Abstract
Research on 4,4’-dimethoxychalcone (DMC) in the context of traumatic brain injury (TBI) is extremely limited, and no effective clinical treatments are available to improve outcomes for individuals with TBI. Our study aims to investigate the underlying mechanisms by which DMC may alleviate neuroinflammation and neuronal damage following TBI. This study seeks to provide a theoretical foundation for the development of future pharmacological therapies for TBI. A moderate TBI model was established using the fluid percussion injury (FPI) method. The recovery of neuromotor function following TBI was evaluated using the modified neurological severity score (mNSS), the Morris water maze test, and analysis of cerebral edema. Gene and protein expression levels were quantified using cell viability assays, quantitative real-time polymerase chain reaction (qRT-PCR), Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, and immunofluorescence. Network pharmacology was employed to predict potential targets of DMC, and gene ontology (GO) analysis along with KEGG pathway enrichment was conducted to predict signaling pathways affected by DMC.DMC treatment significantly improved neuromotor deficits in mice after TBI. In both in vivo and in vitro experiments, DMC suppressed microglial activation and decreased the production and release of inflammatory factors. Additionally, DMC reduced neuronal lesions after TBI. DMC notably decreased the elevated expression of triggering receptor expressed on myeloid cells 2 (TREM2) following TBI. Network pharmacological analysis indicated that DMC’s therapeutic effects may be mediated through the PI3K/AKT signaling cascade. These findings indicate that DMC has therapeutic potential for TBI, with significant anti-inflammatory and neuroprotective properties likely mediated by the TREM2/PI3K/AKT/NF-κB signaling cascade.
Keywords: 4,4’-Dimethoxychalcone; Traumatic brain injury; Microglia; Myeloid cells express trigger receptor 2; Neuroprotection
Introduction
Traumatic brain injury (TBI) is a prevalent neurological disorder with severe consequences [1]. In China, the rate of TBI has risen among middle-aged and elderly populations due to car accidents and falls [2], while gunshot wounds are more prevalent in conflict areas such as the Middle East [3]. The economic impact of TBI is substantial, particularly in low and middle-income countries with limited healthcare resources [4, 5]. Initial injuries resulting from mechanical forces lead to conditions such as hypoxia, hemorrhage, and cellular damage [6, 7]. Subsequent injuries, including inflammation and oxidative stress, exacerbate CNS damage over time [8, 9], presenting a critical opportunity for intervention. However, effective treatment options remain scarce, contributing to elevated rates of mortality and disability [10].
Neuroinflammation is a central component of secondary injury in TBI [11]. The local inflammatory response begins right after the initial mechanical trauma, as injured neurons release various danger signals (such as heat shock proteins and ATP), which activate microglial cells and astrocytes within the CNS’s innate immune system [12]. In the context of neuroinflammation triggered by TBI, microglia, the main immune cells of the CNS, are pivotal. The ensuing inflammatory cascade is self-perpetuating, resulting in the release of inflammatory mediators, excessive activation of glial cells, infiltration of leukocytes, and subsequent pathological alterations, including cell death, brain swelling, and breakdown of the blood–brain barrier [13]. Microglia, as key regulators of the CNS immune response, rapidly transition to an activated state post-injury [14, 15]. However, research has shown that microglia exhibit dual roles in the CNS [16]. In the initial stages of injury, microglia can play a protective role by regulating the inflammatory response and releasing anti-inflammatory factors, like IL-10, thus mitigating excessive immune reactions that could otherwise cause additional harm to brain tissue. As TBI progresses, microglia-mediated inflammatory responses can become dysregulated, leading to overactivation and a shift toward a pro-inflammatory phenotype (M1) [17, 18]. These excessively activated microglia release significant amounts of pro-inflammatory cytokines, such as TNF-α, IL-1β, and IL-6 [12], which aggravate neuronal damage through excitotoxic processes, mainly by increasing glutamate release [19]. This sustained release of inflammatory mediators and excitotoxic agents further damages surrounding healthy brain tissue, amplifying the neuroinflammatory response [18]. While microglia possess protective potential in the early stages of TBI, their continued overactivation contributes to chronic neuroinflammation and neurological damage. Therefore, managing microglial activation and function is essential for reducing long-term neuroinflammation caused by TBI and supporting neurological recovery. Despite extensive studies into modulating microglial activity to improve TBI outcomes, no effective clinical therapies currently exist.
