Canagliflozin Attenuates Podocyte Inflammatory Injury through Suppressing the TXNIP/NLRP3 Signaling Pathway in Diabetic Kidney Disease Mice

Abstract

Diabetic kidney disease (DKD), a leading cause of end-stage renal disease (ESRD), poses a serious threat to global health. Aseptic inflammation and pyroptosis of podocytes are crucial factors contributing to the pathogenesis and progression of DKD. Sodium-glucose cotransporter 2 inhibitors (SGLT2i), a novel class of antidiabetic agents widely used in clinical settings, may exert a protective effect on podocyte injury, although the underlying mechanisms remain poorly understood. This study uses the streptozotocin (STZ) -induced DKD mouse model to further explore the mechanism by which SGLT2i protect podocytes. The results demonstrated that Canagliflozin (CANA) treatment significantly improved serum creatinine levels, 24-h urinary albumin excretion, and urinary albumin-to-creatinine ratio (UACR) in DKD mice. Additionally, CANA treatment attenuated glomerular and podocyte injury, reducing overall pathological damage. Mechanistically, CANA reduced the expression of key inflammatory markers in the renal cortex of DKD mice, including TXNIP, NLRP3, ASC, caspase-1, IL-1β, IL-18, and GSDMD. These findings suggest that CANA may be an effective therapeutic agent for DKD by inhibiting the TXNIP-NLRP3 inflammasome pathway and preventing podocyte pyroptosis.

Introduction

Diabetic kidney disease (DKD), a prevalent microvascular complication of diabetes mellitus, is a leading cause of end-stage renal disease (ESRD)[1, 2]. The escalating prevalence of DKD highlights its significant impact on global health and underscores the urgency of developing effective therapeutic strategies[3]. Currently, the standard care for DKD primarily focuses on managing risk factors, such as blood glucose and blood pressure[4]. Renin angiotensin system (RAS) inhibitors are a cornerstone of DKD treatment. The advent of novel therapeutics, such as sodium-glucose co-transporters 2 inhibitors (SGLT2i), glucagon-like peptide-1 receptors (GLP-1R), and novel mineralocorticoid receptor antagonists (MRAs), has expanded treatment options and improved outcomes for DKD patients[5].

The pathogenesis of DKD is intricate, with inflammation playing a critical role in both the initiation and progression of the condition[6, 7]. The Nucleotide-binding oligomerization domain (NOD)-like Receptor Protein 3 (NLRP3) inflammasome, among the most thoroughly and deeply researched inflammasomes, has been implicated in a close association with DKD and podocyte injury[8, 9]. Podocytes, specialized cells within the kidney, are vital for maintaining the glomerular filtration barrier. They regulate the passage of large molecular proteins, stabilize the glomerular capillary structure, and preserve glomerular endothelial cell function[10]. However, pathological conditions can lead to podocyte damage, loss, and impaired regeneration, culminating in proteinuria and kidney damage[11].

The NLRP3 inflammasome, a multi-protein complex consisting of NLRP3, Apoptosis-Associated Spotted Like Protein with a CARD (ASC) and caspase-1[12], is closely associated with DKD and podocyte damage[13]. NLRP3 inflammasome activation in podocytes can exacerbate DKD podocytes dysfunction and glomerular injury[14]. Thioredoxin Interacting Protein (TXNIP), a protein that activates the NLRP3 inflammasome, has been shown to initiate downstream signaling pathways[15]. It plays a role in cellular oxidative stress and inflammatory responses[16].

Consequently, exploring effective measures and pathways to protect podocyte damage by suppressing inflammation holds significant clinical importance for the prevention and treatment of DKD.

