Protocol to rapidly verify silent gene reporter in human pluripotent stem cells using CRISPR activation

Summary

Validating human pluripotent stem cell (hPSC) reporters targeting silent genes typically requires inducing gene expression through cell state transitions, which can be time consuming and complex. Here, we present a rapid workflow to verify reporter knockins at unexpressed loci in hPSCs using CRISPR-mediated transcriptional activation (CRISPRa). We detail steps for designing and cloning single-guide RNA (sgRNA), delivery of CRISPRa into reporter cells, and detection of reporter gene. In this protocol, we illustrate this process using KLF17-GFP reporter hPSCs.

For complete details on the use and execution of this protocol, please refer to Wu et al.¹

Graphical abstract

Highlights

• •Steps for design and cloning of guide RNAs targeting promoters of genes of interest
• •Procedures for activating silent reporters in hPSCs using the SAM-TET1 CRISPRa system
• •Guidance for detecting reporter gene expression within 48 h

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Validating human pluripotent stem cell (hPSC) reporters targeting silent genes typically requires inducing gene expression through cell state transitions, which can be time consuming and complex. Here, we present a rapid workflow to verify reporter knockins at unexpressed loci in hPSCs using CRISPR-mediated transcriptional activation (CRISPRa). We detail steps for designing and cloning single-guide RNA (sgRNA), delivery of CRISPRa into reporter cells, and detection of reporter gene. In this protocol, we illustrate this process using KLF17-GFP reporter hPSCs.

Before you begin

CRISPRa system selection

Multiple CRISPRa systems are available for transcriptional activation of target gene. In our original study,¹ we performed a side-by-side comparison of three most potent CRISPRa systems: dCas9-VP64-P64-Rta (VPR),² Synergistic Activation Mediator (SAM)³ and Suntag-P65-HSF1 (SPH).⁴ Among these, we found that the SAM system exhibited superior potency in activating silent genes in hPSCs.

To further enhance activation of silenced genes particularly regulated by promoter methylation, such as KLF17 and INS, we developed a modified SAM-TET1 system.¹ This system combines the SAM complex with the TET1 catalytic domain to promote DNA demethylation at the target site, resulting in more robust activation of methylated genes. For the genes not highly methylated, or bivalent genes that are regulated by both H3K4me3 and H3K27me3, the SAM-TET1 system can achieve similar turn-on efficiency compared to SAM. Thus, the SAM-TET1 system is a reliable tool for verifying silent gene reporter lines in hPSCs, regardless of the underlying chromatin context.

Preparation of plasmids

Timing: 1 week

Note: All plasmids for the SAM and SAM-TET1 systems used in this study have been deposited and are available through Addgene. The original versions of the VPR, SAM, and SPH CRISPRa systems are lentiviral vectors. In the initial test of our study, we delivered these vectors via electroporation into human pluripotent stem cells (hPSCs) to directly compare their activation potency.

Note: We observed robust activation of reporter genes, particularly with the SAM system, using dCas9-VP64 (Addgene #61422) and lentiMPH v2 (Addgene #89308). Similarly, strong activation was achieved with the SAM-TET1 system, using pLV-TET1-dCas9 (Addgene #235599) and pLV-MVPH (Addgene #235600). In all cases, target-specific sgRNAs were cloned into the MS2-sgRNA backbone (Addgene #73797). These plasmids can also be used for lentiviral packaging to enable stable, long-term expression of SAM or SAM-TET1 components, depending on the needs of the user.

Note: Due to the large size of lentiviral constructs, we subsequently cloned all components into non-viral plasmid backbones to reduce overall size and improve nucleofection efficiency. While the relative activation potency among different CRISPRa systems remained consistent, all systems showed improved activation efficiency with the smaller non-viral vectors.

• 1.
  Prepare plasmids for the SAM-TET1 system. Two formats are available:

  • a.
    The three-plasmid format: EF1α-dCas9-VP64 (Addgene #235595), EF1α-MPH (Addgene #235596), and EF1α-TET1-dCas9 (Addgene #235593).
  • b.
    Two-plasmid format: EF1α-TET1-dCas9 (Addgene #235593) and EF1α-MVPH (Addgene #235594).
• 2.Prepare the sgRNA backbone plasmid, LsgRNA-MS2 (Addgene #235597).