Recently, TREM2 (Triggering Receptor Expressed on Myeloid Cells 2) has been identified as a unidirectional transmembrane receptor predominantly found on microglia and myeloid cells [20]. It plays a vital role in modulating neuroinflammation, phagocytosis, and tissue repair in the nervous system [21]. Studies have shown that the activation of TREM2 can alleviate neuroinflammation and facilitate the removal of damaged tissue by influencing the phenotypic changes and phagocytic activity of microglia. Notable neuroprotective effects have been observed in models of TBI [22, 23], subarachnoid hemorrhage (SAH) [24], ischemic stroke [25], and Alzheimer’s disease [26, 27]. For example, TREM2 activation has been shown to reduce neuronal apoptosis, promote myelin repair, and improves blood–brain barrier function and cognitive performance through signaling pathways such as PI3K/Akt and DHCR24/LXR. Conversely, the lack of TREM2 significantly hinders the phagocytic capacity of microglia, exacerbates brain injury and inflammation, and results in incomplete tissue repair and suboptimal functional recovery [22, 23, 28]. Additionally, some studies suggest that TREM2 may perform its function by detecting nucleic acids or other danger signals released from damaged neurons [24]. In summary, TREM2 plays an essential role in maintaining brain homeostasis and promoting neuronal recovery, making it a potential therapeutic target for neuroinjury and neurodegenerative diseases. Thus, pharmacologically targeting TREM2 may offer a promising approach for the treatment of TBI.
4,4’-Dimethoxychalcone (DMC) is a flavonoid that has attracted significant attention due to its capabilities in scavenging free radicals, providing anti-inflammatory and anti-aging effects, and inhibiting tumor growth. These effects have been widely validated in recent studies, generating considerable research interest [29, 30]. Recent studies have demonstrated that DMC exhibits significant anti-inflammatory effects in models of Parkinson’s disease. The findings indicate that DMC effectively reduces the production of reactive oxygen species (ROS) and mitigates oxidative stress-induced pro-inflammatory responses by activating PKC θ and affecting the riboflavin cycle pathway. Moreover, DMC leads to a marked reduction in the expression levels of IL-1β, TNF-α, and IL-6, thereby enhancing the inflammatory microenvironment [31, 32]. However, the precise mechanisms through which DMC exerts its anti-inflammatory effects remain to be further explored. Additionally, studies have indicated that DMC offers protective benefits to dopaminergic neurons. It promotes the expression of tyrosine hydroxylase (TH), which boosts dopamine production, and also inhibits MPP + (neurotoxin)-induced neuronal apoptosis, thereby providing neuroprotection in Parkinson’s disease [31, 32]. Furthermore, DMC has been found to exert protective effects in primary renal clear cell carcinoma and aged mouse models by modulating iron metabolism or activating autophagy pathways [33, 34]. These mechanisms are intricately linked to the pathophysiological processes that occur after TBI [35]. However, research on DMC in the context of TBI remains scarce.
In this study, we explored the role of DMC in TBI and assessed its potential therapeutic benefits using a combination of network pharmacology and experimental validations. Our aim was to discover new therapeutic agents that can improve outcomes for TBI and elevate the quality of life for individuals affected by this condition.
Methods
Cell Culture
The BV2 mouse microglial cell line was reactivated and grown in DMEM (KeyGEN BioTECH, China) enriched with 10% FBS (Sigma, USA) at 37 °C in a 5% CO₂ environment. The growth medium was refreshed every two days, and the cells were subcultured every 48 h.
Experimental Animals
Male C57BL/6 mice, aged 8 to 9 weeks and weighing 18 to 22 g, were sourced from the Nanjing Qinglongshan Animal Breeding Center. The mice were kept in a sterile setting with regulated temperature and humidity, following a 12-h light and dark cycle. The animals were handled and treated in accordance with ethical standards, and the mice had unrestricted access to both water and food.
Establishment of TBI Model
Mice were used for TBI research, and the experimental protocol was approved by the Institutional Animal Care and Use Committee. TBI was induced using the fluid percussion injury (FPI) model (AmScien Instruments, Richmond, Virginia, USA) [36, 37]. Anesthetization of the mice was achieved with isoflurane, maintaining a level that ensured the absence of nociceptive reflexes (such as the toe pinch reflex). After administering anesthesia, the mice were positioned in a stereotaxic frame to stabilize the head. The surgical area was sterilized using a solution of 70% ethanol and povidone-iodine. A 3 mm craniotomy was then performed on the left hemisphere of the mouse brain, 2 mm lateral to the sagittal suture and 3 mm anterior to the bregma, using a high-speed drill while taking care to avoid injuring the dura mater. Following the craniotomy, a luer-lock connector was securely attached to the skull using dental cement and connected to the FPI device. A moderate fluid percussion injury was administered at a pressure of 2.0 ± 0.2 atm, with an impact duration of less than 20 ms. After the injury, the cranial defect was sealed with bone wax, and the incision was sutured closed. The mice were then moved to a temperature-controlled recovery room for post-operative recovery. Recovery was monitored by observing reflex responses and assessing the modified neurological severity score (mNSS). The procedure was repeated three times to ensure the establishment of a moderate TBI injury. The mice were allocated at random into four different groups: Sham, TBI, TBI + Vehicle (administered with dimethylsulfoxide [DMSO] mixed with corn oil), and TBI + DMC (administered with 100 mg/kg DMC via gavage post-injury).
