Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Mar 7;48(5):3446–3457. doi: 10.1007/s10753-025-02276-7

USP5 Deletion Inhibits KD Serum Induced-Human Coronary Artery Endothelial Cell Dysfunction by Regulating the NFATC1/TLR4-Mediated NF-κB Signaling Pathway in Kawasaki Disease

Lidan Yao 1, Yupeng Lai 2, Heng Li 1, Sihan Chen 1, Xianjia Yu 3, Ni Zhou 3, Dandan Lang 3,✉
PMCID: PMC12596296  PMID: 40053057

Abstract

Kawasaki disease (KD) is an acute febrile illness characterized by systemic vasculitis, especially in coronary arteries. Previous studies have indicated that nuclear factor of activated T cells, cytoplasmic 1 (NFATC1, also known as NFAT2) plays a crucial role in the pathogenesis of KD. However, the molecular mechanism of NFATC1 involved in KD is poorly defined. Human coronary artery endothelial cells (HCAECs) were treated with 15% serum from KD patients to mimic the inflammatory injury model in vitro. NFATC1 mRNA level was determined using real-time quantitative polymerase chain reaction (RT-qPCR). NFATC1, Bax, Bcl-2, Ubiquitin-specific peptidase 5 (USP5), Toll-like receptor 4 (TLR4), p-P65, P65, p-IκBα, and IκBα protein levels were determined by Western blot. Cell viability, proliferation, and apoptosis were assessed using the Cell Counting Kit-8 (CCK-8) assay, 5-ethynyl-2’-deoxyuridine (EdU) assay, and flow cytometry. Interleukin-1β (IL-1β) and tumor necrosis factor α (TNF-α) levels were analyzed using ELISA. ROS and SOD levels were detected using special assay kits. After ubibrowser database analysis, the interaction between USP5 and NFATC1 was verified using Co-immunoprecipitation (CoIP) assay. Meanwhile, the possible interaction between NFATC1 and TLR4 was predicted by STRING databases and identified using CoIP assay. NFATC1 expression was increased in KD patients and KD serum-treated HCAECs. KD serum-mediated HCAEC viability and proliferation inhibition, apoptosis, inflammatory response, and oxidative stress promotion. Furthermore, blocking NFATC1 relieved KD serum-evoked HCAEC injury in vitro. Mechanistically, USP5 triggered the deubiquitination of NFATC1 and prevented its degradation. NFATC1 interacted with TLR4 to regulate its expression in HCAECs. Besides, KD serum activated the nuclear factor kappa-B (NF-κB) signaling pathway by regulating the USP5/NFATC1/TLR4 axis in HCAECs. USP5 deficiency mitigated KD serum-induced inflammation and injury in HCAECs through targeting NFATC1 and TLR4-mediated NF-κB signaling, providing a possible therapeutic target for KD treatment.

Graphical Abstract

USP5 stabilizes NFATC1 by its deubiquitinase activity, thus activating TLR4-mediated NF-κB signaling, ultimately promoting KD serum-induced apoptosis, inflammation, and oxidative stress in HCAECs.

graphic file with name 10753_2025_2276_Figa_HTML.jpg

Keywords: USP5, NFATC1, TLR4, HCAECs, Inflammatory Response, Kawasaki Disease

Introduction

As a multisystemic vasculitis syndrome, Kawasaki disease (KD) primarily affects infants and young children and ultimately results in complex coronary artery abnormalities, posing an increasing health and economic burden worldwide [1, 2]. Clinically, it is characterized by a fever lasting 5 days or more, accompanied by bilateral conjunctival injections, oral alteration, cervical lymphadenopathy, and extremity changes [3, 4]. Nearly 20% of untreated children develop coronary artery abnormalities, ectasia, and even thrombosis, which can cause myocardial ischemia or even myocardial infarction [5]. Despite significant advances in standard treatments, such as high-dose intravenous immunoglobulin, anti-inflammatory agents, or oral aspirin, approximately 15% of cases develop resistance to this treatment [6]. Located in the inner surface of the coronary artery, the endothelium is identified as an interface between circulating inflammatory cells and vascular media or adventitia. It is believed as the first target of inflammatory attack in the early stages of KD [7]. At present, some literature has confirmed vascular endothelial cell injury and dysfunction in KD [8, 9]. However, the molecular mechanism of KD-triggered vascular damage is poorly defined and no specific biomarker is available.

Currently, a previous study has stated that the only signaling pathway relevant to KD clinical treatment is the nuclear factor of activated T-cells (NFAT) pathway [10]. NFAT was initially discovered as a member of the inducible nucleoprotein complex, which involved IL-2 in T cells [11]. Widely expressed in mammalian cells, the NFAT family of transcription factors includes five members (NFAT1 ~ 5). Numerous studies have suggested that the NFAT signaling pathway is closely related to angiogenesis and inflammation in endothelial cells [12, 13]. Of note, during the development of KD, NFAT2 (also called NFATC1) and NFAT4 activation could perturb the homeostasis of human coronary artery endothelial cells (HCAECs) [14]. Moreover, recent research presented that overexpressing NFATC1 promotes HCAEC dysfunction and vasculitis inflammatory infiltration in KD progression [15]. Nevertheless, the mechanism of NFATC1 involved in KD progression is far from being addressed.