Note: Step-by-step instructions for cloning sgRNA plasmids are provided in Step 1, “Design and cloning of sgRNA that guides dCas9-transactivator to the target gene promoter”.

Note: Both the two- and three-plasmid formats for SAM-TET1 yielded comparable activation efficiency, allowing flexibility based on experimental design or delivery preference. In this protocol, we demonstrate how to use both formats to activate the KLF17 gene, as described in the Step 2 “Delivery of CRISPRa into reporter cells by electroporation”.

Preparation of cell line

Timing: 8–10 weeks

Silent gene reporter hPSCs are generated by in-frame knock-in of reporter genes at transcriptionally silent loci in hPSCs through CRISPR/Cas9-mediated homology directed repair (HDR).⁵ A detailed protocol associate with the reporter line generation can be checked in our previous published Star Protocol.⁶ This part involves below steps.

• 3.Construct a donor plasmid harboring the P2A-reporter gene and the drug selectable gene flanked by homology arms spanning the stop codon of the gene of interest (GOI) for homologous recombination (Figure 1).
• 4.Design and construct a sgRNA plasmid targeting the region nearby the stop codon of GOI.
• 5.Co-transfect Cas9/sgRNA plasmid and donor plasmid in hPSCs using electroporation.
• 6.Generate single-cell clones.
• 7.Verify positive clones by PCR and sanger sequencing.

Figure 1.

Construction of silent gene reporter human pluripotent stem cells (hPSCs) via CRISPR/Cas9-mediated homology directed repair

About H1-KLF17-GFP reporter line and general hPSC culture

Timing: 1–2 weeks

To detail the step-by-step workflow, we use a naïve hPSC KLF17-GFP reporter generated in the H1 human ES cell line¹ as an example. KLF17 is a marker of naïve pluripotency, specifically expressed in the naïve state but not in primed hPSCs.^7,8 Using SAM-TET1 CRISPRa, KLF17-GFP expression is activated at the primed hPSC stage, enabling the verification of reporter targeting without the need for naïve induction.

CRITICAL: High-quality hPSC cultures (hESC/hiPSC lines) including the reporter hPSCs after gene editing, should exhibit a normal karyotype and no signs of spontaneous differentiation. All hPSCs must be tested and confirmed to be mycoplasma-free.

• 8.Culture hPSC lines on Matrigel-coated plate with StemFlex medium.

Note: We routinely passage hPSCs at a ratio of 1:6 every 3–4 days using 0.5 mM EDTA.

Alternatives: hPSCs cultured in other hPSC medium, such as mTeSR1 or mTeSR Plus (STEMCELL Technologies) and E8 (Thermo Fisher Scientific) can be also used.

Innovation

Reporter gene knock-ins in hPSCs are typically screened by PCR and Sanger sequencing, but confirming reporter expression remains the gold standard. Validation is straightforward when the target gene is expressed in parental hPSCs, but becomes challenging when the gene is silent. In such cases, verification requires inducing cell state transitions, such as differentiation into specific lineages or transition into non-primed pluripotent states, to activate the target gene. These processes are often complex, expensive, time-consuming, and in many cases inefficient, highlighting the need for a more direct and reliable approach.

Instead of activating silent genes by forcing cell state transitions, our protocol achieves endogenous gene activation through epigenetic modulation using CRISPR-mediated transcriptional activation (CRISPRa). This system employs catalytically inactive Cas9 (dCas9) and guide RNAs to recruit transcriptional activators, enabling robust activation of silent genes directly from their native promoters.

We present a streamlined workflow for verifying reporter knock-ins at silent loci in hPSCs by nucleofecting guide RNAs, activating the target gene, and confirming reporter expression via fluorescence. This approach bypasses cell state transitions, reduces technical barriers, and accelerates validation. By providing a direct and broadly accessible strategy, our method represents a significant advancement for efficient reporter gene verification at silent loci in hPSCs, even for researchers with limited CRISPRa expertise.