Modified Mouse Neurological Function Score (mNSS Score)
Neurofunction was evaluated using the modified neurological severity score (mNSS) at 24, 48, and 72 h post-TBI. The mNSS scoring system assessed motor, sensory, reflex, and balance functions, as well as any abnormalities. Motor function was assessed through tail suspension and the observation of spontaneous movements to monitor the muscle condition and overall impairment of motor function. Sensory function was evaluated by tactile and nociceptive tests, measuring the mice’s ability to respond to stimuli. Reflexes and balance were examined through corneal reflex, pinna reflex, righting reflex, and beam walking, assessing the integrity of the reflex arc, posture control, and motor coordination. Abnormal behaviors were observed by noting involuntary movements and the mice’s responsiveness to environmental stimuli, providing insight into the state of the motor control centers and the level of alertness and consciousness. The scale spans from 0 to 18, where elevated values correlate with increased levels of neurological dysfunction. A zero score signifies typical functionality, while scores of 1–6 suggest slight decline, 7–12 denote moderate decline, and 13–18 indicate significant decline in neurological capabilities.
Brain Water Content Measurement
To evaluate cerebral swelling, the water content in the brain was determined using the wet-dry weight technique. Brain tissue was carefully dried with filter paper, and the wet weight was recorded. The sample was subsequently dehydrated in an oven at 90 °C for 72 h to ascertain the dry mass. The calculation for brain water content is as follows: (weight before drying—weight after drying) / weight before drying × 100%. Elevated percentages suggest increased edema severity.
Morris Water Maze (MWM)
The Morris Water Maze assessment was employed to assess cognitive abilities following DMC therapy. The setup included a circular pool measuring 120 cm in diameter, featuring a submerged platform with a diameter of 8 cm. The water temperature was kept between 20–22 °C and colored with alum. Mice participated in four days of training, during which the duration needed to locate the platform (escape latency) was measured. After the FPI injury, the Sham, TBI, and DMC-treated groups were tested for three consecutive days. At the end of the experiment, the platform was taken out, and the duration spent in the designated quadrant (within 60 s) was documented. The percentage of time spent was computed as follows: (time in the designated quadrant/60) × 100%.
Cell Viability Assay (CCK-8)
BV2 microglial cells were cultured in 96-well plates at a density ranging from 3000 to 5000 cells per well. After adherence, lipopolysaccharide (LPS) and DMC were added at various concentrations. The CCK-8 reagent (Beyotime Biotechnology, China) was combined with DMEM containing 10% FBS and allowed to incubate with the cells for 2 h at designated time intervals of 12 h, 24 h, 36 h, and 48 h. Cell viability was evaluated by measuring the absorbance at 450 nm with a spectrophotometer.
qRT-PCR
RNA was isolated from brain tissue samples utilizing the Trizol reagent (Sangon Biotech, China). The concentration of RNA was determined, and 2 μg of RNA was subjected to reverse transcription to generate cDNA. qRT-PCR was carried out using SYBR Green Master Mix (Tiangen, China) according to the following procedure: melting (95 °C, 20 s), annealing (94 °C, 10 s), and elongation (70 °C, 25 s) for 40 cycles. The relative gene expression was determined employing the 2^-ΔΔCt approach. The primer sequences are as follows: GAPDH forward 5'- ATGACCACAGTCCATGCCATC −3' and reverse 5'- GAGCTTCCCGTTCAGCTCTG −3'; IL-1β forward 5'- TCCAGGATGAGGACATGAGCAC −3' and reverse 5'- GAACGTCACACACCAGCAGGTTA −3'; NF-κB forward 5'- ATGGCAGACGATGATCCCTAC −3' and reverse 5'- CGGAATCGAAATCCCCTCTGTT −3'; TNF-α forward 5'- TGCCTATGTCTCAGCCTCTT −3' and reverse 5'- GGAGGCCATTTGGGAACT −3'.
Western Blot
Brain tissue was collected from the region surrounding the injury site, specifically from the cortical area. Protein concentrations were measured using a BCA assay kit (Beyotime Biotechnology, China). Samples were separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, USA), followed by blocking with either 5% skim milk or 5% BSA (Biosharp, China). The membranes were then incubated with primary antibodies overnight. The following day, secondary antibodies were applied for further processing. Protein bands were detected using a GE Imaging System (Amersham ImageQuant 800) and analyzed with ImageJ software. Protein levels were normalized relative to internal reference proteins. The following primary antibodies were used: PI3K (Cell Signaling Technology, 4257 T, 1:1000, USA), phosphorylated PI3K (Cell Signaling Technology, 17366 T, 1:1000, USA), AKT (Cell Signaling Technology, 4691 T, 1:1000, USA), phosphorylated AKT (Cell Signaling Technology, 4060 T, 1:2000, USA), NF-κB (Abcam, AB32536, 1:10,000, UK), phosphorylated NF-κB (Affinity, AF2006, 1:1000, USA), IL-1β (Affinity, AF5103, 1:1000, USA), TREM2 (Abcam, AB305103, 1:1000, UK), Bax (Abcam, AB32503, 1:5000, UK), Bcl-2 (Huabio, JF104-8, 1:2000, China), and β-Actin (Affinity, AF7018, 1:10000, USA).