As a post-translation modification, ubiquitylation can play an important role in eukaryotic cells by rapidly modifying protein substrates to alter the stability, activity, and localization of endogenous proteins [16]. Being a reversible dynamic process, it can be reversed by deubiquitinases (DUBs), which terminate ubiquitination by removing the ubiquitin chain from the substrate, thus maintaining the expression of the substrate proteins [17, 18]. Mounting evidence has suggested that altered DUB activity is implicated in several human diseases [19], containing vascular inflammation [20, 21]. As a vital DUB belonging to the ubiquitin-specific protease (USP) family, USP5 is essential for maintaining homeostasis of the monoubiquitin pool [22]. Previous studies have indicated that USP5 regulates diverse physiological functions by removing ubiquitin chains from target proteins [23]. For example, USP5 interacted with TXNIP and protected TXNIP from ubiquitin–proteasome degradation, thereby facilitating LPS-induced apoptosis and inflammatory response [24]. Beyond that, USP5 could stabilize ROBO4 via deubiquitination to promote inflammation and oxidative stress in diabetic retinopathy [25]. Interestingly, further study suggested that USP5 could induce HCAEC inflammation via sustaining the nuclear factor kappa-B (NF-κB) signaling activation in KD progression [26]. Herein, database analysis showed that USP5 could interact with and stabilize NFATC1 via its deubiquitination activity. Hence, we aimed to preliminarily explore whether USP5 could control KD-induced HCAEC damage by regulating NFATC1.

Materials and Methods

Clinical Samples and Cell Culture

In this study, 33 KD patients and 29 health control subjects (HC group) were enrolled from the Zhuhai People's Hospital (Zhuhai Clinical Medical College of Jinan University). Early morning fasting peripheral venous blood was collected, separated by centrifugation (700 × g, 15 min), and stored at −80˚C until later use. All participants or the participant’s family signed written informed consent in advance. Meanwhile, this research was approved by the Ethics Committee of Zhuhai People's Hospital (Zhuhai Clinical Medical College of Jinan University).

Human coronary artery endothelial cell line (HCAEC, 300-05A, Cell Application, St.Louis, MO, USA) was cultured in MesoEndo cell growth medium (212–500, Cell Application) under a 5% CO2 atmosphere at 37˚C. To construct an in vitro cell model of inflammatory injury, HCAECs at 90% confluence were incubated for 24 h in the medium with 15% KD serum or HC serum. Before cells were incubated, serum was heat-inactivated at 56˚C for 30 min and filtered by filter tip.

RT-qPCR

For mRNA studies, total RNA was extracted from serum samples and cells with Trizol (Invitrogen, Paisley Scotland, UK) on ice. After quantification with NanoDrop 2000 system, cDNA synthesis from 1 μg of total RNA was performed using Maxima H Minus cDNA Synthesis Master Mix kit (Invitrogen). Then, qPCR reaction was implemented using Power SYBR Green Master Mix (Invitrogen). Gene expression was analyzed with 2–ΔΔCt method and GAPDH as an internal reference. Primer sequences are listed in Table 1.

Table 1.

Primer sequences used for PCR

Name Primers for PCR (5’−3’)
NFATC1 Forward TTCGAGTTTAACCAGCGCGA
Reverse GCCCAAGCACGAGGTTATCT
GAPDH Forward GACCACAGTCCATGCCATCAC
Reverse ACGCCTGCTTCACCACCTT
Open in a new tab

Western Blot Assay

In brief, the protein was extracted from serum samples and cells with RIPA lysate buffer (Beyotime, Shanghai, China). After measuring the protein concentrations using BCA protein assay, equal amount of protein (30 μg) was denatured by boiling them in a loading buffer at 100 ˚C for 5 min. After denaturation, the proteins were separated by 10% SDS-PAGE gel, transfer on PVDF membranes, and incubated with primary antibodies: NFATC1 (ab25916, 1:1000, Abcam, Cambridge, MA, USA), USP5 (ab154170, 1:1000, Abcam), TLR4 (ab13556, 1:1000, Abcam), Bcl-2 (ab182858, 1:2000, Abcam), Bax (ab182733, 1:2000, Abcam), p-P65 (SAB4504488, 1:1000, Sigma-Aldrich), P65 (SAB4502609, 1:1000, Sigma-Aldrich), p-IκBα (SAB5701790, 1:1000, Sigma-Aldrich), and IκBα (SAB1305978, 1:1000, Sigma-Aldrich), and GAPDH (ab9485, Abcam, 1:2500) overnight at 4˚C. Subsequently, the membrane was labeled using a secondary antibody at 25 ˚C for 2 h. At last, the protein bands on the membrane were visualized with ECL reagent (Solarbio, Beijing, China).

For protein stability experiment, USP5 or Vector-transfected HCAECs were harvested and exposed to 50 μg/mL Cycloheximide (CHX, Sigma-Andrich) for 0, 5, 10, and 15 h. After extraction, western blot was used for the stability of USP5 protein levels.

Cell Transfection

The siRNAs targeting NFATC1 (si-NFATC1, 5’-GGAAGACACCUATGGAAUU-3’), si-USP5 (5’-GAUAGACAUGAACCAGCGGAU-3’), and their controls (si-NC) were provided by RiboBio (Guangzhou, China). For overexpression plasmid, human NFATC1 cDNA (NM_0172389.3) or human TLR4 cDNA (NM_003266.4) was obtained by RT-PCR amplification and sub-cloned into pcDNA3.1 vector (GenePharma, Shanghai, China). Empty vector pcDNA3.1 acted as a negative control (Vector). For cell transfection, 20 nM of siRNA or 50 ng of vector were transfected into HCAECs using Lipofectamine 3000 (Invitrogen) for 24 h. In other experiments, HCAECs were treated for 24 h with HC serum, KD serum alone, or KD serum with siRNA or/and vector.