Institutional permissions

Use of all hPSC lines hESC in this study was approved by the Tri-institutional (MSKCC, Weill-Cornell, Rockefeller University) Stem Cell Research Oversight (ESCRO) Committee. Since this protocol involves the use of hPSC lines, readers performing this protocol will need to comply with all relevant ethical regulations from the relevant institutions.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Experimental models: Cell lines
H1 hESCs	WiCell	WA01
H1-KLF17-GFP reporter line	The SKI Stem Cell Research Facility	Wu et al.1
Recombinant DNA
LsgRNA-MS2	Addgene	235597
EF1α-dCas9-VP64	Addgene	235595
EF1α-MPH	Addgene	235596
EF1α-TET1-dCas9	Addgene	235593
EF1α-MVPH	Addgene	235594
Chemicals, peptides, and recombinant proteins
Matrigel hESC-qualified matrix	Corning	354277
StemFlex medium	Gibco	A3349401
EDTA	Fisher Scientific	MT-46034CI
Accutase	Innovative Cell Technologies	AT104
DMEM/F12	Fisher Scientific	MT10092CV
Dulbecco’s phosphate-buffered salt solution 1×	Fisher Scientific	MT21031CV
Y-27632 dihydrochloride	Tocris	1254
BsmBI-v2	NEB	R0739L
T4 DNA ligase	NEB	EL0011
T4 polynucleotide kinase	NEB	M0201S
LB agar	Invitrogen	22700025
LB broth	Fisher BioReagents	BP1427-500
Carbenicillin disodium salt	Gibco	10177012
OneTaq 2× master mix with standard buffer	NEB	M0482L
Agarose	Invitrogen	16500500
Critical commercial assays
RNeasy mini kit	QIAGEN	74104
RNeasy micro kit	QIAGEN	74004
RNase-free DNase set	QIAGEN	79254
QIAquick gel extraction kit	QIAGEN	28706
ZymoPURE II plasmid midiprep kit	Zymo Research	D4201
P3 Primary Cell 4D-Nucleofector X Kit S	Lonza	V4XP-3032
SuperScript VILO master mix	Invitrogen	11755050
PowerUp SYBR Green master mix	Applied Biosystems	A25742
Bacterial and virus strains
Mix & Go competent cells - DH5 Alpha	Zymo Research Corporation	NC9911229
Oligonucleotides
Sequencing primer	–	–
hU6 primer: GAGGGCCTATTTCCCATGATT	N/A	N/A
sgRNA oligos	–	–
KLF17-sgRNA1-F: CACCGCCCTCACCATGCCCCAACCA	Wu et al.1	N/A
KLF17-sgRNA1-R: AAACTGGTTGGGGCATGGTGAGGGC	Wu et al.1	N/A
KLF17-sgRNA2-F: CACCGAAGTGGCTGGCTGTCCGTG	Wu et al.1	N/A
KLF17-sgRNA2-R: AAACCACGGACAGCCAGCCACTTC	Wu et al.1	N/A
NT-sgRNA-F: CACCGCTGAAAAAGGAAGGAGTTGA	Wu et al.1	N/A
NT-sgRNA-R: AAACTCAACTCCTTCCTTTTTCAGC	Wu et al.1	N/A
qPCR primers	–	–
GAPDH-F: TGCACCACCAACTGCTTAG	Wu et al.1	N/A
GAPDH-R: GGCATGGACTGTGGTCATGAG	Wu et al.1	N/A
KLF17-F: AACATTGTTGGGCCCGACT	Wu et al.1	N/A
KLF17-R: CGGGCTGCTCTGGTAGAAAT	Wu et al.1	N/A
Other
4D-Nucleofector X unit	Lonza	AAF-1002X
4D-Nucleofector core unit	Lonza	AAF-1002B
Viability cell counter	Nexcelom Bioscience	Cellometer K2
QuantStudio 5	Applied Biosystems	A34322
BD FACSAria III	BD Biosciences	648282
FCS Express software	De Novo Software	version 7.18.0025

Step-by-step method details

Design and cloning of sgRNA that guides dCas9-transactivator to the target gene promoter

Timing: 1 week

This section describes how to design sgRNA for target gene activation using an online web tool, as well as the cloning of sgRNA plasmids.

• 1.
  sgRNA design. Design the guide RNA sequences for the target gene are designed by using CRISPick https://portals.broadinstitute.org/gppx/crispick/public.