SGLTs, transmembrane proteins involved in glucose reabsorption, are differentially expressed in the intestinal and glomerular compartments. SGLT-1 is mainly expressed in the small bowel, whereas SGLT-2 is mainly expressed in the proximal part of the renal tubules[17]. SGLT2 inhibitors (SGLT2i) are currently utilized as a novel class of hypoglycemic drugs in clinical practice[18, 19]. Numerous studies have indicated that it exerts a protective effect on the heart and kidneys[20–22]. SGLT2i has been recommended as a first-line treatment for DKD by various authoritative guidelines, with Canagliflozin (CANA) being one of the approved SGLT2i medications[23]. The primary mechanism of action involves the blockade of the SGLT-2 transporter in the renal proximal tubule, which inhibits glucose reabsorption, promotes the excretion of urine glucose and sodium, and contributes to a reduction in blood glucose levels[24]. Beyond their renal tubular actions, SGLT2i have been shown to protect against podocyte injury, a critical aspect of DKD pathophysiology[25]. This protection is believed to be multifaceted, involving mechanisms such as maintaining podocyte integrity, inhibiting podocyte apoptosis, enhancing podocyte autophagy, ameliorating slit diaphragm dysfunction, restoring podocyte epithelial-mesenchymal transition (EMT), and preventing podocyte loss. Despite these findings, the precise molecular mechanisms underlying SGLT2i's effects remain unclear[26]. In our previous in vitro studies, we observed that podocytes express SGLT2 at baseline, albeit at low levels. Notably, exposure of podocytes to high glucose conditions results in a significant upregulation of SGLT2 expression. Furthermore, we have demonstrated that SGLT2i effectively reverses the high glucose-induced increase in SGLT2 and NLRP3 expression in podocytes[27]. Based on these findings, the present study was designed to explore the protective effects of SGLT2i on podocyte injury in a DKD mouse model, employing losartan as a reference control, and to elucidate the underlying mechanisms.

Material and Methods

Drugs

Imported Canagliflozin (CANA) is marked by Janssen Pharmaceuticals, a division of Johnson company, and losartan used in this experiment was purchased from Merck Sharp. Streptozotocin (STZ) was prepared by Sigma-Aldrich Company (Sigma-Aldrich, United States) and dissolved in the citrate buffer (0.1 M, pH 4.5) for further use.

Animals

4-week-old male FVB mice weighting at 25–35 g were purchased from Jiangsu Jicui Co Ltd. All the work was carried out according to the approved guidelines. The experimental animals were housed in the Animal Experimentation Center of Shanghai Putuo District Hospital, and acclimatized in a clean environment at constant temperature for 2 weeks, subjected to a regular 12/12-h light/dark cycle, and fed with a standard diet. Diabetes was modelled by intraperitoneal injection of STZ at 50 mg/kg/day for 5 days after 4 weeks of high-fat feeding. One week later, successful DKD modelling was indicated by measurement of a random glucose ≥ 16.7 mmol/L. After 4 weeks of modelling the mice were randomly divided into 5 groups (n = 7 per group): (1) Normal control mice receiving vehicle (Ctrl), (2) diabetic kidney disease mice receiving vehicle (DKD), (3) diabetic kidney disease mice receiving Canagliflozin at 5 mg/kg/day (CANA), (4) diabetic kidney disease mice receiving losartan at 15.2 mg/kg/day (losartan), (5) diabetic kidney disease mice receiving Canagliflozin at 5 mg/kg/day and losartan at 15.2 mg/kg/day (CANA + losartan). Canagliflozin and losartan suspended in 0.5% sodium carboxymethyl cellulose were used as delivery vehicles and administered to mice by oral gavage for 8 weeks.

Measurement of Metabolic Parameters

Mouse was individually placed in a metabolic cage to collect 24 h urine. Urinary albumin was detected using a double antibody sandwich method. Anti-mouse urinary albumin antibody (Bethyl Laboratory, A90-134A) was encapsulated on the assay plate overnight, the next day add the sample/standard to bind with the antibody. Then add biotin-labelled detection antibody HRP (Bethyl Laboratory, A90-134P) enzyme conjugate and chromogenic substrate TMB (Bethyl Laboratory, lot 230,501) in turn. When the liquid shows blue, immediately add the Stop solution (Beyotime, P0215) to the reaction system. Finally measure the OD value at the 450 nm. Urinary creatinine was tested with a Creatinine (urinary) Colorimetric Assay Kit, Item No. 500701, purchased from Cayman chemical. Serum creatinine was measured using a creatinine (CRE) test kit purchased from Nanjing Jiancheng Bioengineering Institute (Item No. C011-2–1).

Renal Histology and Immunohistochemistry

Slices were first antigenically repaired using 50 × EDTA (Sangon Biotech Co. Ltd, E673003-0250) and then incubated sequentially at room temperature with hydrogen oxide blocks and rapid blocking solution. And then the primary antibody dilution is added and left overnight at 4℃. After incubation with biotinylated secondary (Vector Laboratories), the sections were incubated with VECTA-STAIN ABC reagent (Vector Laboratories). Next, the sections were color developed using the DAB Substrate kit (Vector Laboratories, ZLI-9018). Finally, sections were streaked using hematoxylin for 15 s. Observe the image with a bio-optical microscope at × 400 magnification. Immunostaining including Nephrin (Abcam, Ab216341, 1:500), WT-1 (Abcam, Ab89901, 1:200), TXNIP (Proteintech, 18,243–1-AP, 1:50) and NLRP3 (Proteintech, 19,771–1-AP, 1:50).

