with frequent use of invasive devices, high antibiotic pressure, and vulnerable patient populations, may contribute to this elevated risk. Among the various sample types, respiratory secretions demonstrated the highest frequency of carbapenemase presence, representing 44.5% of all cases. Within this category, A. baumannii was the predominant pathogen, accounting for 58.4% of isolates. This observation underscores the global burden of lower respiratory tract infections associated with antimicrobial resistance, which remains a major challenge for healthcare systems worldwide.23 The high prevalence of resistant pathogens in respiratory specimens highlights the urgent need for effective infection control measures and targeted therapeutic strategies to manage these infections. It is important to note that only 36 rectal swab samples from hospital AMR surveillance were included, indicating that surveillance is still under development and requires further strengthening, particularly during health emergencies.

The discussion and analysis of carbapenemase gene presence were conducted for each bacterial group, including Enterobacterales, A. baumannii, and P. aeruginosa, as the WHO critically prioritizes them for research into new antibiotics.

In the Enterobacterales group, 718 carbapenemase-positive genes were identified, belonging to 4 types (NDM, KPC, OXA-48-like, and IMP), with the most prevalent being blaNDM (561, 78.1%) in 13 regions of Peru, and blaKPC (95, 13.2%) found in 7 regions. These findings are consistent with previous reports on carbapenemase prevalence in Peru.16 Previous studies in our country have reported blaNDM in E. coli, K. pneumoniae, and E. cloacae complex isolates.16,24,25 In the present study, this gene was detected in all Enterobacterales species considered. It should be noted that our study identified blaKPC only in K. pneumoniae and E. cloacae isolates, although it has been identified previously also in E. coli and K. aerogenes isolates in Peru.24,26 The third most prevalent type of carbapenemase gene among Enterobacterales was blaOXA-48-like (n = 43, 6%), which was found in 6 regions across Peru. This gene was detected more frequently in E. coli isolates and less commonly in K. pneumoniae since 2020 in Lima, as previously reported, but not in K. aerogenes.17,25,27,28 The blaNDM, blaKPC, and blaOXA-48-like genes are the most common carbapenemase genes worldwide in Enterobacterales and have also been documented in Latin America.4,8–11 Furthermore, we identified the presence of blaIMP in K. pneumoniae and K. oxytoca (7, 1%) in only two regions, a gene previously reported in K. pneumoniae isolates in Peru.26 While there are few reports of blaIMP in Enterobacterales in Latin America, it has been documented globally.8,9,29,30

Regarding carbapenemase combinations, we identified blaNDM + blaKPC in K. pneumoniae (n = 7) and blaNDM + blaOXA-48-like in E. coli isolate from 2021. These unusual reports in the country led to an Epidemiological Alert in 2022 and have been reported later in isolates from Lima.17,31 However, blaNDM + blaKPC in K. pneumoniae was detected in an isolate recovered in 2018 in Lima.32 Both combinations have been documented in Latin America and other global regions.9,29,30,33–36 The combination of blaNDM + blaIMP (n = 2), detected in isolates of K. pneumoniae, as well as blaNDM + blaVIM (n = 2), detected in isolates of E. coli and K. pneumoniae, have been documented in Enterobacterales in Latin America and other regions worldwide, but to the best of our knowledge have not been previously reported in Peru.9,33,36,37 These carbapenemase combinations were detected in isolates at the beginning of 2020 (blaNDM + blaVIM) and the others from August 2020 onwards. NDM-coding genes are found in different types of plasmids and transposable elements, which could explain the diversity of isolates, allowing for combinations of this blaNDM gene type with Classes A or D carbapenemase genes.38 In our study, blaNDM has been identified more frequently in the Enterobacterales group and at a lower frequency in A. baumannii and P. aeruginosa. In the last two groups of bacteria, the reported isolates with this gene were scarce before the pandemic but have been increasing.20,38