  • a.
    To use this web tool, select the reference genome, editing mechanism, and Cas9 enzyme from the available options.
  • b.
    Enter the gene of interest using the accepted formats listed on the website. Top candidates are ranked based on raw ranking, cut position and mutual spacing.
  • c.
    For example, to look for sgRNA candidates for KLF17 gene activation, input following information on the CRISPick website (Figure 2):

    • i.
      Choose Human GRCh38 as a reference genome;
    • ii.
      Choose CRISPRa for the editing mechanism;
    • iii.
      Select SpyoCas9 with “NGG” PAM as Cas9 enzyme;
    • iv.
      Input KLF17 Gene ID: 128209 and submit.

Note: sgRNA candidates are designed from −300 to 0 bases from gene transcription start site (TSS). To verify the sgRNA with sufficient gene activation efficacy, multiple sgRNAs can be picked from the top candidates for cloning. For KLF17 activation, we choose the two sgRNA target sequences.

Figure 2.

Screenshot of sgRNA design using CRISPick

KLF17-sgRNA1: CCCTCACCATGCCCCAACCA;

KLF17-sgRNA 2: GAAGTGGCTGGCTGTCCGTG.

Two non-targeting sgRNAs (NT-sgRNAs), CTGAAAAAGGAAGGAGTTGA and AAGATGAAAGGAAAGGCGTT were tested and used as controls. The first sequence is used as the representative NT-sgRNA in this protocol.

Note: We recommend designing two sgRNAs and testing them individually or in combination. In our experience, combination of the two sgRNA shows slightly enhancing gene activation in some cases, single sgRNA was sufficient for reporter gene verification.

• 2.
  sgRNA cloning.

  • a.
    Order Forward and Reverse sgRNA oligos with overhangs for cloning through BsmbI site.

    • i.
      In the forward oligo, append “CACCG” to the 5′ end of the protospacer sequence.
    • ii.
      To make reverse oligo, create a reverse complement of the protospacer sequence first followed by adding “AAAC” to the 5′ end and a “C” to the 5′ end.
      Forward oligo: 5′ CACCGNNNNNNNNNNNNNNNNNNNN-3’
      Reverse oligo: 3′- CNNNNNNNNNNNNNNNNNNNNCAAA -5'
      Oligos for KLF17-sgRNA1 cloning.
      Forward oligo: 5′-CACCGCCCTCACCATGCCCCAACCA-3'
      Reverse oligo: 3′-CGGGAGTGGTACGGGGTTGGTCAAA-5'
      Oligos for KLF17-sgRNA2 cloning.
      Forward oligo: 5′- CACCGAAGTGGCTGGCTGTCCGTG-3'
      Reverse oligo: 3′- CTTCACCGACCGACAGGCACCAAAA -5'
      Oligos for NT-sgRNA cloning.
      Forward oligo: 5′-CACCGCTGAAAAAGGAAGGAGTTGA-3'
      Reverse oligo: 3′-CGACTTTTTCCTTCCTCAACTCAAA-5'
  • b.
    Oligos annealing and phosphorylation.

    • i.
      Prepare the following reaction in a PCR tube.
    • ii.
      Incubate the reaction tube in a thermocycler at 37°C for 30 min and 95°C for 5 min and then ramp down to 25°C at 5°C/min.

      Forward oligo (100 μM)	1 μL
      Reverse oligo (100 μM)	1 μL
      10× T4 ligation Buffer (NEB)	1 μL
      T4 Polynucleotide Kinase	0.5 μL
      ddH2O	6.5 μL
      Total	10 μL

      Alternatives: The annealing can also be completed by placing the tube in the boiled water for 10 min and let the reaction gradually reach to 20°C–22°C.

      Pause point: The annealed products can be stored at −20°C.

  • c.
    Digest sgRNA backbone plasmid.

    • i.
      Set up following reaction and incubate at 55°C for 1 h.
    • ii.
      Run the digested product on a 1% TAE agarose gel and isolate a fragment with the size of 3307 bp from the gel and purify with the QIAquick Gel Extraction Kit following manufacturer’s instructions.
    • iii.
      Elute DNA in 30 μL ddH2O.

      LsgRNA-MS2 (Addgene #235597)	1 μg
      BsmbI-v2	0.5 μL
      10× NEBuffer 3.1	1 μL
      ddH2O	To 10 μL

      Pause point: Samples can be stored at −20°C or processed immediately in the next step.

  • d.
    Ligate annealed sgRNA oligos and digested backbone plasmid.