Immunofluorescence

Kidney tissues were dehydrated with 12% sucrose for 2 days, then embedded in optimum cutting temperature compound (OCT) and snap-frozen at −80℃. 4-μm sections were removed and rewarmed for 5 min, blocked with 10% normal goat serum to avoid nonspecific binding at room temperature for 1 h. Samples were incubated with primary antibody against NLRP3 (Proteintech, 19,771–1-AP, 1:50), Synaptopodin (Proteintech, 67,339–1-lg, 1:200), Nephrin (Abcam, Ab216341, 1:50) and WT-1 (Abcam, Ab89901, 1:50) at 4℃ overnight. Then, the sections were washed and treated with fluorescent-dye conjugated secondary antibodies including Alexa Fluor® 488-conjugated AffiniPure™ Goat Anti-Mouse IgG (H + L) (Jackson ImmunoResearch Laboratories, 115–545-003, 1:200), Cy™3-conjugated AffiniPure™ Goat Anti-Rabbit IgG (H + L) (Jackson ImmunoResearch Laboratories, 111–165-003, 1:200) and Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (Abcam, 150,077, 1:200) for 1 h at room temperature. After washing, the samples were counterstained with 4’,6-diamidino-2-phenylindole (DAPI), while to minimize background fluorescence, anti-fluorescence quenching blockers (Beyotime, P0126) were applied and fixed with coverslips. Finally, the slides were visualized using laser scanning confocal microscopy (LSM) to obtain detailed fluorescence images.

Periodic Acid-Schiff (PAS) Staining

Follow the standard steps of PAS reagent kit (Baso Diagnostics Inc, BA4080B). Paraffin sections of 4 μm thickness were cut and oxidized in periodate solution for 10 min, then stained with Schiff’s reagent for 10 min. Finally, sections were subjected to hematoxylin staining of the nuclei for 15 s and slides were covered with neutral gum fixation.

Transmission Electron Microscopy

After removing the mouse kidney, carefully slice the renal cortex into thin slices of approximately 2 mm³. These slices were quickly soaked in 2.5% glutaraldehyde electron microscopy solution and assisted by the Electron Microscopy Center of Shanghai Medical College, Fudan University.

Western Blot Analysis

Grind the renal cortex using RIPA lysis (Beyotime, P0013B) buffer containing 1 mM PMSF (Beyotime, ST505) and 1 × protease (Beyotime, P1005) and phosphatase inhibitor (Beyotime, P1045) at a concentration of 20 μl/mg for 1 min. The total protein is obtained from the supernatant after centrifugation at 12,000 rpm for 15 min. The total protein concentration of tissue lysates was determined using the BCA kit (Beyotime, P0009). Proteins were separated by SDS-PAGE and analyzed by Western blot following standard procedures. Blocking in 5% BSA for 1 h, then incubate overnight with specific primary antibody at 4 ℃: NLRP3 (ApidoGen, AG-20B-0014, 1:1000), IL-1β (Proteintech, 16,806–1-AP, 1:500), Caspase-1 (Proteintech, 22,915–1-AP, 1:2000), GSDMD (Proteintech, 20,770–1-AP, 1:2000), ASC (Proteintech, 10,500–1-AP, 1:2500), β-ACTIN (Abcam, Ab6276, 1:10,000). After washing the membrane with TBST, the goat anti-rabbit IgG and goat anti-mouse IgG secondary antibodies conjugated with horseradish peroxidase were incubated at room temperature for 1 h. Incubate with enhanced chemiluminescence (ECL) and exposure image with quantitative LAS 500. Densitometric quantitation was determined by Image J. β-ACTIN was used as an internal control.

Quantitative Real-time PCR

Extraction of total RNA from mouse renal cortex, RNA reverse transcription synthesis of first complementary strand DNA (cDNA), and PCR reaction system were all performed using reagent kits purchased from Tiangen Biochemical Technology (Beijing) Co, Ltd. The primer sequence design and synthesis were carried out by Biotechnology (Shanghai) Co, Ltd. Calculate the relative expression levels of each target gene mRNA using the 2^−ΔΔCT method and normalize them according to β-ACTIN. Determination of the expression levels of IL-1β and IL-18 in the renal cortex (Table 1).

Table 1.