In A. baumannii, numerous studies have indicated that the most commonly reported gene worldwide is blaOXA-23-like.9,39 However, our research reveals a different trend, with the highest frequency of isolates exhibiting the blaOXA-24-like (n = 488, 67,7%), followed by the blaOXA23-like (n = 211, 29,3%). In Peru, these are the carbapenemase genes most frequently documented in A. baumannii, which have also been described worldwide and in Latin America.8,11,16,24 In addition, we identified 7 (1%) isolates with the blaNDM gene, which has been previously reported in other publications in isolates from Lima and Loreto in Perú, and later during the pandemic.25,40 In our study, the majority of isolates with the blaNDM gene originated in the region of Amazonas.

Notably, we found three types of isolates with combinations of carbapenemase genes in A. baumannii that, to the best of our knowledge, have not been previously reported in our country. These included the blaOXA23-like + blaOXA-24-like genes found in two regions, one isolate with the combination of blaNDM + blaOXA-58-like, reported in Lambayeque, a combination also reported in Iran, and two isolates in Lima and Junín, exhibiting a combination of blaNDM + blaOXA-24-like described in Latin America and worldwide.41–44

In P. aeruginosa, the predominant carbapenemase gene was blaIMP, found in 188 (63%) of the isolates across 12 regions. The second most common gene was the combination blaIMP + blaVIM, observed in 56 (19%) of the isolates from 7 regions, with a higher prevalence in 2 of them. Following this, the blaVIM gene was detected in 44 (15%) isolates across three regions. These findings are consistent with previous reports from Peru, highlighting a significant occurrence of these genes.16,24 While blaIMP and blaVIM genes have been documented globally and in Latin America, their combined detection is less frequent.8,9,11 Initial reports of this combination emerged from various countries, including Costa Rica, the UK, Panamá, Mexico, and recently Morocco.45–48 In Peru, recent findings detected this combination in isolates from 2018, indicating a rising trend in prevalence, consistent with findings from the NRLNIH in 2019.16,21 Additionally, 5 (2%) isolates with blaNDM were identified in P. aeruginosa isolates in Peru, in 4 regions starting from July 2021. Similar patterns have been observed in Latin America, Europe, and Asia, with an increasing prevalence in Brazil following the onset of the COVID-19 pandemic, also reported in Peru.8,11,20,25 Lastly, blaKPC was found in 4 (1%) isolates across two regions, a pattern previously described in Peru in isolates from 2019 and globally.8,9,11,19

The National Surveillance AMR Program showed the emergence of carbapenemase genes not previously described in Peru, identified in Enterobacterales, A. baumannii, and P. aeruginosa. The presence of mobile and transferable genetic elements in Gram-negative bacteria has enabled the combination of multiple β-lactamases within a single bacterium, particularly in those acquired in hospitals and with resistance to carbapenems and third-generation cephalosporins.9 The presence of these combinations of resistance genes in critical priority bacterial strains poses challenges for clinical management, as they complicate treatment protocols.

It was observed that most isolates originated from hospitals in Lima. This can be attributed to several factors: the concentration of high-complexity and high-resolution hospitals in the city; the fact that approximately one-third of the Peruvian population resides in Lima; and, especially in pandemic years, the lower shipping costs within the same region.

However, we found that the more prevalent genes were well distributed in the country. In Enterobacterales, the most prevalent and widely distributed gene was blaNDM (561; 78,1%), detected in isolates from 13 Peruvian regions, mainly from Lima, Callao, and Arequipa. Among A. baumannii isolates, the most prevalent and widely distributed gene was blaOXA.24-like (n = 488; 67,7%), detected in isolates from 17 regions, mainly from Lima, Tacna, and La Libertad. Similarly, in P. aeruginosa isolates, the predominant gene was blaIMP (n = 188; 63%) detected in isolates from Lima, La Libertad, and Huánuco. These regions represent the coast and some highland regions, but no Amazon regions.