    • i.
      Before ligation, dilute annealed sgRNA oligos with 1:250 ratio.
    • ii.
      Set up ligation reaction and incubate at 20°C–25°C for 1 h.

      Digested plasmid	50 ng
      Annealed sgRNA oligos (1:250)	1 μL
      10× T4 ligation Buffer (NEB)	1 μL
      T4 DNA ligase	1 μL
      ddH2O	To 10 μL

  • e.
    Transform with 50 μL Mix & Go Competent Cells - DH5 Alpha with 2 μL ligation product.

    • i.
      Add 500 μL of SOC medium prewarmed to 20°C–25°C and mix gently.
    • ii.
      Spread 100 μL of the mixture onto a pre-warmed Lysogeny Broth (LB) plate with carbenicillin (100 μg/mL) and incubate at 37°C for 14–16 h.
  • f.
    Select 2 colonies from the plate and perform colony PCR to verify positive colonies using hU6 primer and the reverse sgRNA oligo.

    • i.
      Set up PCR reaction as follows and directly inoculate half of the colony into the reaction:

      OneTaq 2× master mix	10 μL
      10 μM hU6 primer	0.5 μL
      10 μM reverse sgRNA oligo	0.5 μL
      ddH2O	9 μL
      Bacteria	–

    • ii.
      Set up thermocycling conditions: 94°C 30 s, (94°C 30 s, 58°C 30 s, 72°C 30 s) 30×, 72°C 5 min and check PCR product on 1% TAE agarose gel. Positive colonies will show a ∼270 bp band.
  • g.
    Inoculate the rest of positive colony in 30 mL LB medium containing 100 μg/mL carbenicillin and shake the cultures in a rotary incubator at 250 rpm at 37 °C for 16∼18 h.
  • h.
    Extract sgRNA plasmid using ZymoPURE II Plasmid Midprep Kit.
  • i.
    Sequence the plasmid DNA using hU6 primer.

Delivery of CRISPRa into reporter cells by electroporation

Timing: 1 day

This section describes how to deliver plasmids into hPSC reporter lines via electroporation for reporter gene activation.

Note: Lentiviral transduction of CRISPRa systems is also effective for activating gene expression in reporter cells. However, for rapid verification of reporter lines, we selected nucleofection due to its faster and more straightforward workflow. Unlike transduction, nucleofection does not require the production and concentration of lentivirus, and robust gene activation can be observed within 48 h. This makes nucleofection a convenient and time-efficient method for reporter line validation.

• 3.
  Prepare reporter hPSCs for electroporation.

  • a.
    When all the plasmids are ready, thaw the reporter hPSCs onto Matrigel and maintain in StemFlex medium.
  • b.
    Passage hPSCs at a ratio of 1:4∼1:6 every 3–4 days using 0.5 mM EDTA.
  • c.
    Prepare hPSCs with 70%∼80% confluency in a 6-well plate with around 3 × 10⁶ cells.

CRITICAL: Check cells daily under phase contract microscope and remove areas of spontaneous differentiation during the culture. It is important to maintain hPSCs with high quality. Differentiated cells will affect efficiency of hPSC electroporation and the outcome of CRISPR activation.

• 4.
  Dissociate hPSCs for electroporation.

  • a.
    Aspirate culture medium, wash the cells once with 1 mL of 1×DPBS and add 1 mL Accutase per well.
  • b.
    Incubate cells at 37°C for 10 min.
  • c.
    Add 2 mL StemFlex and gently pipette up and down.
• 5.
  Count cells for electroporation.

  • a.
    Transfer dissociated cells into a 15 mL conical tube and spin down at a 120 g for 3 min.
  • b.
    Aspirate the supernatant and resuspend the cells with 1 mL fresh StemFlex medium.
  • c.
    Determine the cell number with the Nexcelom Bioscience Cellometer K2.
• 6.
  Prepare 4D-Nucleocuvett^@ Solution for electroporation in the 16-well Nucleocuvett^@ Strip.

  • a.
    For each reaction, prepare solution containing 16.4 μL P3 Primary Cell Nuleofector Solution and 3.6 μL Supplement 1.
  • b.
    Resuspend 5 × 10⁵ cells with 20 μL Solution.

Note: For multiple electroporation reactions, prepare master mix of the solution and scale up the cell number according to the number of reactions.