ELISA
ELISA kits were used to assess the concentrations of IL-1β (Epizyme Biomedical Technology, China) in cell supernatants and TNF-α (Epizyme Biomedical Technology, China) in tissue samples, following the manufacturer’s instructions.
Nissl Staining
Nissl staining was conducted to assess neuronal viability following TBI. After the establishment of the model, mice were sacrificed, and tissue samples were collected, embedded, and prepared for sectioning. Mice underwent perfusion with saline, followed by paraformaldehyde, after which the brain tissue was fixed, dehydrated, and embedded in paraffin. Slides (5–10 μm) were subjected to deparaffinization, rehydration, and subsequently stained with a Nissl staining kit (Beyotime Biotechnology, China). The slides were then scanned and evaluated for neuronal viability.
Hematoxylin and Eosin (HE) Staining
After embedding the brain tissue samples in paraffin and slicing them into sections the samples were first deparaffinized by immersing them in xylene and subsequently rehydrated through a series of graded ethanol and distilled water. The sections were then subjected to staining using the Hematoxylin and Eosin (HE) method. Initially, the sections were stained with hematoxylin (Beyotime Biotechnology, China), followed by washing with distilled water. Following this, the sections underwent differentiation with a 1% hydrochloric acid ethanol solution (Beyotime Biotechnology, China), and were subsequently stained with eosin (Beyotime Biotechnology, China). After staining process, the sections were washed with distilled water, dehydrated through a graded series of ethanol, and cleared with xylene. Finally, coverslips were applied to the sections. The stained samples were then visualized using microscope (Zeiss, Germany) for histological analysis.
Immunohistochemistry
Brain tissue samples were embedded in paraffin and sectioned into 5–10 µm slices. The tissue slices underwent a series of procedures, starting with deparaffinization in xylene, followed by rehydration through a graded ethanol series and then immersion in distilled water. Antigen retrieval was performed by heating the sections in a sodium citrate buffer solution at high temperature. After this step, the sections were permeabilized with 0.1% Triton X-100 (Beyotime Biotechnology, China) for 20 min. After washing with PBS, non-specific binding sites were blocked by incubating the sections with 5% BSA for 1 h at room temperature. Subsequently, the sections were then incubated overnight at 4 °C with the primary antibody (Iba1, AB178846, Abcam, 1:2000, UK). On the following day, the sections received an incubation with the HRP-conjugated secondary antibody for 1 h at room temperature. After this incubation, the immunoreactivity was visualized using a DAB (diaminobenzidine) substrate kit (Boster Biological Technology, China) according to the manufacturer’s instructions. Following DAB staining, the sections were counterstained with hematoxylin to visualize the cell nuclei. Once the staining was completed, the sections were dehydrated through a graded ethanol series, cleared with xylene, and then mounted under coverslips. The stained sections were photographed under a light microscope (Zeiss, Germany).
Immunofluorescence
As previously outlined, brain tissue samples were paraffin-embedded, and sections with a thickness of 5–10 µm were produced. Freshly prepared paraffin sections underwent deparaffinization and rehydration before being subjected to antigen retrieval by heating in sodium citrate buffer at high temperature. Following antigen retrieval, the sections were permeabilized with 0.1% Triton X-100 for 20 min. After washing with PBS, non-specific binding sites were blocked by incubating the sections with immunofluorescence blocking solutions (Beyotime Biotechnology, China) for 1 h. The sections were then incubated overnight with the primary antibody (Iba1, Abcam, AB283346, 1:100, UK). On the following day, the sections were washed with PBS, followed by incubation with the second primary antibody (TREM2, Abcam, AB305103, 1:500, UK) overnight. On the third day, following washing to remove the second primary antibody, the sections were exposed to the appropriate fluorescent secondary antibodies. For double labeling, primary antibodies from different species were selected, and the corresponding species-specific secondary antibodies conjugated to distinct fluorophores were applied. After incubation, the sections were washed and mounted using a DAPI-containing immunofluorescence mounting medium (Beyotime Biotechnology, China). For single immunofluorescence staining, after overnight incubation with the first primary antibody (NeuN, Abcam, AB177487, 1:200, UK), the sections were washed and incubated with the corresponding fluorescent secondary antibody, followed by additional washing and mounting under a coverslip. Fluorescent images of the stained sections were captured using a fluorescence upright microscope (Zeiss, Germany).
Immunofluorescence images were acquired using the same magnification and exposure time for all samples. Regions of interest (ROI) were selected around the TBI injury site and surrounding areas. Data analysis was performed using ImageJ software.