Primers Used for Q-PCR

Gene name	Sequence (5’−3’)
IL-1β	forward	GAAATGCCACCTTTTGACAGTG
IL-1β	reverse	TGGATGCTCTCATCAGGACAG
IL-18	forward	GTGAACCCCAGACCAGACTG
IL-18	reverse	CCTGGAACACGTTTCTGAAAGA
Beta-Actin	forward	GAAGTGTGACGTGGACATCC
Beta-Actin	reverse	CCGATCCACACGGAGTACTT

Statistics Analysis

Data analysis was performed using GraphPad Prism version 9.0. The experimental results are expressed as mean ± standard error means (SEMs). One-way ANOVA followed by the Tukey’s post hoc analysis was employed to determine the statistical significance among groups. P < 0.05 is considered statistically significant.

Results

CANA Reduces Serum Creatinine, Urinary Albumin and UACR levels in DKD Mice

Kidney tissue and serum were collected after 8 weeks of treatment for each group (Fig. 1a). To assess the renal function level of mice, ELISA was employed to measure serum creatinine and 24-h urinary albumin content, and UACR was calculated accordingly. The results indicated that serum creatinine levels in the model group mice were significantly elevated compared to the Ctrl group (P < 0.01). Following treatment with CANA and losartan, serum creatinine levels in the treated mice were significantly restored relative to those in the DKD group (P < 0.01) (Fig. 1b). Similarly, the 24-h urinary albumin content and UACR in the model mice increased significantly 4 weeks after STZ injection, affirming the successful establishment of the DKD model (P < 0.05) (Fig. 1c, d). After 4 and 8 weeks of treatment with losartan, canagliflozin, or a combination of both, the 24-h urinary albumin content and UACR ratio in the treated mice were significantly decreased compared to the DKD group (P < 0.05) (Fig. 1c, d). These findings suggest that CANA ameliorates renal injury in DKD mice and exhibits a protective effect on renal function that is comparable to losartan.

Fig. 1.

CANA reduces serum creatinine and urinary albumin levels in DKD mice. (a) Schematic depicting the streptozotocin (STZ)-induced diabetes paradigm in FVB mice. After diabetes induction, mice were followed for 12 weeks. (b) serum creatinine, (c) 24-h proteinuria and (d) urine albumin-to-creatinine ratio (ACR). Values are mean ± SEM (n = 5). #P < 0.05, ##P < 0.01 versus Ctrl; *P < 0.05, **P < 0.01, versus DKD by one-way ANOVA with Tukey’s post doc analysis

CANA Reduces the Pathological Damage of Glomeruli and Podocytes in DKD Mice

To observe the impact of CANA on the renal pathological injury in the DKD model mice, paraffin sections of mouse kidney tissues were subjected to Periodic Acid-Schiff (PAS) staining. The results indicated that compared to the Ctrl group, the glomerular mesangial area was expanded, the mesangial matrix proliferation was augmented, and the glycogen deposition was increased in the DKD mice (P < 0.01). Following treatment with CANA, the aforementioned pathological injuries were ameliorated, suggesting that CANA can reduce the pathological injury of glomeruli (P < 0.01) (Fig. 2a, c). To further investigate the effect of CANA on the structure of podocytes, transmission electron microscopy (TEM) was employed to observe the changes in foot processes (Fig. 2b). The results revealed that DKD mice exhibited widened and fused podocytes, disappearance of foot processes, reduced density and quantity of podocytes, and thickened basement membranes. After CANA treatment, these alterations were significantly mitigated. These findings demonstrate that CANA can alleviate the pathological injury of podocytes and help maintain their structural stability.

Fig. 2.

CANA attenuates renal pathological damage in DKD mice. (a) PAS staining. (b) SEM images. (c) Relative glomerular mesangial area. Values are mean ± SEM (n = 5). ##P < 0.01 versus Ctrl; *P < 0.05, **P < 0.01, versus DKD by one-way ANOVA with Tukey’s post doc analysis

CANA Restores Glomerular Function and Podocyte Number in DKD Mice

Nephrin, a crucial structural molecule located on the glomerular podocyte membrane and a vital component of the podocyte slit diaphragm, plays a key role in the composition of the glomerular filtration barrier[28]. In renal disease research, Wilms tumor-1 (WT-1) is widely recognized as a podocyte-specific marker and is frequently used for podocyte counting[29, 30]. Immunohistochemical and immunofluorescence staining revealed that, in comparison to the Ctrl group, the expression of Nephrin and WT-1 in the glomeruli of DKD mice was significantly decreased (P < 0.01). Conversely, treatment with CANA, losartan, or a combination of both significantly up-regulated the expression of Nephrin and WT-1 in the glomeruli of DKD mice (P < 0.01) (Fig. 3a-h). In particular, upregulation was more pronounced in the group using CANA or the combination than in the group using losartan alone, but was not statistically significant. These findings suggest that CANA restores the number and function of podocytes within the glomeruli.