The COVID-19 pandemic had an impact in the administrative, human and laboratory material resources available in the NRLNIH, that explain in part lack of carbapenemase gene results in the laboratory registry, however our study, based on national surveillance data, enables us to illustrate the percentages and expansion of new types and combinations of carbapenemase genes, which were previously rare and critically prioritized during the COVID-19 pandemic. Although most isolates originated in Lima, it shows the distribution of carbapenemase genes in 18 AMR monitoring regions, including gene combinations, which underlines the imperative need to reinforce the surveillance of antimicrobial resistance and implement measures to prevent and control its dissemination from the perspective of ‘One Health¨.

Supplementary Material

dlaf203_Supplementary_Data
dlaf203_supplementary_data.zip (175.3KB, zip)

Acknowledgements

We would like to thank the PhD. Roberto Melano for reviewing the manuscript, and to Lab tech Eva Huamaní for her support in labelling strains.

Members of the Working group in the national surveillance of antimicrobial resistance: Hospital de Emergencias Ate Vitarte (T. Dijango, G. Rosas); Hospital de Emergencias Villa El Salvador (H. Chávez, M. Cano); Hospital Central de la Fuerza Aérea del Perú (A. Urbano); Hospital Nacional Arzobispo Loayza (R. Hernández, A. Salazar); Hospital Nacional Cayetano Heredia (K. Amaro, E. Salazar); Hospital de Emergencias J. Casimiro Ulloa (J. Figueroa); Hospital Nacional Edgardo Rebagliati M. (J. Diaz); Hospital II Essalud Emergencias Grau (M. Cruzado); Hospital de Emergencias Pediátricas (F. Príncipe, B. Paredes); Hospital Nacional Guillermo Almenara I. (C. Paúcar, R. Sandoval); Hospital Nacional Hipólito Unanue (M. Chávez, E. Sierra); Hospital José Agurto Tello de Chosica (C. Rojas); Hospital María Auxiliadora (C. Valera, D. Bohorquez); Hospital Militar Luis Arias Schereiber (G. Salvador); Hospital Nacional Dos de Mayo (C. Cucho); Hospital Nacional Docente Madre Niño San Bartolomé (J. Soto); Instituto Nacional de Cs. Neurológicas (R. Pissani, T. Huaytaya); Instituto Nacional Materno Perinatal (G. Sosa); Instituto Nacional de Salud del Niño, Sede Breña (T. Vela, C. Quispe); Hospital Carlos Lanfranco la Hoz (P. Virna, K. Paredes); Hospital Nacional Sergio E. Bernales (A. Olivares); Hospital San Juan de Lurigancho (P. Berrios); Clínica Centenario Peruano Japonesa (E. Tapia); Clínica Delgado—Auna (J. Lagos); Clínicas San Gabriel and San Pablo (A. Castro); Hospital Alberto L. Barton Thompson-Callao (J. Alva, D. Palacin); Hospital II Essalud Lima Norte-Callao ‘Luis Negreiros Vega’ (F. Cárdenas); Hospital Naval (N. Campos); Hospital Nacional Alberto Sabogal Sologuren (J. Torres); Hospital Nacional Daniel A. Carrión (M. Rodríguez, E. Mezarina); Hospital San José (N. Manchaca); Hospital Belén de Trujillo (K. Castillo); Hospital R. Docente -Trujillo (J. Zambrano); Hospital de Alta Complejidad Essalud ¨Virgen de la Puerta¨- La Libertad (L. Tacanga, I. Salinas); Hospital Nacional III Carlos Alberto Seguin Escobedo (A. San Martín, M. Ruíz); Hospital Regional Honorio Delgado E.-Arequipa (M. Jiménez, C. Encinas); Instituto Regional de Enfermedades Neoplásicas-Sur (J. Díaz, A. Rivera); Hospital de Apoyo-Puquio ‘Felipe Huamán P. de Ayala¨(S. Padilla); Hospital II Essalud Huamanga (N. Tica); Hospital Regional de Ayacucho ¨Miguel Angel Mariscal Llerena¨ (M. Gutiérrez); Hospital Regional Lambayeque (A. Yovera, R. Sipión); Hospital Hipólito Unanue de Tacna (M. Ramos, P. Cornejo); Hospital II Essalud Abancay (A. Vargas); Hospital Regional Guillermo Díaz de la Vega-Apurímac (M. Galindo, R. Ramos); Hospital Regional de Ica (C. Araujo); Hospital II Essalud Huánuco (D. Rufo, J. Curo); Hospital Herminio Balizan-Huánuco (G. Shaveta); Hospital III Essalud-Chimbote; Hospital Eleazar Guzmán Barrón (A. Urcia); Hospital ‘Víctor Ramos Guardia”- Huaraz (O. Fernández, H. Contreras); Hospital III Essalud-Iquitos (I. Rivadeneyra, J. Herrera); Hospital R. Loreto ‘Felipe S. Arriola Iglesias¨ (A. Briones); Hospital Regional del Cusco (D. Valdez); Hospital Antonio Lorena- Cusco (J. Pino); Hospital Regional Virgen de Fátima-Amazonas; (E. Gonzales); Hospital Regional de Moquegua (G. Liendo); Hospital Santa Rosa Madre de Dios (D. Cayulla, R. Palacios); Hospital Regional Docente Clínico Quirúrgico Daniel A. Carrión (D. Estrella); Hospital Regional Docente Materno Infantil ¨El Carmen¨ (N. Suarez); Hospital II Pucallpa-Essalud (W. Ortiz).