Cell Viability

In brief, the viability of HCAECs was analyzed with cell counting kit-8 (CCK-8, Beyotime). After being cultured for 24 h, 10 μL CCK-8 solution was added and incubated for 4 h. Finally, the absorbance from different groups was analyzed with a microplate reader.

5-ethynyl-2’-Deoxyuridine (EdU) Assay

After mixture with 20 μM EdU (RiboBio) for 2 h at 37˚C, HCAECs (5 × 104 cells/well) in 6-well plates were washed with PBS and fixed in 4% formaldehyde for 30 min. After permeabilization with 0.5% Triton-X-100, the cells were reacted with Apollo Dye Solution for 30 min. Then, the nuclei were stained with DAPI for 30 min, and visualized with fluorescence microscope.

Flow Cytometry

After centrifugation, HCAECs from each group were harvested and re-suspended in binding buffer. Subsequently, the cells were stained with 5 µL Annexin V-FITC (KeyGEN Biotech, Nanjing, China) and mixted with 5 µL PI (KeyGEN Biotech) avoiding light. 15 min later, cell apoptosis rate was immediately analyzed using flow cytometer and FlowJo software.

ELISA

After treatments, the culture medium of HCAECs from each group was collected. Subsequently, the gathered supernatant was submitted to the assessment of pro-inflammatory cytokines (IL-1β and TNF-α) levels using ELISA kits (PI301, PT512, Beyotime). At last, the absorbance was analyzed with a microplate reader.

Detection of Reactive Oxygen Species (ROS) and Superoxide Dismutase (SOD)

Briefly, a ROS Fluorometric Assay Kit (Invitrogen) assessed intracellular ROS level. 1 × 105 HCAECs were labeled with 10 µM DCFH-DA probe at 37˚C for 30 min in the dark. After PBS washing, a fluorescence microscope was employed to observe the images from five fields of view, and the fluorescence intensity was analyzed with Image J software.

For SOD levels, the treated HCAECs were harvested and lysed. After that, the assessment of SOD activity in cell extract was performed with SOD Colorimetric Activity Kit (Invitrogen).

CoIP

Interaction between NFATC1 and USP5 or TLR4 was assessed in this experiment. In brief, HCAECs were suspended in IP Lysis buffer (Beyotime) for 15 min at 4˚C. After centrifugation, the supernatants were incubated with anti-NFATC1, anti-USP5, anti-TLR4, and anti-IgG antibody for 16 h, followed by mixing with protein A/G magnetic beads (Millipore, Molsheim, France) at 4˚C. The next day, samples were washed and determined using western blot.

Ubiquitylation Assay

In short, Flag-NFATC1 + si-NC or Flag-NFATC1 + si-USP5-transfected HCAECs cells were washed and lysed for immunoprecipitation assay using anti-Flag. Finally, NFATC1 ubiquitination was analyzed by western blot using anti-Ub.

Statistical Analysis

All statistical analyses were operated using GraphPad Prism7. Data in this research were expressed as mean ± standard deviation (SD), with P < 0.05 suggesting that the differences were statistically significant. The receiver operating characteristic (ROC) curve analysis was conducted to assess the area under the curve (AUC) value for NFATC1 in serum samples. Significant differences were analyzed based on Student’s t-test or one-way ANOVA with Tukey’s tests.

Results

NFATC1 Expression was Increased in KD Patients and KD Serum-Stimulated HCAECs

First of all, to check the role of NFATC1 in KD, its expression patterns were determined in serum samples from healthy control participants (HC, n = 29) and KD patients (n = 33). As shown in Fig. 1A, the significant upregulation of NFATC1 was observed in KD patients. Then, we performed ROC curve analysis to assess the potential of NFATC1 as a diagnostic marker for KD patients. As displayed in Fig. 1B, the ROC curve data showed that the AUC reached 0.8877 in NFATC1. Subsequently, HCAECs, as an in vitro model, were employed to study the function of vascular endothelium. To examine whether KD serum could increase NFATC1, HCAECs were cultured with 15% KD serum or 15% healthy control (HC) serum for 24 h. After that, RT-qPCR or western blot analysis revealed that there was an obvious increase of NFATC1 levels in those cultured with KD serum cells, rather than those in the HC groups (Fig. 1C and D). Overall, these results suggested that NFATC1 might affect the endothelial cells during the pathogenesis of KD.

Fig. 1.

Fig. 1

Open in a new tab

Expression patterns of NFATC1 in KD patients and KD serum-stimulated HCAECs. (A) RT-qPCR assay was applied to measure the expression level of NFATC1 in serum samples from healthy control participants (HC, n = 29) and KD patients (n = 33). (B) The ROC curve analysis of NFATC1 levels for discriminating patients with KD from healthy control. (C and D) HCAECs were exposed to medium with 15% serum from KD patients or HC controls for 24 h. Then, NFATC1 mRNA level and protein level were detected in stimulated HCAECs using RT-qPCR or western blot. *P < 0.05

NFATC1 Inhibition Could Repress KD Serum-Induced HCAEC Injury

Given that NFATC1 expression was enhanced in KD serum-treated HCAECs, loss-of-function studies were performed in HCAECs. As shown in Fig. 2A, NFATC1 protein level was significantly decreased in si-NFATC1-transfected HCAECs in comparison with the si-NC group, suggesting that the knockdown efficiency was successful. Functionally, CCK-8 and EdU assays exhibited that KD serum treatment could strikingly hinder HCAEC viability and proliferation, while these effects were partly abolished after si-NFATC1 transfection (Fig. 2B and C). Furthermore, increased HCAEC apoptosis rate due to KD serum exposure was evidently relieved by NFATC1 downregulation (Fig. 2D). In parallel, KD serum treatment-induced Bax increase (pro-apoptosis factor) and Bcl-2 inhibition (anti-apoptosis factor) were partly overturned through NFATC1 deficiency (Fig. 2E). In terms of the inflammatory response, secretion of pro-inflammatory cytokines IL-1β and TNF-α was highly induced in HCAECs in response to KD serum, while these effects were partially alleviated after si-NFATC1 transfection (Fig. 2F). Meanwhile, KD serum treatment-triggered oxidative stress was also apparently relieved in HCAECs by NFATC1 silencing, as described by increased ROS level (Fig. 2G) and decreased SOD activity (Fig. 2H). Collectively, these results indicated that KD serum-induced HCAEC damage was effectively ameliorated via NFATC1 downregulation.