Fig. 3.

CANA restored the glomerular function and the number of glomerular podocytes in DKD mice. (a) Nephrin and (b) WT-1 stained by immunohistochemistry. (c) Nephrin positive area of each glomerulus and (d) WT-1 count per glomerulus in immunohistochemical staining. (e) WT-1 and (f) Nephrin stained by immunofluorescence. (g) WT-1 count per glomerulus and (h) Nephrin positive area of each glomerulus in immunofluorescence staining. Values are mean ± SEM (n = 5). ##P < 0.01 versus Ctrl; *P < 0.05, **P < 0.01 versus DKD; NS, nonsignificant versus CANA + losartan by one-way ANOVA with Tukey’s post doc analysis

CANA Reduces TXNIP Expression in the Glomeruli of DKD Mice

To further elucidate the pathway of NLRP3 activation, we examined TXNIP expression. Immunohistochemical analysis revealed that, in comparison to the Ctrl group, there was a significant increase in TXNIP expression within the glomeruli of DKD mice. Moreover, TXNIP expression was significantly reduced following CANA treatment (P < 0.01) (Fig. 4).

Fig. 4.

CANA reduces the expression levels of TXNIP. TXNIP stained by immunohistochemistry and TXNIP positive area of each glomerulus. Values are mean ± SEM (n = 5). ##P < 0.01 versus Ctrl; *P < 0.05, **P < 0.01 versus DKD by one-way ANOVA with Tukey’s post doc analysis

CANA reduces NLRP3 Expression in Podocytes of DKD Mice

Western blot analysis revealed that, in comparison to the Ctrl group, NLRP3 expression was up-regulated in the renal cortex of DKD mice (P < 0.01). Additionally, treatment with CANA led to a significant decrease in NLRP3 expression (P < 0.05), and the combined treatment group of CANA and losartan was more effective than treatment with CANA alone (P < 0.05) (Fig. 5a-b). Immunohistochemical staining results demonstrated a significant increase in NLRP3 expression in the glomeruli of DKD mice compared to Ctrl mice and a reduction in NLRP3 expression in the CANA group relative to the DKD group (Fig. 5c-d). Immunofluorescence imaging corroborated these findings, showing co-expression of NLRP3 and Synaptopodin in glomeruli. Compared to Ctrl mice, DKD mice showed high levels of NLRP3 expression and low levels of Synaptopodin in the glomeruli. After treatment with CANA, the expression of NLRP3 in the glomeruli was significantly downregulated, while the expression of Synaptopodin was markedly restored (Fig. 5e-g).

Fig. 5.

CANA reduces the expression level of NLRP3. (a-b) Western bolt analysis of renal cortical NLRP3 expression levels. (c) Immunohistochemical staining of the glomerular NLRP3 positive area (d) NLRP3 stained by immunohistochemistry. (e–g) Immunofluorescence staining of NLRP3 and Synaptopodin. Values are mean ± SEM (n = 5). ##P < 0.01 versus Ctrl; *P < 0.05, **P < 0.01 versus DKD; &P < 0.05, &&P < 0.01, NS, nonsignificant versus CANA + losartan by one-way ANOVA with Tukey’s post doc analysis

CANA Reduces the Protein Expression of the ASC-Caspase 1/IL-1β/GSDMD Pathway in DKD Mice

To verify the effect of CANA on inflammatory expression in DKD mice, the mRNA expression levels of IL-1β and IL-18 were measured by Q-PCR. The results indicated that the mRNA expression levels of both IL-1β and IL-18 were significantly elevated in the DKD group compared to the Ctrl group (P < 0.05). Additionally, treatment with CANA resulted in a notable decrease in the mRNA expression levels of IL-1β and IL-18 (P < 0.05) (Fig. 6a-b). Western blot analysis was then used to examine the expression levels of NLRP3 downstream proteins. The results revealed that IL-1β, ASC, Caspase-1, and GSDMD protein levels were significantly reduced in the CANA-treated mice compared to the DKD group (Fig. 6c-g).

Fig. 6.