Contributor Information

Maritza Mayta-Barrios, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Juan Ramírez-Illescas, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Juan Pacori, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Joshi Acosta, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Luis Pampa-Espinoza, Departamento Académico de Medicina Preventiva y Salud Publica, Universidad Nacional Mayor de San Marcos, Calle Germán Amezaga No. 375, Lima, Peru.

Javier Silva-Valencia, Escuela de Posgrado, Universidad San Ignacio de Loyola, Av. La Fontana 550, La Molina, Lima, Peru.

Alicia Núñez-Llanos, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Celinda Bendezú, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Kevin Serrano, Centro Nacional de Salud Pública, Instituto Nacional de Salud, Jirón Cápac Yupanqui 1400–Jesús María, Lima 11, Lima, Peru.

Martín Yagui-Moscoso, Departamento Académico de Medicina Preventiva y Salud Publica, Universidad Nacional Mayor de San Marcos, Calle Germán Amezaga No. 375, Lima, Peru.

Working group in the national surveillance of antimicrobial resistance:

T Dijango, G Rosas, H Chávez, M Cano, A Urbano, R Hernández, A Salazar, K Amaro, E Salazar, J Figueroa, J Diaz, M Cruzado, F Príncipe, B Paredes, C Paúcar, R Sandoval, M Chávez, E Sierra, C Rojas, C Valera, D Bohorquez, G Salvador, C Cucho, J Soto, R Pissani, T Huaytaya, G Sosa, T Vela, C Quispe, P Virna, K Paredes, A Olivares, P Berrios, E Tapia, J Lagos, A Castro, J Alva, D Palacin, F Cárdenas, N Campos, J Torres, M Rodríguez, E Mezarina, N Manchaca, K Castillo, J Zambrano, L Tacanga, I Salinas, A San Martín, M Ruíz, M Jiménez, C Encinas, J Díaz, A Rivera, S Padilla, N Tica, M Gutiérrez, A Yovera, R Sipión, M Ramos, P Cornejo, A Vargas, M Galindo, R Ramos, C Araujo, D Rufo, J Curo, G Shaveta, A Urcia, O Fernández, H Contreras, I Rivadeneyra, J Herrera, A Briones, D Valdez, J Pino, E Gonzales, G Liendo, D Cayulla, R Palacios, D Estrella, N Suarez, and W Ortiz

Funding

This study was performed by the National Reference Laboratory for Nosocomial Infections at the National Institute of Health of Peru, which solely funded this manuscript.