Fig. 2.

Fig. 2

Open in a new tab

Influences of NFATC1 silencing on KD serum-induced HCAEC injury. (A) NFATC1 protein level was determined in HCAECs transfected with si-NC or si-NFATC1 using western blot. (B-H) HCAECs were treated with HC serum, KD serum, KD serum + si-NC, or KD serum + si-NFATC1. (B) Cell viability was assessed using CCK-8 assay. (C) EdU-positive cells were measured using EdU assay. (D) Cell apoptosis rate was analyzed using flow cytometry. (E) Bax and Bcl-2 protein level were determined using western blot. (F) The secretions of IL-1β and TNF-α were measured using ELISA kits. (G) The content of ROS was analyzed with DCFDA-cell ROS detection kit. (H) SOD levels was detected using a special kit. *P < 0.05

USP5 Could Directly Interact with and Deubiquitination NFATC1

Based on ubibrowser database predication, NFATC1 was found to interact with USP5 (Fig. 3A). Then, the knockdown efficiency of USP5 in HCAECs was detected and presented in Fig. 3B. After that, western blot results further showed that NFATC1 protein level was significantly reduced by USP5 downregulation in HCAECs, which was partially ameliorated after proteasome inhibitor MG132 treatment (Fig. 3C). In addition, western blot analysis verified that the overexpression efficiency of USP5 in HCAECs was available (Fig. 3D). Then, a protein stability assay was used to further check whether USP5 could prevent NFATC1 degradation in HCAECs. According to the data shown in Fig. 3E, after CHX (a chemical that inhibits protein synthesis) treatment, USP5 upregulation prolonged NFATC1 protein half-life in HCAECs, indicating that USP5 overexpression could inhibit the degradation of NFATC1. Beyond that, Co-IP analysis validated that the ubiquitination level of NFATC1 was prominently enhanced after the deficiency of USP5 in HCAECs (Fig. 3F). Furthermore, Co-IP analysis also verified the ability of endogenous USP5 and NFATC1 to bind in HCAECs (Fig. 3G). Overall, these outcomes suggested that USP5 deubiquitinaseactivity is required for enhancing NFATC1 protein stability in HCAECs.

Fig. 3.

Fig. 3

Open in a new tab

USP5 affected NFATC1 expression through deubiquitination. (A) The relationship between USP5 and NFATC1 was analyzed using the ubibrowser database. (B) USP5 protein level was measured in HCAECs transfected with si-NC or si-USP5 using western blot. (C) NFATC1 protein level was examined using western blot in HCAECs transfected with si-NC, si-USP5, or si-USP5 + MG132. (D) USP5 protein level was assessed using western blot in HCAECs transfected with Vector or USP5. (E) Influences of USP5 overexpression on NFATC1 protein stability after CHX treatment was detected in HCAECs using western blot. (F) Analysis of NFATC1 protein and ubiquitination levels by Western blot in HCAECs transfected with Flag-NFATC1 + si-NC or Flag-NFATC1 + si-USP5. (G) The binding association between NFATC1 and USP5 in HCAECs using Co-IP assay. *P < 0.05

USP5 Overexpression Relieved KD Serum-Induced HCAEC Damage by Modulating NFATC1

Considering the modulatory role of USP5 on NFATC1 expression in HCAECs, we further assessed whether the influences of USP5 in KD serum-induced cell damage were related to NFATC1. Firstly, the overexpression efficiency of NFATC1 in HCAECs was measured and displayed in Fig. 4A. Subsequently, functional analysis exhibited that USP5 silencing could remarkably improve cell viability and proliferation in KD serum-treated HCAECs, whereas these effects were partially abolished after co-transfection NFATC1 (Fig. 4B and C). Beyond that, USP5 deficiency-mediated cell apoptosis rate inhibition in KD serum-exposed HCAECs was partly overturned by NFATC1 upregulation (Fig. 4D). Consistently, USP5 knockdown elicited an obvious reduction in Bax protein level and a substantial enhancement in Bcl-2 protein level in KD serum-treated HCAECs, while these effects were partly overturned through NFATC1 overexpression (Fig. 4E). Apart from that, KD serum-evoked inflammatory response in HCAECs was significantly alleviated by USP5 downregulation, and this impact was partially reversed after NFATC1 addition, as described by higher IL-1β and TNF-α secretions (Fig. 4F). Meanwhile, elevated NFATC1 also markedly abrogated the repression impacts of USP5 silencing on oxidative stress in HCAECs, as evidenced by increased ROS level (Fig. 4G) and reduced SOD activity (Fig. 4H). All these results demonstrated that USP5 knockdown could play a protective role in KD serum-induced HCAEC injury by targeting NFATC1.

Fig. 4.