CANA reduces the expression levels of ASC, Caspase-1, IL-1β and GSDMD. (a) IL-1β and (b) IL-18 mRNA relative expression (c-g) Western blot analysis of renal cortical ASC, Caspase-1, IL-1β and GSDMD expression levels. Values are mean ± SEM (n = 3). #P < 0.05, ##P < 0.01 versus Ctrl; *P < 0.05, **P < 0.01 versus DKD; &P < 0.05, &&P < 0.01 versus CANA + losartan by one-way ANOVA with Tukey’s post doc analysis

Discussion

Diabetic Kidney Disease (DKD) represents a prevalent microvascular complication associated with diabetes mellitus. The classic clinical hallmarks include persistent proteinuria, a gradual decline in renal function, and characteristic morphological alterations of the glomeruli. However, recent observations have highlighted that the clinical manifestations and progression of DKD can vary significantly[31]. The histopathological hallmarks of DKD commonly include glomerular basement membrane thickening, mesangial proliferation, endothelial changes and podocyte injury[32]. The structural and functional derangements of the glomeruli are intricately linked to podocyte injury and loss[33]. Podocytes are unique, highly specialized kidney cells with crucial roles. They maintain the glomerular basement membrane’s integrity and regulate the filtration of large proteins through the charge-selective barrier. They also preserve the structural stability of glomerular capillaries and balance the hydrostatic pressure within the glomerulus. Furthermore, podocytes support the endothelial cells function and contribute to the synthesis and secretion of vascular endothelial growth factor[34]. In pathological conditions, damage, detachment and lack of regeneration of podocytes can compromise the glomerular filtration barrier, resulting in increased proteinuria and renal impairment.[35].

SGLT2, a high-capacity, low-affinity cotransporter, is localized to the S1 and S2 segments of the proximal renal tubules[36]. SGLT2i represents a novel class of oral hypoglycemic agents that achieve their therapeutic effect by facilitating the excretion of glucose in urine independent of insulin [37]. Furthermore, SGLT2i has been demonstrated to facilitate the excretion of sodium, counteract the tubulo-glomerular feedback mechanism, and decrease intraglomerular pressure, collectively contributing to the preservation of renal function[38]. Moreover, SGLT2i has been observed to have additional benefits, including the reduction of blood pressure, body fat mass, and metabolic disorders, in addition to demonstrating anti-inflammatory and anti-fibrotic properties, and providing comprehensive cardiovascular and renal protection[39–42].

SGLT-2 s is predominantly expressed in the proximal renal tubules; however, recent research has indicated that SGLT2i also exerts a protective effect on podocytes [43]. SGLT2i exerts reno-protective effects through various mechanisms, including the preservation of podocyte integrity, suppression of podocyte apoptosis, augmentation of podocyte autophagy, and prevention of podocyte loss[44]. In a study by Zhao XY et al., it was observed that the expression level of SGLT2 was elevated and co-localization with Synaptopodin was reduced in kidney biopsy samples from lupus mice. Treatment with SGLT2i resulted in increased expression of Nephrin and podocin in mice, significantly ameliorating podocyte injury and suggesting a protective effect of SGLT2i on podocytes[45]. Guo R et al. discovered that SGLT2i can down-regulate the IGF1R/PI3K signaling pathway to inhibit podocyte epithelial-mesenchymal transition (EMT) in DKD podocytes[46]. Sun J et al. found that SGLT2i targets ABCA1 signaling pathway to regulate podocyte cholesterol accumulation and alleviate podocyte injury[47]. Ge M et al. not only demonstrated similar expression levels of SGLT2 protein in human and mouse podocytes to those in tubular cells but also observed that SGLT2i mitigates podocyte lipid droplet accumulation and apoptosis in Alport syndrome[25].

In this study, the administration of CANA significantly reduced serum creatinine levels, 24-h urinary albumin, and the urinary albumin-creatinine ratio (UACR) in mice. Immunohistochemical staining, immunofluorescence staining, PAS pathological staining and electron microscopy observation revealed a restoration of glomerular and podocyte architecture. These findings were comparable to those observed with losartan treatment. At the same time, we observed a better therapeutic effect when CANA and losartan were combined than CANA or losartan alone, but the results were not statistically significant. The results from our study suggest that CANA exerts significant anti-proteinuria effects and delays the progression of renal dysfunction in the DKD mouse model. This is consistent with the improvement of glomerular lesions and the reversal of podocyte injury.