• 7.
  Prepare plasmids as follows:

  • a.
    Three-plasmids format: 1 μg EF1α-dCas9-VP64, 1 μg EF1α-MPH, 1 μg EF1α-TET1-dCas9 along with 1 μg cloned sgRNA.
  • b.
    Two-plasmids format: 1 μg EF1α-TET1-dCas9, 1 μg EF1α-MVPH along with 1 μg cloned sgRNA.
• 8.Resuspend 5 × 10⁵ cells with the reagent containing plasmids and transfer the cell mixture to the 16-well Nucleocuvett^@ Strip.

Note: Normally, one well of 80% confluent cells in 6-well plate are enough for 8 electroporation reactions.

Note: pmaxGFP Vector provided by the P3 Primary Cell 4D-Nucleofector X Kit can be used as a positive control for the electroporation.

CRITICAL: Volume of plasmids should comprise maximum 10% of total volume. Purified plasmids with high concentration are required for nucleofection. Electroporation with plasmids with lower concentration and larger volume lead to a significant cell death.

• 9.Transfer the cuvette to the 4D-Nucleofector, select “Primary Cell P3”, Pulse Code with CB-150, and press “Start”.

Note:Pulse Code for your hPSC lines can be optimized according to the protocol supplied with the reagents. “CB-150” is the best code for hESCs and hiPSCs in our testing.

Alternatives: If more cell number is required for the experiment, Single Nucleocuvette with 100 μL reaction format is recommended. In the large reaction, we use 2 × 10⁶ cells for each reaction. If electroporation system is not available in your lab, other transient transfection methods can be also tested. For example, Lipofectamine Stem Transfection Reagent is also applicable for hPSC transfection although the transfection efficiency is lower than 4D-nucleofection in our hand.

• 10.Resuspend cells with Stemflex supplemented with 10 μM Y-27632 and reseed into one well of 24-well plate coated with Matrigel.
• 11.Replace the medium with fresh Stemflex 24 h after nucleofection.

Detection of reporter gene

Timing: 1 day

This section describes the detection of reporter gene expression after nucleofection with CRISPRa-related plasmids, using microscope and flow cytometry.

• 12.Check fluorescence gene in the reporter hPSCs under microscope daily after transfection.

Note: The time for the fluorescence gene activation varies. In most cases, fluorescence genes can be observed as early as 24∼48 h posttransfection. In the KLF17-GFP reporter line, GFP was effectively activated by the targeted sgRNA after 48 h electroporation while almost no GFP positive cells were detected by using the non-targeting control (NT-sgRNA) (Figure 3).

• 13.
  Detect fluorescence-activated cells by flow cytometry.

  Note: We still recommend using flow cytometry to detect reporter gene expression in case of low signal of fluorescence since flow cytometry is more sensitive than fluorescence microscope in detecting reporter gene. In addition, it is more accurate to compare the efficiency of the two sgRNA candidates using flow cytometry.

  • a.
    Aspirate culture medium and wash cells with 1 mL of 1×DPBS.
  • b.
    Incubate cells with Accutase at 37°C for 10 min to generate single cell suspension.
  • c.
    Add Stemflex to neutralize Accutase and spin down cells at 120 g for 3 min.
  • d.
    Remove the supernatant and resuspend cells with 500 μL FACS medium (1% BSA in PBS).
  • e.
    Passage cells through the 35 μm cell strainer to remove clumps and debris.
  • f.
    Analyze fluorescence-activated cells by flow cytometry.

    Note: In the case of KLF17-GFP reporter activation, cells, both sgRNA1 and sgRNA2 resulted in over 40% GFP positive cells. However, sgRNA2 induced a higher fluorescence intensity compared to sgRNA1, indicating greater activation potency (Figure 4).

Figure 3.

Fluorescent images showing reporter gene activation in KLF17-GFP reporter cells 48 h after electroporation with three-plasmids format or two-plasmids format SAM-TET1

Bright-field images are shown in lower panel accordingly. Scale bar: 10 μm.

Figure 4.

FACS analysis of fluorescence-positive cell population by SAM-TET1 along with either non-targeting control, sgRNA1 or sgRNA2

(A) FACS gating example for the detection of GFP positive cells. Cells were initially gated on population using FSC-A/SSC-A (scatter gate). Single cells were gated using FSC-W/FSC-H (FSC gate) and SSC-W/SSC-H (SSC gate). The GFP positive cells were determined relative to the negative control.