Fig. 4

Open in a new tab

USP5/NFATC1 regulated KD serum-induced HCAEC injury. (A) NFATC1 protein level was detected in HCAECs transfected with Vector or NFATC1 using western blot. (B-H) HCAECs were treated with HC serum, KD serum, KD serum + si-NC, KD serum + si-USP5, KD serum + si-USP5 + Vector, or KD serum + si-USP5 + NFATC1. (B and C) Cell viability and EdU-positive cells were assessed using CCK-8 assay and EdU assay. (D) Flow cytometry analysis of cell apoptosis. (E) Western blot analysis of Bax and Bcl-2 protein level. (F) IL-1β and TNF-α secretions were assessed using ELISA kits. (G and H) Special assay kits identified of ROS and SOD products. *P < 0.05

NFATC1 Interacted with TLR4 to Affect its Expression

Furthermore, an NFATC1 interacting protein network was generated using the STRING database, a protein function prediction tool. The results revealed that there is an interaction between NFATC1 and TLR4 (Fig. 5A). Interestingly, western blot analysis found that TLR4 protein level was distinctly enhanced in KD serum-treated HCAECs, which were partially mitigated by NFATC1 downregulation (Fig. 5B). Considering the above results, we further explored whether USP5 could regulate TLR4 expression by interacting with NFATC1. As shown in Fig. 5C, NFATC1 upregulation could effectively abolish the inhibitory role of USP5 deficiency on TLR4 protein level in KD serum-treated HCAECs. Besides, CoIP assay validated that NFATC1and TLR4 could interact with each other using endogenous proteins (Fig. 5D). Collectively, these findings validated the USP5/NFATC1/TLR4 regulatory axis in HCAECs.

Fig. 5.

Fig. 5

Open in a new tab

NFATC1 interacted with TLR4 to affect its expression. (A) The interaction between NFATC1 and TLR4 was analyzed by STRING database (a useful tool for studying protein–protein). (B) TLR4 protein level was determined using western blot assay in HCAECs treated with HC serum, KD serum, KD serum + si-NC, KD serum + si-NFATC1. (C) Western blot analysis of TLR4 protein level in HCAECs treated with HC serum, KD serum, KD serum + si-NC, KD serum + si-USP5, KD serum + si-USP5 + Vector, or KD serum + si-USP5 + NFATC1. (D) The targeted binding of NFATC1 to TLR4 was verified using Co-IP assay. *P < 0.05

USP5 Absence Could Block KD Serum-Induced NF-κB Signaling by Regulating NFATC1/TLR4

It has been reported that TLR4 signaling classically induces NF-κB activation and further leads to the expression of several pro-inflammatory genes. Therefore, we speculated that USP5 could affect NF-κB signaling by targeting NFATC1/TLR4 axis. To verify the hypothesis, the targets of the NF-κB pathway, like the phosphorylation of P65 and IκBα, were detected. As presented in Fig. 6A and B, KD serum-induced p-P65/P65 and p-IκBα/IκBα expression in HCAECs were strikingly alleviated by USP5 silencing, and these effects were partially overturned by NFATC1 co-transfection, implying that USP5 downregulation could relieve KD serum-triggered NF-κB signaling activation by regulating NFATC1. In addition, the overexpression efficiency of TLR4 was examined and exhibited in Fig. 6C. After that, western blot results presented that NFATC1 deficiency could hinder the expression of p-P65/P65 and p-IκBα/IκBα in KD serum-exposed HCAECs, which were partially abolished through TLR4 overexpression (Fig. 6D and E). In total, these results indicated that USP5 silencing could repress the KD serum-mediated NF-κB signaling pathway via NFATC1/TLR4 axis in HCAECs.

Fig. 6.

Fig. 6

Open in a new tab

USP5 deubiquitination stabilizes NFATC1 to regulate TLR4/NF-κB signaling pathway. (A and B) p-P65, P65, p-IκBα, and IκBα protein levels were measured using western blot assay in HCAECs treated with HC serum, KD serum, KD serum + si-NC, KD serum + si-USP5, KD serum + si-USP5 + Vector, or KD serum + si-USP5 + NFATC1. (C) Western blot analysis of TLR4 protein level in HCAECs transfected with Vector or TLR4. (D and E) Western blot analysis of p-P65, P65, p-IκBα, and IκBα protein levels in HCAECs treated with HC serum, KD serum, KD serum + si-NC, KD serum + si-NFATC1, KD serum + si-NFATC1 + Vector, or KD serum + si-NFATC1 + TLR4. *P < 0.05

Discussion

Nowadays, research hotspots on the pathogenesis of KD are HCAEC dysfunction and inflammatory immune mechanisms, which are also thought to contribute to the development of coronary artery abnormalities [5, 27]. Convincing evidence has indicated the essential roles of the NFAT signaling pathway in the clinical treatment of KD [28]. NFATC1 in immune cells and stromal cells has been reported to increase through the NFAT signaling pathway in KD [15, 29]. In addition, HCAECs have been verified to be activated by KD serum and produce a range of inflammatory mediators, leading to inflammatory cascade reactions [30–32]. Meanwhile, dysregulated endothelial cell homeostasis has the potential to influence aneurysm formation and vessel wall damage in acute KD [14]. Furthermore, NFATC1 expression was upregulated in HCAECs induced by sera from KD patients [14]. Consistent with these reports, we found that NFATC1 content was elevated in KD suffers and KD serum-treated HCAECs. Functional analysis verified that the artificial downregulation of NFATC1 partially relieved KD serum-evoked HCAEC apoptosis, inflammation, and oxidative stress in vitro. These observations demonstrated that NFATC1 might drive the pathological process of KD by exacerbating dysfunction and inflammation in KD serum-treated HCAECs.