Transparency declarations

None to declare.

Supplementary data

Figure S1 and Table S1 are available as Supplementary data at JAC-AMR Online.

References

  • 1. WHO Executive Board . Global action plan on antimicrobial resistance. 2015. https://iris.who.int/bitstream/handle/10665/193736/9789241509763_eng.pdf?sequence=1
  • 2. WHO . Guidelines for the prevention and control of carbapenem-resistant Enterobacteriaceae, Acinetobacter baumannii and Pseudomonas aeruginosa in health care facilities. 2017. https://iris.who.int/bitstream/handle/10665/259462/9789241550178-eng.pdf?sequence=1
  • 3. WHO . Global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. 2017. https://iris.who.int/bitstream/handle/10665/311820/WHO-EMP-IAU-2017.12-eng.pdf?sequence=1
  • 4. Nordmann  P, Poirel  L. Epidemiology and diagnostics of carbapenem resistance in Gram-negative bacteria. Clin Infect Dis  2019; 69  Suppl 7: S521–8. 10.1093/cid/ciz824 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bush  K, Jacoby  GA. Updated functional classification of β-lactamases. Antimicrob Agents Chemother  2010; 54: 969–76. 10.1128/AAC.01009-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Mathers  AJ, Cox  HL, Kitchel  B  et al.  Molecular dissection of an outbreak of carbapenem-resistant Enterobacteriaceae reveals intergenus KPC carbapenemase transmission through a promiscuous plasmid. mBio  2011; 2: e00204-11. 10.1128/mBio.00204-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Hall  RM. Integrons and gene cassettes: hotspots of diversity in bacterial genomes. Ann N Y Acad Sci  2012; 1267: 71–8. 10.1111/j.1749-6632.2012.06588.x [DOI] [PubMed] [Google Scholar]
  • 8. Hammoudi Halat  D, Ayoub Moubareck  C. The current burden of carbapenemases: review of significant properties and dissemination among Gram-negative bacteria. Antibiotics (Basel)  2020; 9: 186. 10.3390/antibiotics9040186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Bush  K, Bradford  PA. Epidemiology of β-lactamase-producing pathogens. Clin Microbiol Rev  2020; 33: e00047-19. 10.1128/CMR.00047-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Senchyna  F, Gaur  RL, Sandlund  J  et al.  Diversity of resistance mechanisms in carbapenem-resistant Enterobacteriaceae at a health care system in Northern California, from 2013 to 2016. Diagn Microbiol Infect Dis  2019; 93: 250–7. 10.1016/j.diagmicrobio.2018.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. García-Betancur  JC, Appel  TM, Esparza  G  et al.  Update on the epidemiology of carbapenemases in Latin America and the Caribbean. Expert Rev Anti Infect Ther  2021; 19: 197–213. 10.1080/14787210.2020.1813023 [DOI] [PubMed] [Google Scholar]
  • 12. Calvo Montes  J, Canut Blasco  A, Martínez-Martínez  L  et al.  Preparación de informes acumulados de sensibilidad a los antimicrobianos. 51. In: Cercenado Mansilla  E, Cantón Moreno  R (ed.), Procedimientos en Microbiología Clínica: Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica (SEIMC), 2014, 6–9. [Google Scholar]
  • 13. Sacsaquispe  R, Ventura  G. Manual de procedimientos bacteriológicos de Infecciones Intrahospitalarias. Instituto Nacional de Salud, 2001. [Google Scholar]
  • 14. Woodford  N, Ellington  MJ, Coelho  JM  et al.  Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents  2006; 27: 351–3. 10.1016/j.ijantimicag.2006.01.004 [DOI] [PubMed] [Google Scholar]