TUNEL Staining
TUNEL (Terminal deoxynucleotidyl transferase dUTP nick-end labeling) staining was performed to assess neuronal apoptosis in brain tissue following TBI. A double-labeling procedure was employed to specifically identify apoptotic neurons, integrating TUNEL staining with a neuronal marker (NeuN, Abcam, AB177487, 1:200, UK). After completing the embedding and sectioning of the tissue, TUNEL staining was performed using an TUNEL staining kit (Beyotime Biotechnology, China) according to the manufacturer’s protocol. The sections were first permeabilized with 0.1% Triton X-100 for 20 min, followed by blocking with an immunofluorescence blocking solution for 40 min. Following the blocking step, primary antibodies (NeuN+) were incubated overnight at 4 °C. The next day, after washing with PBS, sections were incubated with fluorescent secondary antibodies. Subsequently, the tissue sections were incubated with TUNEL reaction mixture containing terminal deoxynucleotidyl transferase (TdT) and CY3-labeled dUTP in a humidified chamber at 37 °C for 1 h. Finally, sections were mounted with a mounting medium containing DAPI for nuclear counterstaining. Staining results were photographed by immunofluorescence microscopy (Zeiss, Germany).
DMC Target Prediction
The two-dimensional configuration of DMC was sourced from the PubChem database and analyzed using Swiss Target Prediction to predict potential targets.
TBI Target Screening
TBI-related targets were identified by querying the OMIM database and combined with GeneCards database to create a database of potential TBI targets.
PPI Network
Possible DMC targets were evaluated with Cytoscape to create a protein–protein interaction (PPI) network, aiding in the recognition of important target interactions.
GO and KEGG Enrichment Analysis
GO and KEGG pathway enrichment evaluations were conducted with DMC and TBI target databases to guide further research.
Statistical Analysis
All experiments were conducted with a minimum of three independent replicates (N ≥ 3). Data are reported as mean ± standard deviation. The experimental data underwent analysis utilizing SPSS 27.0.1 and GraphPad Prism 8. Sample sizes (N) are provided in figure legends. Statistical analyses included the use of unpaired t-tests, one-way ANOVA, and two-way ANOVA, with significance levels set at p < 0.05.
Results
DMC Improves Neurological Impairment Following Traumatic Brain Injury
The Morris water maze was employed to evaluate the neuroprotective properties of DMC. Specifically, we investigated DMC’s potential protective effects on learning and memory abilities independently (Fig. 1A). To address individual differences in the mice’s activity levels, we initially assessed their swimming speed and determined that DMC treatment had no impact on this variable (Fig. 1B). Throughout the learning period, the duration of time needed to find the platform was notably reduced in the DMC-treated group in contrast to the TBI group (Fig. 1C), suggesting that DMC promotes the restoration of compromised learning abilities post-TBI. Additionally, during the memory evaluation phase, in which the platform was absent, the group receiving DMC treatment spent considerably more time in the designated target area compared to the TBI group (Fig. 1D). Moreover, there was a substantial increase in the total swimming distance and the frequency of crossing the platform in the DMC group when compared to the TBI group (Fig. 1E, F), indicating a notable enhancement in memory performance. In summary, these results indicate that DMC significantly reduces the deficits in learning and memory caused by TBI. To obtain a more precise assessment of neurological recovery, we employed the modified neurological severity score (mNSS) scale. The findings showed that the neurological improvement in mice treated with DMC was considerably greater than the spontaneous recovery seen in the TBI group. (Fig. 1G).
Fig. 1.
DMC improves motor function impairment after TBI. A. Morris Water maze results showing spatial learning and memory trajectories. The upper panel depicts learning phase trajectories, while the lower panel illustrates memory phase trajectories for Sham, TBI, and DMC groups. Lines represent paths taken by mice, highlighting group differences in cognitive performance. B. Quantitative analysis of swimming speed in the water maze. Data show no significant differences in swimming speed among the Sham, TBI, and DMC groups, indicating uniform performance across conditions. C. Line graph showing escape latency time in the water maze. Mice underwent four days of training before TBI modeling on day four, followed by three days of testing, highlighting the impact of TBI and DMC on learning. D. Quantitative analysis of time spent in the target quadrant of the water maze. Data represent the mean duration (± SD) of time that mice from the Sham, TBI, and DMC groups spent in the target quadrant, providing insights into spatial memory and learning outcomes following TBI. E. Quantitative analysis of total swimming distance in the water maze. Data are presented as mean ± SD for the Sham, TBI, and DMC groups, reflecting overall activity levels and navigation strategies during the task. F. Quantitative analysis of the number of platform crossings by mice in the water maze. Data are presented as mean ± SD for the Sham, TBI, and DMC groups, indicating differences in spatial memory performance among the experimental groups. G. Quantitative analysis of mNSS scores in mice on days one, two, and three post-TBI model establishment. Data are presented as mean ± SD for the Sham, TBI, and DMC groups, illustrating the temporal changes in neurological deficits following injury and the effects of treatment across the assessment period. H. Quantitative analysis of brain water content in mice. Data are presented as mean ± SD for the Sham, TBI, and DMC groups, providing insights into the effects of TBI and treatment on brain edema and tissue integrity. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001, ****, p ≤ 0.0001, n = 6
Cerebral edema, a critical manifestation of secondary brain injury, was also assessed. To assess whether DMC could mitigate this situation, we evaluated brain water contents by calculating the ratio of wet to dry weight of mouse brain tissues. The results showed a significant reduction in brain edema in the DMC-treated group compared to the TBI group (Fig. 1H). These results indicat that DMC reduces secondary damage and accelerates recovery post-TBI.