(B) FACS analysis of the GFP positive cell percentage (left panel) and median fluorescence intensity (MFI, right panel) in KLF17 reporter cells activated by SAM-TET1 along with non-targeting sgRNA (NT-sgRNA), sgRNA1 and sgRNA2 in KLF17 reporter.

Evaluation of sgRNA potency (optional)

Timing: 1 day

This section describes how to evaluate sgRNA potency by measuring the mRNA levels of the target gene.

Note: In our original study, we evaluated seven reporter lines, including TBXT-GFP,⁶ NGN2-GFP,¹ MAP2-GFP,¹ OLIG2-tdTomato,¹ SOX10-GFP,⁹ KLF17-GFP,¹ HOPX-GFP.¹⁰ Based on our experience, designing two sgRNAs per target using CRISPick is sufficient to validate each reporter line. The target genes we tested were efficiently activated by at least one sgRNA, and in most cases, both sgRNAs successfully induced reporter gene expression. If fluorescence cannot be detected by microscope or FACS, the potency of the sgRNA should be evaluated. This step helps determine whether the failure to activate the reporter gene is due to the sgRNA itself or an issue with the reporter line.

• 14.Collect the remaining of cells after FACS analysis for RNA extraction.

Note: At 48 h after nucleofection, there are typically 0.5–1 million cells per well.

Note: To simplify the experiment, the remaining of cells after FACS analysis can be directly used for RNA extraction. Collect cell pellet in the FACS tube by spin down the tubes at 200 g for 5 min.

• 15.
  RNA extraction.

  • a.
    Add 350 μL RLT buffer to the cell pellet and isolate total RNA using RNeasy Mini kit (Qiagen).
  • b.
    Use the RNeasy Micro Kit (Qiagen) when the number of cells is less than 5 × 10⁵, following the manufacturer’s instructions.

CRITICAL: High quality of RNA is required for cDNA synthesis. To eliminate genomic DNA contamination, it is necessary to perform the DNase digestion after initial wash with RW1. The purity of RNA is checked by Nanodrop. A260/A280 ratio should be in the range of 1.9∼2.1.

• 16.Measure the concentration of RNA and use 1 μg for reverse transcription using SuperScript VILO MasterMix. Prepare reaction as follows in PCR tubes.

SuperScript VILO MasterMix	2 μL
RNA	1 μg
Nuclease-free water	Add to 10 μL

• 17.Gently mix by pipetting and incubate reaction at 25°C for 10 min, 42°C for 60 min followed by incubation at 85°C for 5 min.
• 18.Dilute cDNA with 1:50 ratio using Nuclease-free water.
• 19.Set up qPCR reaction as follows:

Diluted cDNA	4 μL
Primers (5 μM)	0.5 μL
PowerUp SYBR Green Master Mix (2×)	Add to 10 μL
Nuclease-free water	0.5 μL

Note: Prepare master mix without cDNA. Aliquot 6 μL into each tube in the 384-well plate and add 4 μL diluted cDNA to each reaction.

• 20.Centrifuge the plate at 1500 g for 2 min and load the plate into the QuantStudio Real-Time PCR instrument.
• 21.Set up PCR program as follows:

Step	Temperature	Duration	Cycles
UDG activation	50°C	2 min	1
Dual-Lock DNA polymerase	95°C	2 min	1
Denature	95°C	15 S	40
Anneal/extend	60°C	1 min
Melt Curve	95°C	15 S	1
	60°C	1 min
	95°C	15 S

• 22.Calculate the expression of the target gene relative to the control group is calculated using $2^{–\Delta \Delta {\mathrm{C}}_t}$.

Note: Consistent with fluorescent signal induced by the two sgRNAs, the KLF17 was activated effectively by both two sgRNAs, while the sgRNA2 performed better (Figure 5). GFP expression was further confirmed to be detectable when KLF17-GFP hPSCs was further reprogrammed into naïve hPSC.¹

Figure 5.

KLF17 gene expression measured by real-time qPCR

Data are represented as mean ± SD from three independent experiments. Statistical analysis was performed using an unpaired two-tailed t test. ∗p<0.05.