The past few years have witnessed a surge in research examining the potential of SGLT2i to improve podocyte injury. However, reports on the relationship between SGLT2i and renal podocyte sterile inflammation are scarce[48]. Clinical studies have shown that SGLT2i can exert an anti-inflammatory effect by reducing serum inflammatory factors such as IL-1β in patients with type 2 diabetic nephropathy[49]. Basic research has also revealed that SGLT2i exhibits anti-inflammatory properties, including the inhibition of NLRP3 inflammasome expression and Il-1β and IL-18 secretion in human aortic smooth muscle cells[50], and reduction of TNF-α and IL-1 levels in cardiomyocytes under high glucose conditions; Inhibition of AMPK signaling pathway in liver cells reduces the expression of IL-17 and IL-23[51], decrease the levels of IL-6 and IL-1β in an LPS-induced lung injury model[52], and inhibit the activation of NLRP3/ASC inflammasome in cardiac fibroblasts of DKD[53]. Furthermore, SGLT2i has been found to inhibit the activation of AMPK/Akt in the renal cortex of BTBR ob/ob mice with type 2 diabetes[54], decrease the mRNA production of TNF-α/PEDF/PTX-3 in the kidney of diabetic rats[55], and other effects. Our previous in vitro study demonstrated that high glucose can induce the up-regulation of NLRP3 expression in human podocytes, and SGLT2i can reverse this effect[27]. Therefore, it is speculated that SGLT2 inhibitors may regulate inflammatory signaling pathways in podocytes by inhibiting the NLRP3 pathway, thereby protecting podocyte function.

Inflammatory injury is a key factor in the progression of podocyte injury in DKD[56]. There has been a significant growth in the scientific in DKD[57]. Recent research has indicated that the activation of the NLRP3 inflammasome can elicit an inflammatory response in renal podocytes, leading to renal failure. The NLRP3 inflammasome is a complex multi-protein assembly consisting of NLRP3, ASC, and caspase-1. The activation of NLRP3 primarily involves three key mechanisms[58]: (1) the activation and regulation of ions, such as potassium ion efflux, sodium ion efflux and chloride ion efflux; (2) the activation and regulation of organelles, including mitochondria, endoplasmic reticulum, centrosomes, Golgi and endosomes, and lysosomes; (3) the activation and regulation of metabolism, including glycolysis, the tricarboxylic acid cycle, and fatty acid metabolism. While the upstream events initiating NLRP3 activation remain unclear, studies have shown that TXNIP expression is elevated in a hyperglycemic environment and serves as a pivotal signaling node linking ER stress with inflammation[59]. TXNIP can directly engage with NLRP3 through a REDOX-dependent interaction to facilitate IL-1β mRNA transcription and activate the NLRP3 inflammasome[15, 60]. TXNIP plays a significant role in cellular metabolism by activating inflammatory signaling via the NLRP3 pathway. In DKD, elevated glucose levels contribute to renal hypoxia and oxidative stress, leading to increased TXNIP and NLRP3 expression[61]. TXNIP interacts with the pyrin domain of NLRP3 and ASC, enabling the CAR domain of ASC to recruit and engage pro-caspase-1, thus promoting its cleavage and activation. Cleaved caspase-1 then processes pro-IL-1β and pro-IL-18 into their mature forms, which are subsequently secreted into the cytoplasm, initiating the inflammatory response. Additionally, active caspase-1 cleaves GSDMD at the interface between its N- and C-terminal domains, generating an N-terminal fragment that forms membrane pores and triggers pyroptosis[62]. Existing research has also shown that kidney injury is significantly exacerbated when NLRP3 gap-specific mutants are specifically expressed in podocytes, and NLRP3-deficient hyperglycemic mice exhibit protective effects against DKD[8]. These findings suggest that targeting NLRP3 and suppressing sterile inflammation represent potential therapeutic strategies for alleviating podocyte injury in DKD.

In our current study, we observed an increase in TXNIP and NLRP3 expression in the renal cortex of DKD mice. Notably, CANA treatment significantly attenuated TXNIP and NLRP3 expression in comparison to DKD mice. Concurrently, we found elevated levels of downstream signaling pathway-related proteins, including Caspase-1, GSDMD, and ASC, in the renal cortex of DKD mice. The administration of CANA resulted in a significant reduction in their expression levels. Based on these findings, we propose that SGLT2i may inhibit the production of TXNIP and the activity of NLRP3, thereby mitigating the inflammatory response of DKD podocytes, preventing podocyte pyroptosis, and safeguarding the functionality of DKD glomeruli and podocytes (Fig. 7).

Fig. 7.