  • 15. Instituto Nacional de Enfermedades Infecciosas (INEI)—ANLIS “Dr. Carlos G. Malbrán” . CBP- Multiplex. Protocolo de PCR múltiple para la detección de los genes blaKPC, blaOXA-48-like, blaVIM, blaIMP y blaNDM en bacilos gram negativos. 2019. https://antimicrobianos.com.ar/ATB/wp-content/uploads/2021/01/Detecci%C3%B3n-CBP-Multiplex.pdf
  • 16. Mayta-Barrios  MM, Ramirez-Illescas  JJ, Pampa-Espinoza  L  et al.  Molecular characterization of carbapenemases in Perú during 2019. Rev Peru Med Exp Salud Publica  2021; 38: 113–8. 10.17843/rpmesp.2021.381.5882 [DOI] [PubMed] [Google Scholar]
  • 17.Centro Nacional de Epidemiología, Prevención y Control de enfermedades, Ministerio de Salud del Perú. AE-001-2022, Alerta epidemiológica, ¨Riesgo de infecciones asociadas a la atención de la salud causadas por Enterobacterales, Pseudomonas aeruginosa y Acinetobacter spp. coproductoras de carbapenemasas en el Perú. 2022. https://epipublic.dge.gob.pe/uploads/alertas/alertas_20221_07_203548.pdf
  • 18. Pan American Health Organization . Antimicrobial Resistance, Fueled by the COVID-19 Pandemic. Policy Brief November 2021. 2022. https://iris.paho.org/bitstream/handle/10665.2/55864/PAHOCDEAMRCOVID19220006_eng.pdf?sequence=5&isAllowed=y
  • 19. Salvador-Luján  G, Ramírez-Illescas  J, Delgado-Flores  M  et al.  Primer reporte de carbapenemasa tipo KPC en Pseudomonas aeruginosa en un hospital del Perú. Rev Peru Med Exp Salud Publica  2021; 38: 474–5. 10.17843/rpmesp.2021.383.7044 [DOI] [PubMed] [Google Scholar]
  • 20. Perez  LRR, Carniel  E, Narvaez  GA. Emergence of NDM-producing Pseudomonas aeruginosa among hospitalized patients and impact on antimicrobial therapy during the coronavirus disease 2019 (COVID-19) pandemic. Infect Control Hosp Epidemiol  2022; 43: 1279–80. 10.1017/ice.2021.253 [DOI] [PubMed] [Google Scholar]
  • 21. Tickler  IA, Torre  JCG, Alvarado  L  et al.  Mechanisms of carbapenemase-mediated resistance among high-risk Pseudomonas aeruginosa lineages in Peru. J Glob Antimicrob Resist  2022; 31: 135–40. 10.1016/j.jgar.2022.08.018 [DOI] [PubMed] [Google Scholar]
  • 22. Centro Nacional de Epidemiología Prevención y Control de Enfermedades, Ministerio de Salud de Perú . NTS N° 163-MINSA/2020/CDC. Norma técnica de salud para la vigilancia de las infecciones asociadas a la atención de la salud. 2020. https://www.gob.pe/institucion/minsa/normas-legales/864544-523-2020-minsa
  • 23. Antimicrobial Resistance Collaborators . Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet  2022; 399: 629–55. 10.1016/S0140-6736(21)02724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Angles-Yanqui  E, Huaringa-Marcelo  J, Sacsaquispe-Contreras  R  et al.  Panorama de las carbapenemasas en Perú. Rev Panam Salud Publica  2020; 44: e61. 10.26633/RPSP.2020.61 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. García-Cedrón  D, De La Cruz Noriega  M, Cabanillas-Chirinos  L  et al.  Carbapenemase-producing bacteria isolated from ICU patients of a Peruvian government hospital during the COVID-19 pandemic: a descriptive analysis. Medicina (Kaunas)  2023; 59: 1763. 10.3390/medicina59101763 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Sacsaquispe-Contreras  R, Bailón-Calderón  H. Identificación de genes de resistencia a carbapenémicos en enterobacterias de hospitales de Perú, 2013-2017. Rev Peru Med Exp Salud Publica  2018; 35: 259–64. 10.17843/rpmesp.25Y.25v25i.3474 [DOI] [PubMed] [Google Scholar]