Increasing evidence has focused on the vital role of ubiquitination and deubiquitylation processes in maintaining protein homeostasis via altering modified protein degradation [33, 34]. Deubiquitination is determined by a variety of DUBs, which could counteract ubiquitin ligases by cleaving ubiquitin from their protein substrates and partake in cell oxidative stress and inflammation [18, 35]. As a key member of the DUBs, USP5 has been validated to regulate various inflammatory-related human diseases by targeting different substrates [23]. For instance, USP5 could interact with TRAF6 to stabilize its expression in rheumatoid arthritis and aggravate the activation of NF-κB signaling, ultimately promoting inflammation [36]. Furthermore, USP5 could facilitate LPS-triggered apoptosis and inflammatory response by stabilizing TXNIP protein levels [24]. Herein, our data verified that USP5 is a specific NFATC1 deubiquitinase in HCAECs. USP5 could directly interact with NFATC1 and deubiquitinated NFATC1, thus increasing its protein stability. Rescue assays showed that NFATC1 upregulation overturned the protective effect of USP5 lacking on KD serum-triggered HCAEC damage, supporting the USP5/NFATC1 modulatory mechanism. Interestingly, USP5 could enhance pro-inflammatory cytokine expression by activating NF-κB signaling in endothelial inflammation of KD [26]. Therefore, we reasonably proposed that NFATC1 might be involved in the regulation of NF-κB signaling in HCAECs. In this work, the STRING website found that NFATC1 interacted with TLR4. It has been reported that TLR4, a transmembrane receptor, could promote the upregulation of pro-inflammatory cytokines by directly activating downstream signaling NF-κB [37]. Furthermore, some studies have indicated that TLR4-NF-κB signaling could affect the expression of inflammatory factors in HCAECs of KD [38, 39]. Herein, our data also validated that overexpressing NFATC1 in KD serum-treated HCAECs could abolish USP5 deficiency-mediated reductions in TLR4 protein levels, P65, and IκBα phosphorylation levels. Meanwhile, TLR4 upregulation could attenuate the repression of NFATC1 knockdown on the P65 and IκBα phosphorylation levels in KD serum-treated HCAECs. These results further demonstrated that the USP5/NFATC1/TLR4 axis jointly regulates the activation of NF-κB signaling pathway and KD development. Previous studies have indicated that USP5 inhibitor, vialinin A, could prevent inflammation by preventing the NF-ƙB-mediated expression of various inflammatory cytokines in HCAECs [26]. Therefore, USP5 inhibitor might act as a candidate intervention drug for KD therapy to prevent the excessive production of pro-inflammatory cytokines.

Conclusion

In summary, our findings discovered that USP5 knockdown might relieve KD serum-induced HCAEC inflammation and injuries by regulating NFATC1/TLR4-mediated NF-κB signaling. In other words, blocking the USP5/NFATC1/TLR4-mediated NF-κB signaling may be a new target for the management of inflammation injury in KD.

Authors’ Contribution

Conceptualization and Methodology: Yupeng Lai and Heng Li; Formal analysis and Data curation: Sihan Chen and Xianjia Yu; Validation and Investigation: Ni Zhou and Dandan Lang; Writing - original draft preparation and Writing - review and editing: Lidan Yao, Yupeng Lai and Heng Li; Approval of final manuscript: all authors

Funding

The Clinical Research Promotion Project of Zhuhai People's Hospital 2023LCTS-19

Social Development Technology Plan Project of Zhuhai City in 2024 No. 2420004000130

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval

The present study was approved by the ethical review committee of the Zhuhai People's Hospital (Zhuhai Clinical Medical College of Jinan University). Written informed consent was obtained from all enrolled patients.

Animal Studies

Animal studies were performed in compliance with the ARRIVE guidelines and the Basel Declaration. All animals received humane care according to the National Institutes of Health (USA) guidelines.

Human Rights Statements and Informed Consent

The research has been carried out in accordance with the World Medical Association Declaration of Helsinki, and that all subjects provided written informed consent.

Consent to Participate

Not available.

Consent to Publish

All of us authors agree to publish this article in this journal.

Competing Interests

The authors declare no competing interests.

Clinical Trial Number

Not applicable.’