CANA attenuates podocyte inflammation and pyroptosis by inhibiting the TXNIP/NLRP3 pathway

In this study, losartan served as positive controls for DKD treatment. Angiotensin-converting enzyme inhibitors (ACEIs) and angiotensin receptor blockers (ARBs), collectively known as RAAS inhibitors, have been the cornerstone of DKD treatment for over two decades and are widely recommended as first-line antihypertensive medications for diabetic patients[63]. Losartan has been demonstrated to exert a protective effect on DKD podocytes, in addition to an inhibitory effect on inflammatory pathways. Consequently, it is frequently utilized as a positive control in mechanistic studies of drug treatment for DKD in mice[64, 65]. In recent years, numerous clinical trials have underscored the beneficial effects of SGLT2i on the hearts and kidneys of DKD patients, identifying new potential therapeutic targets for SGLT2i and fostering a comprehensive revision of DKD treatment guidelines. However, the precise mechanism of action of SGLT2i remains the subject of ongoing investigation, particularly with regard to its protective effects and mechanisms on podocytes, which are less well understood at present. Presently, SGLT2i and RAAS inhibitors are recognized as first-line basic medications for DKD management, effectively delaying the progression of chronic kidney disease (CKD) in affected individuals. several potential renal protection mechanisms of RAAS blockers and SGLT2i have been proposed over the past few years[38, 66, 67]. However, the precise mechanisms underlying these effects remain unknown. Some scholars have employed single-cell sequencing to demonstrate that there is a superimposed rather than a synergistic effect between the two drugs, ARBs and SGLT2i. ARBs exhibit more pronounced anti-inflammatory and anti-fibrotic effects in the proximal renal tubular cells of db/db mouse models, whereas SGLT2i seems to impact more significantly on mitochondrial function in proximal tubular (PT) cells[68]. However, the specific mechanisms through which this process occurs within podocytes remain to be elucidated. In the present study, we found that SGLT2i, like ARBs, exerted a discernible protective effect on podocytes inflammatory injury in a murine model of DKD. Notably, SGLT2i demonstrated a remarkable capacity to impede the expression of TXNIP, NLRP3 and their downstream signaling pathway proteins in DKD mice. Of particular note was the observation that combined treatment group of SGLT2i and ARBs exhibited a more pronounced inhibition of NLRP3 expression compared to SGLT2i alone. Furthermore, the combination of the two drugs exhibited a superior effect in the down-regulating of the mRNA expression levels of IL-18 as well as the expression levels of ASC protein and GSDMD protein, in comparison with SGLT2i or ARBs administered individually. This finding lends further support to the hypothesis that the protective effect of SGLT2i on the pyroptosis of DKD podocytes was also demonstrated. The combination of SGLT2i and ARBs was marginally more efficacious than ARBs alone in protecting against renal function and podocyte injury (as reflected by serum creatinine, Nephrin, and WT-1 protein levels). However, these results did not reach statistical significance. This observation may also represent a limitation of our study, as the animal model of DKD may not fully capture the complexities of human DKD, the sample size is still limited, and expanding sample sizes will be essential to further minimize inter-animal variability. Furthermore, additional research is needed to elucidate the potential renal protection mechanisms of RAS blockers and SGLT2i.

In summary, our findings indicate that canagliflozin protects podocytes from pyroptosis induced by GSDMD activation in DKD by inhibiting the NLRP3/ASC/Caspase-1 signaling pathway. This inhibition significantly reduces the production and activity of downstream inflammatory factors such as IL-1β and IL-18, thereby modulating their translation and regulating the inflammatory response. This approach not only preserves podocyte integrity but also delays the progression of DKD. The potential link between NLRP3 activation and increased TXNIP levels warrants further exploration, as the etiology of DKD is multifaceted and requires extensive research to fully understand the specific regulatory mechanisms involved.

Author Contributions

B. Z, T.B and H. W contributed to the conceptualization and theoretical framework of the study and were also involved in the critical revision of the manuscript for important intellectual content. S. L, J.W, and Y. C involved in the data collection, and drafting of the manuscript. Y. C, Y. W, N. X, and X. Y participated in the experimental work and data analysis. Y. S, J. F, Q. X and X. Y were responsible for the statistical analysis. L. W, J. H and Y. C provided resources and technical support throughout the research. All authors have read and approved the final manuscript.

Funding

This work was funded by Clinical specialty of Shanghai Putuo District Health System project(2021tszk02), Key Medical Discipline Project of Shanghai Municipal Health Bureau (ZK2019A12), Putuo District of shanghai Science and Technology Commission Research Project (ptkwws202311), and Traditional Chinese Medicine Research Project of Shanghai Municipal Health Commission(2024QN080).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval

The Animal Ethics Committee for Animal Research, Putuo District Center Hospital, Shanghai (Putuo Hospital, Shanghai University of Traditional Chinese Medicine) (DWEC-A-202212001) approved the Animal experiments.

Conflict of Interest

The authors declare no competing interests.