  • 27. Cuicapuza  D, Alvarado  L, Tocasca  N  et al.  First report of OXA-181-producing Enterobacterales isolates in Latin America. Microbiol Spectr  2023; 11: e0458422. 10.1128/spectrum.04584-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Morales-Moreno  A, Ballena-López  J, Sandoval-Ahumada  R  et al.  Primeros casos clínicos de infecciones por Klebsiella pneumoniae productora de OXA-48 en Perú. Rev Cuerpo Med HNAAA  2021; 14: 379–82. 10.35434/rcmhnaaa.2021.143.1260 [DOI] [Google Scholar]
  • 29. Estabrook  M, Muyldermans  A, Sahm  D  et al.  Epidemiology of resistance determinants identified in meropenem-nonsusceptible Enterobacterales collected as part of a global surveillance study, 2018 to 2019. Antimicrob Agents Chemother  2023; 67: e0140622. 10.1128/aac.01406-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Kazmierczak  KM, Karlowsky  JA, de Jonge  BLM  et al.  Epidemiology of carbapenem resistance determinants identified in meropenem-nonsusceptible enterobacterales collected as part of a global surveillance program, 2012 to 2017. Antimicrob Agents Chemother  2021; 65: e02000-20. 10.1128/AAC.02000-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Reyes Quevedo  YV, Astocondor  AL, Riveros  MD  et al.  P-1372. Distribution and mechanisms of resistance among carbapenem-resistant Enterobacterales in Peru. Open Forum Infect Dis  2025; 12  Suppl 1: ofae631.1549. 10.1093/ofid/ofae631.1549 [DOI] [Google Scholar]
  • 32. Cuicapuza  D, Loyola  S, Velásquez  J  et al.  Molecular characterization of carbapenemase-producing Enterobacterales in a tertiary hospital in Lima, Peru. Microbiol Spectr  2024; 12: e0250323. 10.1128/spectrum.02503-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Flores  C, Bianco  K, de Filippis  I  et al.  Genetic relatedness of NDM-producing Klebsiella pneumoniae co-occurring VIM, KPC, and OXA-48 enzymes from surveillance cultures from an intensive care unit. Microb Drug Resist  2020; 26: 1219–26. 10.1089/mdr.2019.0483 [DOI] [PubMed] [Google Scholar]
  • 34. Kazmierczak  KM, Rabine  S, Hackel  M  et al.  Multiyear, multinational survey of the incidence and global distribution of metallo-β-lactamase-producing Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrob Agents Chemother  2016; 60: 1067–78. 10.1128/AAC.02379-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Castanheira  M, Deshpande  LM, Mathai  D  et al.  Early dissemination of NDM-1- and OXA-181-producing Enterobacteriaceae in Indian hospitals: report from the SENTRY antimicrobial surveillance program, 2006-2007. Antimicrob Agents Chemother  2011; 55: 1274–8. 10.1128/AAC.01497-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Thomas  GR, Corso  A, Pasterán  F  et al.  Increased detection of carbapenemase-producing enterobacterales bacteria in Latin America and the Caribbean during the COVID-19 pandemic. Emerg Infect Dis  2022; 28: 1–8. 10.3201/eid2811.220415 [DOI] [Google Scholar]