DMC Suppresses the Activation of BV2 Microglia and the Production of Inflammatory Markers in vitro
To investigate the mechanism by which DMC alleviates TBI symptoms, we employed a BV2 microglial cell line as an in vitro model. Lipopolysaccharide (LPS) was used to simulate the inflammatory response associated with TBI. We first assessed the cytotoxicity of LPS and DMC using a CCK-8 assay to determine the appropriate drug concentrations. A series of LPS concentrations of 0 ng/ml, 100 ng/ml, 500 ng/ml, and 1 μg/ml was evaluated. A significant reduction in BV2 cell viability was observed at 500 ng/ml LPS (Fig. 2A), leading us to select 100 ng/ml as the optimal LPS concentration for subsequent experiments. Likewise, drawing from previous research, we determined 50 μmol/L to be the ideal concentration of DMC (Fig. 2B). Next, we evaluated the effects of DMC on BV2 cells under LPS stimulation. To confirm that any effects noted were not a result of chemical interactions between LPS and DMC, we conducted tests with varying concentrations of DMC alongside 100 ng/ml of LPS. In the end, we opted for 100 ng/ml of LPS and 50 μmol/L of DMC for the LPS + DMC group (Fig. 2C). Morphological changes in BV2 cells were then observed. Resting microglia exhibited a pike or spindle-shaped morphology with long processes (Fig. 2D). Upon LPS stimulation, BV2 cells displayed characteristic activation, with enlarged cell bodies and shorter, more numerous protrusions, resembling an amoeboid shape as indicated by the red arrow in the figure (Fig. 2E). Notably, DMC treatment attenuated these LPS-induced morphological changes, reducing microglial activation (Fig. 2F). We additionally evaluated the impact of DMC on the levels of inflammatory markers through ELISA. The cell culture supernatants were gathered, and the findings revealed that DMC notably decreased the levels of the pro-inflammatory cytokine IL-1β (Fig. 2G). The results suggest that DMC successfully suppresses the activation of BV2 cells induced by LPS in vitro and mitigates the inflammatory reaction initiated by LPS.
Fig. 2.
DMC alleviates LPS-induced activation and inflammatory responses in BV2 microglia in vitro. A. CCK8 assay conducted in the BV2 cell line to determine the safe concentration of LPS. The data demonstrate the cell viability in response to varying concentrations of LPS, establishing a threshold for subsequent experiments. B. CCK8 assay conducted in the BV2 cell line to determine the safe concentration of DMC. The results indicate cell viability across a range of DMC concentrations, establishing a safety threshold for further experimental use. C. CCK8 assay conducted in the BV2 cell line to evaluate the effects of different concentrations of DMC combined with 100 ng LPS. This experiment aims to exclude potential chemical interactions between DMC and LPS that could influence cell viability results. D. Representative images of control BV2 cells. These images provide a visual reference for cellular morphology and characteristics in the absence of treatment. E. Representative images of BV2 cells in the LPS treatment group. Red arrows indicate activated microglia, highlighting the morphological changes associated with inflammation. F. Representative images of BV2 cells in the LPS + DMC treatment group. Red arrows indicate activated microglia, demonstrating the morphological changes and activation status in response to combined LPS and DMC treatment. G. ELISA assay conducted on supernatants from BV2 cells to quantitatively analyze IL-1β levels, aimed at verifying the anti-inflammatory effects of DMC. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001, ****, p ≤ 0.0001, n = 3
DMC Attenuates Microglial Activation and the Production of Inflammatory Markers in vivo
Expanding upon the results obtained in cell culture, we proceeded to investigate the impact of DMC on microglial activation in vivo. To systematically evaluate DMC’s role in attenuating TBI and its impact on microglial activation, we first performed hematoxylin and eosin (HE) staining. We preliminarily assessed the extent of hemorrhage following injury by measuring the area of red blood cells in representative images. The results demonstrated that compared with TBI group, DMC significantly reduced hemorrhage post-TBI (Fig. 3A, B) and promoted tissue recovery. After TBI, nuclear clumping, disintegration, and nucleolus breakdown—characteristic indicators of cellular demise—were commonly observed, resulting in a significant decrease in cell count within the damaged region (Fig. 3A). These results indicate that DMC has a considerable protective role against tissue impairment caused by TBI. We then performed immunohistochemical evaluations to examine microglial activation using the marker Iba-1. Measuring the number of Iba-1-positive cells showed a significant rise in microglial activity following TBI (Fig. 3C, D). DMC treatment markedly lowered the count of Iba-1-positive cells in comparison to untreated TBI mice (Fig. 3C, D), indicating that DMC effectively suppresses microglial activation after TBI. To further corroborate these findings, we performed immunofluorescence staining. The results from immunofluorescence were consistent with the immunohistochemistry findings showing that DMC substantially decreased the levels of markers linked to microglial activation (Fig. 3E, F). In addition, qRT-PCR was employed to assess whether DMC exhibits the same anti-inflammatory effects in vivo as those observed in vitro. The elevated expression levels of NF-κB, IL-1β and TNF-α mRNA levels observed post-TBI were significantly attenuated following DMC administration (Fig. 3H-J). Additionally, brain tissue was extracted from the mice, and ELISA analysis revealed a marked reduction in the elevated levels of TNF-α induced by TBI following DMC treatment (Fig. 3K). These findings strongly indicate that DMC suppresses microglial activation, thereby mitigating the brain tissue damage caused by TBI and reducing the associated inflammatory response.