Expected outcomes

Using this protocol, we can detect reporter gene expression in silent gene reporter hPSCs without requiring complex cell state transition such as reprogramming or differentiation, by employing a SAM-TET1 CRSIPR-mediated activation system. The fluorescent reporter gene is readily detectable in hPSCs maintained under standard culture conditions shortly after CRISPRa delivery targeting the promoter of the silent gene. Successful activation of the reporter gene indicates that it will serve as a reliable indicator of target gene expression following hPSC transitions.

The protocol can be routinely used to assess the generation of silenced reporter lines. It is applicable to both mixed cell population after electroporation for rapid assessment of knock-in and clonal populations for final validation. We’ve successfully implemented this approach to routinely verify a ranges of reporter lines in our lab.

Limitations

This protocol outlines a streamlined approach for validating silent reporter hPSC lines, eliminating the need for complex cell state transition procedures. This strategy relies on CRISPR-mediated transcriptional activation (CRISPRa), where the efficiency of target gene activation is a key determinant of success. In our experience, most sgRNAs designed using web-based tools are effective. However, in some cases, sgRNAs may exhibit suboptimal performance. There are a few cases where some sgRNAs do not work that efficient. To mitigate the risk of failed gene activation due to ineffective sgRNAs, we recommend designing at least two sgRNAs and testing them individually or in combination.

The efficiency of targeted gene activation can be influenced by multiple factors, including promoter accessibility, epigenetic state, and sgRNA sequence. Establishing a strict threshold for the percentage of activated cells that defines successful editing remains challenging. In knock-in experiments, editing is considered successful if the inserted fragment becomes detectable following CRISPRa. If not detectable, conclusions should be based on both the level of target gene activation and genotyping results.

Troubleshooting

Problem 1

Majority of cells die after electroporation (related to step 11).

Potential solution

• •Ensure that the plasmids used have high concentration and purity.
• •We use Stemflex medium which supports high cell viability. If other media such as mTeSR or E8 are used, supplementing with CloneR or Rock inhibitor after electroporation is strongly advised.

Problem 2

Fluorescence is observed prior to CRISPRa treatment (related to step 3).

Potential solution

The silent gene such as lineage-specific gene should not be expressed in undifferentiated cells. However, spontaneous differentiation during culture can lead to premature activation of lineage markers. It is essential to monitor cultures daily and manually remove differentiated cells to maintain the pluripotent state.

Problem 3

No fluorescence detected after CRISPRa transfection (related to step 12).

Potential solution

• •Target gene activation failure: Measure target gene by qPCR to evaluate the effectiveness of the sgRNA. If no upregulation is detected, design and test additional sgRNAs. Using dual or multiple sgRNAs simultaneously to enhance activation efficiency, as certain combinations can yield stronger gene activation.
• •Reporter gene insertion failure or false-positive clone: Prior to CRISPRa, confirm successful integration of the reporter construct using PCR and sanger sequencing. If target gene expression is upregulated indicated by qPCR, but the reporter gene is not detectable, the tested clone may be a false-positive and should be excluded. We recommend testing 2–5 clones when multiple candidates are available, to ensure reliable validation and selection.
• •Interference from drug-resistance cassette: We strongly recommend removing the drug-resistance cassette flanked by loxP sites after antibiotic selection by introducing a Cre-expressing plasmid. Retention of the selection cassette may interfere with neighboring gene expression, as reported in previous studies.^11,12,13

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Ting Zhou (zhout@mskcc.org).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Youjun Wu (wuy5@mskcc.org).

Materials availability

The plasmids for SAM-TET1 system have been deposited to Addgene. We have listed detailed information in the key resources table.

Data and code availability

This paper did not generate any new datasets or code.

Acknowledgments

This work was supported by NIH/NCI Cancer Center Support Grant P30 CA008748 from Memorial Sloan Kettering. The work was also supported by a core facility grant of The Starr Foundation through the Tri-Institutional Stem Cell Initiative and by the contract C029153 from the New York State’s stem cell funding agency (NYSTEM). This study was supported in part by grants to T.Z. from the NIH (UM1HG012654).

Author contributions

Y.W., A.Z., B.R., S.S.W., and T.Z. performed the experiments and analyzed the data. Y.W. and T.Z. wrote the manuscript.

Declaration of interests

T.Z. is a scientific editor of STAR Protocols.