  • 37. Bocanegra-Ibarias  P, Garza-González  E, Morfín-Otero  R  et al.  Molecular and microbiological report of a hospital outbreak of NDM-1-carrying Enterobacteriaceae in Mexico. PLoS One  2017; 12: e0179651. 10.1371/journal.pone.0179651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Ramirez  MS, Bonomo  RA, Tolmasky  ME. Carbapenemases: transforming Acinetobacter baumannii into a yet more dangerous menace. Biomolecules  2020; 10: 720. 10.3390/biom10050720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Rodríguez  CH, Nastro  M, Famiglietti  A. Carbapenemases in Acinetobacter baumannii. Review of their dissemination in Latin America. Rev Argent Microbiol  2018; 50: 327–33. 10.1016/j.ram.2017.10.006 [DOI] [PubMed] [Google Scholar]
  • 40. Rocha  C, Bernal  M, Canal  E  et al.  First report of New Delhi metallo-β-lactamase carbapenemase–producing Acinetobacter baumannii in Perú. Am J Trop Med Hyg  2019; 100: 529–31. 10.4269/ajtmh.18-0802 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Gupta  N, Angadi  K, Jadhav  S. Molecular characterization of carbapenem-resistant Acinetobacter baumannii with special reference to carbapenemases: a systematic review. Infect Drug Resist  2022; 15: 7631–50. 10.2147/IDR.S386641 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Alattraqchi  AG, Mohd Rani  F, A Rahman  NI  et al.  Complete genome sequencing of Acinetobacter baumannii AC1633 and Acinetobacter nosocomialis AC1530 unveils a large multidrug-resistant plasmid encoding the NDM-1 and OXA-58 carbapenemases. mSphere  2021; 6: e01076-20. 10.1128/mSphere.01076-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Lukovic  B, Gajic  I, Dimkic  I  et al.  The first nationwide multicenter study of Acinetobacter baumannii recovered in Serbia: emergence of OXA-72, OXA-23 and NDM-1-producing isolates. Antimicrob Resist Infect Control  2020; 9: 101. 10.1186/s13756-020-00769-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Quiñones Pérez  D, Aung  MS, Carmona Cartaya  Y  et al.  Clonal diversity of Acinetobacter clinical isolates producing NDM-type carbapenemase in Cuba, 2013–19. IJID Reg  2022; 5: 93–6. 10.1016/j.ijregi.2022.08.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Toval  F, Guzmán-Marte  A, Madriz  V  et al.  Predominance of carbapenem-resistant Pseudomonas aeruginosa isolates carrying blaIMP and blaVIM metallo-β-lactamases in a major hospital in Costa Rica. J Med Microbiol  2015; 64: 37–43. 10.1099/jmm.0.081802-0 [DOI] [PubMed] [Google Scholar]
  • 46. Turton  JF, Wright  L, Underwood  A  et al.  High-resolution analysis by whole-genome sequencing of an international lineage (sequence type 111) of Pseudomonas aeruginosa associated with metallo-carbapenemases in the United Kingdom. J Clin Microbiol  2015; 53: 2622–31. 10.1128/JCM.00505-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Deshpande  LM, Vega  S, Tinoco  JC  et al.  Endemicity of Pseudomonas aeruginosa producing IMP-18 and/or VIM-2 MBLs from the high-risk clone ST111 in Central America. JAC Antimicrob Resist  2023; 5: dlad092. 10.1093/jacamr/dlad092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Ihssane  B, Fatima  EO, Aboubakr  K  et al.  First report of Pseudomonas aeruginosa strains co-harboring blaNDM-blaVIM and blaVIM-blaIMP metallo-β-lactamase genes in Morocco. J Glob Antimicrob Resist  2023; 33: 42–3. 10.1016/j.jgar.2023.02.012 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

dlaf203_Supplementary_Data
dlaf203_supplementary_data.zip (175.3KB, zip)

Articles from JAC-Antimicrobial Resistance are provided here courtesy of British Society for Antimicrobial Chemotherapy and Oxford University Press

RESOURCES