Fig. 3.
DMC ameliorates microglial activation and inflammatory responses after TBI in vivo. A. H&E staining of mouse brain tissue. The upper section shows images at 2.5 × magnification, while the lower section displays images at 10 × magnification, including a 40 × magnified image in the lower right corner. Red arrows indicate areas of brain tissue hemorrhage, highlighting the pathological changes associated with the experimental treatment. B. Statistical analysis of red blood cell area based on representative HE staining images, reflecting the impact of TBI and DMC treatment on hemorrhage. C. Representative immunohistochemistry images of Iba-1+ microglia in mouse brain tissue from Sham, TBI, and DMC groups. These images illustrate the activation and morphological changes of microglia in response to TBI and treatment with DMC. D. Quantitative analysis of the number of microglia based on representative immunohistochemistry images. This analysis counts the number of Iba-1+ microglia in mouse brain tissue across different experimental groups, providing insights into the effects of DMC treatment on microglial activation and inflammation. E. Representative immunofluorescence images of TREM2 and Iba-1+ co-staining in mouse brain tissue from Sham, TBI, and DMC groups. F. Statistical analysis of Iba-1+ cell numbers based on representative immunofluorescence images. G Statistical analysis of Trem2 numbers based on representative immunofluorescence images. H and J. Statistical analysis of qRT-PCR results for IL-1β, NF-κB and TNF-α expression in mouse brain tissue. This analysis evaluates the expression levels of these inflammatory markers to assess the anti-inflammatory effects of DMC in vivo. K. ELISA assay conducted on mouse brain tissue samples to quantitatively analyze TNF-α levels, aimed at verifying the in vivo anti-inflammatory effects of DMC. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001, ****, p ≤ 0.0001, A-G, n = 3, H–K, n = 4
DMC Modulates TREM2 Receptor Expression in Microglia
We hypothesized that DMC not only regulates microglial function but also influences the expression of TREM2 receptors. In order to examine this hypothesis, we methodically assessed the impact of DMC on TREM2 levels post TBI through Western blotting and immunofluorescence co-staining. Western blotting results revealed a significant upregulation of TREM2 protein expression post-TBI (Fig. 4A, B), indicating that TREM2 has a crucial function in the inflammatory reaction triggered by TBI. Conversely, DMC treatment significantly reduced TREM2 expression levels (Fig. 4A, B), indicating that DMC effectively inhibits TBI-induced overexpression of TREM2. These results offer initial support that DMC could potentially have neuroprotective properties in the context of TBI by reducing the levels of TREM2 expression. To further confirm whether TREM2 expression is specifically localized to microglia, we performed immunofluorescence co-staining. The findings revealed a notable rise in the co-localization of TREM2 with the microglial marker Iba-1 after TBI (Fig. 3E), indicating that TREM2 is primarily found in microglia. The following immunofluorescence co-staining analysis demonstrated that DMC treatment notably decreased the co-localization of TREM2 in microglia (Fig. 3E, G), confirming the Western blot results and further reinforcing the role of DMC in regulating TREM2 on microglia expression. These findings indicate that DMC not only lowers the total levels of TREM2 on microglia but also efficiently prevents its activation in microglia, thus reducing the inflammatory response initiated by TBI. In summary, DMC significantly reduces TREM2 expression following TBI, particularly within microglia. These findings suggest that DMC may exert neuroprotective effects and mitigate TBI-induced neuroinflammation by inhibiting the overexpression of TREM2 in microglia. Nevertheless, the molecular processes involved in the specific relationship between DMC and TREM2 receptors on microglia require additional exploration.
Fig. 4.