Footnotes

Highlights

1. NFATC1 knockdown suppressed KD serum-induced HCAEC damage.

2. USP5 triggered the deubiquitination of NFATC1 and prevented its degradation.

3. NFATC1 could regulate TLR4 expression.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Rife, E., and A. Gedalia. 2020. Kawasaki disease: An update. Current Rheumatology Reports 22 (10): 75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Banday, A.Z., S. Mondal, P. Barman, A. Sil, R. Kumrah, P. Vignesh, and S. Singh. 2021. What lies ahead for young hearts in the 21(st) century - is it double trouble of acute rheumatic fever and Kawasaki disease in developing countries? Frontiers in Cardiovascular Medicine 8:694393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Jindal, A.K., R.K. Pilania, A. Prithvi, S. Guleria, and S. Singh. 2019. Kawasaki disease: Characteristics, diagnosis, and unusual presentations. Expert Review of Clinical Immunology 15 (10): 1089–1104. [DOI] [PubMed] [Google Scholar]
  • 4.Saguil, A., M. Fargo, and S. Grogan. 2015. Diagnosis and management of Kawasaki disease. American Family Physician 91 (6): 365–371. [PubMed] [Google Scholar]
  • 5.Noval Rivas, M., and M. Arditi. 2020. Kawasaki disease: Pathophysiology and insights from mouse models. Nature Reviews Rheumatology 16 (7): 391–405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Agarwal, S., and D.K. Agrawal. 2016. Kawasaki disease: Etiopathogenesis and novel treatment strategies. Expert Review of Clinical Immunology 13 (3): 247–258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Qiu, Y., Y. Zhang, Y. Li, Y. Hua, and Y. Zhang. 2022. Molecular mechanisms of endothelial dysfunction in Kawasaki-disease-associated vasculitis. Frontiers in Cardiovascular Medicine 9:981010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu, X., T. Luo, Z. Fan, J. Li, Y. Zhang, G. Lu, M. Lv, S. Lin, Z. Cai, J. Zhang, K. Zhou, J. Guo, Y. Hua, Y. Zhang, and Y. Li. 2023. Single cell RNA-seq resolution revealed CCR1(+)/SELL(+)/XAF(+) CD14 monocytes mediated vascular endothelial cell injuries in Kawasaki disease and COVID-19. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 1869 (5): 166707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yu, L., Y. Li, Y. Zhang, L. Weng, D. Shuai, J. Zhu, C. Niu, M. Chu, and C. Jia. 2024. Human cytomegalovirus pUL135 protein affects endothelial cell function via CD2AP in Kawasaki disease. International Journal of Cardiology 413:132364. [DOI] [PubMed] [Google Scholar]
  • 10.McCrindle, B.W., A.H. Rowley, J.W. Newburger, J.C. Burns, A.F. Bolger, M. Gewitz, A.L. Baker, M.A. Jackson, M. Takahashi, P.B. Shah, T. Kobayashi, M.H. Wu, T.T. Saji, and E. Pahl. 2017. Diagnosis, treatment, and long-term management of Kawasaki disease: A scientific statement for health professionals from the American Heart Association. Circulation 135 (17): e927–e999. [DOI] [PubMed] [Google Scholar]
  • 11.Macian, F. 2005. NFAT proteins: key regulators of T-cell development and function. Nature Reviews Immunology 5 (6): 472–484. [DOI] [PubMed] [Google Scholar]
  • 12.El Chami, H., and P.M. Hassoun. 2012. Immune and inflammatory mechanisms in pulmonary arterial hypertension. Progress in Cardiovascular Diseases 55 (2): 218–228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Minami, T. 2014. Calcineurin-NFAT activation and DSCR-1 auto-inhibitory loop: how is homoeostasis regulated? Journal of Biochemistry 155 (4): 217–226. [DOI] [PubMed] [Google Scholar]
  • 14.Wang, Y., J. Hu, J. Liu, Z. Geng, Y. Tao, F. Zheng, Y. Wang, S. Fu, W. Wang, C. Xie, Y. Zhang, and F. Gong. 2020. The role of Ca(2+)/NFAT in dysfunction and inflammation of human coronary endothelial cells induced by Sera from patients with Kawasaki disease. Scientific Reports 10 (1): 4706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Huang, H., J. Dong, J. Jiang, F. Yang, Y. Zheng, S. Wang, N. Wang, J. Ma, M. Hou, Y. Ding, L. Meng, W. Zhuo, D. Yang, W. Qian, Q. Chen, G. You, G. Qian, L. Gu, and H. Lv. 2023. The role of FOXO4/NFAT2 signaling pathway in dysfunction of human coronary endothelial cells and inflammatory infiltration of vasculitis in Kawasaki disease. Frontiers in Immunology 13:1090056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sun, M., and X. Zhang. 2022. Current methodologies in protein ubiquitination characterization: from ubiquitinated protein to ubiquitin chain architecture. Cell & Bioscience 12 (1): 126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fujita, Y., R. Tinoco, Y. Li, D. Senft, and Z.A. Ronai. 2019. Ubiquitin ligases in cancer immunotherapy - balancing antitumor and autoimmunity. Trends in Molecular Medicine 25 (5): 428–443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Snyder, N.A., and G.M. Silva. 2021. Deubiquitinating enzymes (DUBs): Regulation, homeostasis, and oxidative stress response. Journal of Biological Chemistry 297 (3): 101077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhan, X., Y. Yang, Q. Li, and F. He. 2024. The role of deubiquitinases in cardiac disease. Expert Reviews in Molecular Medicine 26:e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang, W., J. Zhao, L. Deng, N. Ishimwe, J. Pauli, W. Wu, S. Shan, W. Kempf, M.D. Ballantyne, D. Kim, Q. Lyu, M. Bennett, J. Rodor, A.W. Turner, Y.W. Lu, P. Gao, M. Choi, G. Warthi, H.W. Kim, M.M. Barroso, W.B. Bryant, C.L. Miller, N.L. Weintraub, L. Maegdefessel, J.M. Miano, A.H. Baker, and X. Long. 2023. INKILN is a novel long noncoding RNA promoting vascular smooth muscle inflammation via scaffolding MKL1 and USP10. Circulation 148 (1): 47–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cheng, N., and J. Trejo. 2023. An siRNA library screen identifies CYLD and USP34 as deubiquitinases that regulate GPCR-p38 MAPK signaling and distinct inflammatory responses. Journal of Biological Chemistry 299 (12): 105370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ning, F., H. Xin, J. Liu, C. Lv, X. Xu, M. Wang, Y. Wang, W. Zhang, and X. Zhang. 2020. Structure and function of USP5: Insight into physiological and pathophysiological roles. Pharmacological Research 157:104557. [DOI] [PubMed] [Google Scholar]
  • 23.Gao, S.T., X. Xin, Z.Y. Wang, Y.Y. Hu, and Q. Feng. 2024. USP5: Comprehensive insights into structure, function, biological and disease-related implications, and emerging therapeutic opportunities. Molecular and Cellular Probes 73:101944. [DOI] [PubMed] [Google Scholar]
  • 24.Shi, S., X. Pan, M. Chen, L. Zhang, S. Zhang, X. Wang, S. Shi, Z. Chen, W. Lin, and Y. Jiang. 2023. USP5 promotes lipopolysaccharide-induced apoptosis and inflammatory response by stabilizing the TXNIP protein. Hepatology Communications 7 (8): e0193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Guo, H., R. Liu, H. Lv, Q. Huo, Y. Yao, and X. Lu. 2024. USP5 facilitates diabetic retinopathy development by stabilizing ROBO4 via deubiquitination. Cellular Signalling 120:111225. [DOI] [PubMed] [Google Scholar]
  • 26.Huang, C., W. Wang, H. Huang, J. Jiang, Y. Ding, X. Li, J. Ma, M. Hou, X. Pu, G. Qian, and H. Lv. 2022. Kawasaki disease: ubiquitin-specific protease 5 promotes endothelial inflammation via TNFα-mediated signaling. Pediatric Research 93 (7): 1883–1890. [DOI] [PubMed] [Google Scholar]
  • 27.Kumrah, R., T. Goyal, A. Rawat, and S. Singh. 2024. Markers of endothelial dysfunction in Kawasaki disease: An update. Clinical Reviews in Allergy & Immunology 66 (1): 99–111. [DOI] [PubMed] [Google Scholar]
  • 28.Aoyagi, R., H. Hamada, Y. Sato, H. Suzuki, Y. Onouchi, R. Ebata, K. Nagashima, M. Terauchi, M. Terai, H. Hanaoka, and A. Hata. 2015. Study protocol for a phase III multicentre, randomised, open-label, blinded-end point trial to evaluate the efficacy and safety of immunoglobulin plus cyclosporin A in patients with severe Kawasaki disease (KAICA Trial). BMJ Open 5 (12): e009562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sun, Y., Y. Tao, Z. Geng, F. Zheng, Y. Wang, Y. Wang, S. Fu, W. Wang, C. Xie, Y. Zhang, and F. Gong. 2023. The activation of CaN/NFAT signaling pathway in macrophages aggravated Lactobacillus casei cell wall extract-induced Kawasaki disease vasculitis. Cytokine 169:156304. [DOI] [PubMed] [Google Scholar]
  • 30.Inoue, Y., H. Kimura, M. Kato, Y. Okada, and A. Morikawa. 2001. Sera from patients with Kawasaki disease induce intercellular adhesion molecule-1 but not Fas in human endothelial cells. International Archives of Allergy and Immunology 125 (3): 250–255. [DOI] [PubMed] [Google Scholar]
  • 31.Huang, X.B., S. Zhao, Z.Y. Liu, Y.Y. Xu, and F. Deng. 2023. Serum amyloid A as a biomarker for immunoglobulin resistance in Kawasaki disease. Annals of Medicine 55 (2): 2264315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kaneko, S., M. Shimizu, A. Shimbo, H. Irabu, K. Yokoyama, K. Furuno, T. Tanaka, K. Ueno, S. Fujita, N. Iwata, J. Fujimura, K. Akamine, M. Mizuta, Y. Nakagishi, T. Minato, K. Watanabe, A. Kobayashi, T. Endo, K. Tabata, M. Mori, and T. Morio. 2023. Clinical significance of serum cytokine profiles for differentiating between Kawasaki disease and its mimickers. Cytokine 169:156280. [DOI] [PubMed] [Google Scholar]
  • 33.Liu, J., Y. Cheng, M. Zheng, B. Yuan, Z. Wang, X. Li, J. Yin, M. Ye, and Y. Song. 2021. Targeting the ubiquitination/deubiquitination process to regulate immune checkpoint pathways. Signal Transduction and Targeted Therapy 6 (1): 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Liu, F., J. Chen, K. Li, H. Li, Y. Zhu, Y. Zhai, B. Lu, Y. Fan, Z. Liu, X. Chen, X. Jia, Z. Dong, and K. Liu. 2024. Ubiquitination and deubiquitination in cancer: From mechanisms to novel therapeutic approaches. Molecular Cancer 23 (1): 148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Newton, K., and A.D. Gitlin. 2022. Deubiquitinases in cell death and inflammation. Biochemical Journal 479 (10): 1103–1119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Luo, X.B., J.C. Xi, Z. Liu, Y. Long, L.T. Li, Z.P. Luo, and D.H. Liu. 2020. Proinflammatory effects of ubiquitin-specific protease 5 (USP5) in rheumatoid arthritis fibroblast-like synoviocytes. Mediators of Inflammation 2020:8295149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kim, H.J., H. Kim, J.H. Lee, and C. Hwangbo. 2023. Toll-like receptor 4 (TLR4): New insight immune and aging. Immunity & Ageing 20 (1): 67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Si, F., Y. Lu, Y. Wen, T. Chen, Y. Zhang, and Y. Yang. 2023. Cathelicidin (LL-37) causes expression of inflammatory factors in coronary artery endothelial cells of Kawasaki disease by activating TLR4-NF-κB-NLRP3 signaling. Immunity, Inflammation and Disease 11 (9): e1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gao, F., F. Si, S. Feng, Q. Yi, and R. Liu. 2016. Resistin enhances inflammatory cytokine production in coronary artery tissues by activating the NF-κB signaling. BioMed Research International 2016:3296437. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Inflammation are provided here courtesy of Springer

RESOURCES