DMC reduces the elevated expression of TREM2 after TBI. A. Western blot analysis of TREM2 protein levels in mouse brain tissue, comparing Sham, TBI, Vehicle, and DMC groups. This experiment assesses the expression of TREM2 to evaluate its role in the inflammatory response and the effects of DMC treatment following TBI. B. Statistical analysis of TREM2 protein levels based on Western blot data from mouse brain tissue. C. Representative images of Nissl staining in mouse brain tissue from Sham, TBI, and DMC groups. This staining technique highlights neuronal morphology and viability, providing insights into the effects of TBI and DMC treatment on neuronal health and integrity. D. Statistical analysis of Nissl positive cell numbers based on representative images from mouse brain tissue. E. Immunofluorescence staining of NeuN+ in mouse brain tissue from Sham, TBI, and DMC groups. The images demonstrate neuronal integrity and distribution, with the rightmost section providing a detailed magnification of the stained neurons. This staining highlights the impact of TBI and DMC treatment on neuronal preservation and morphology. F. Statistical analysis of neuronal numbers based on representative immunofluorescence images of NeuN staining in mouse brain tissue. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001, ****, p ≤ 0.0001, A-B, n = 4,C-F, n = 3
DMC Ameliorates TBI-Induced Neuronal Apoptosis
We systematically evaluated the effects of DMC on TBI-induced neuronal apoptosis through Nissl staining and immunofluorescence staining. The findings revealed a notable decline in neuronal count after TBI, with injured neurons displaying cytoplasmic shrinkage and a significant decrease in Nissl bodies (Fig. 4C, D). Nevertheless, DMC administration markedly elevated neuronal counts, and the restoration of Nissl bodies was substantially improved (Fig. 4C, D), suggesting that DMC provides neuroprotection by mitigating neuronal injury resulting from TBI. Further immunofluorescence staining for NeuN + confirmed these findings. Neuronal marker expression was significantly diminished after TBI, suggesting substantial neuronal loss (Fig. 4E, F). Nonetheless, the administration of DMC led to a notable elevation in NeuN + levels (Fig. 4 E, F), and the survival of neurons showed a significant enhancement in the DMC-treated group when compared to the TBI group, thus reinforcing the neuroprotective efficacy of DMC. To further explore the impact of DMC on cell apoptosis, especially neuronal apoptosis. We assessed the protein expression levels of apoptosis-related markers Bax and Bcl-2 and performed TUNEL staining in conjunction with neuronal double staining. The results from Western blot demonstrated a significant increase in the pro-apoptotic Bax protein level after TBI, which was notably decreased following DMC treatment in contrast, the anti-apoptotic Bcl-2 protein level showed a significant decline after TBI, but DMC treatment significantly restored its expression (Fig. 5 A, B). To provide a more comprehensive evaluation of DMC’s effect on apoptosis, we calculated the Bax/Bcl-2 ratio. The ratio was significantly higher in the TBI group compared to the control group (Fig. 5 C), indicating an increase in apoptosis. After DMC treatment, the Bax/Bcl-2 ratio significantly decreased (Fig. 5 C), suggesting that DMC mitigated the TBI-induced increase in apoptosis. We then further investigate the effect of DMC on neuronal cell apoptosis, we performed neuronal TUNEL fluorescence co-staining. The findings from TUNEL and neuronal double labeling indicated a significant rise in the number of TUNEL-positive cells, as well as co-localization of TUNEL with neuronal markers following TBI (Fig. 5 D, E), suggesting a marked increase in neuronal apoptosis after injury. However, following DMC treatment, there was a substantial reduction in the number of TUNEL-positive neurons compared to the TBI group (Fig. 5 D, E). In summary, DMC significantly reduces cell apoptosis following TBI, particularly neuronal apoptosis. These results collectively demonstrate that DMC exerts a neuroprotective effect, likely by mitigating TBI-induced neuronal injury.
Fig. 5.
DMC alleviated cell apoptosis induced by TBI, particularly neuronal apoptosis. A. Western blot analysis of Bax protein levels in mouse brain tissue, comparing Sham, TBI, Vehicle, and DMC groups. This experiment evaluates the expression of the pro-apoptotic protein Bax to assess its role in cellular apoptosis and the effects of DMC treatment following TBI. B. Western blot analysis of Bcl-2 protein levels in mouse brain tissue, comparing Sham, TBI, Vehicle, and DMC groups. This experiment assesses the expression of the anti-apoptotic protein Bcl-2 to evaluate its role in cellular apoptosis and the effects of DMC treatment following TBI. C. Statistical analysis of the ratio of pro-apoptotic protein Bax to anti-apoptotic protein Bcl-2 in mouse brain tissue, comparing Sham, TBI, Vehicle, and DMC groups. D. Immunofluorescence double staining of NeuN and TUNEL was performed on mouse brain tissue from Sham, TBI, and DMC groups. The images illustrate neuronal cell apoptosis, with the rightmost panel showing the co-localization of neurons and TUNEL, where co-localized cells appear yellow. This staining highlights the effects of TBI and DMC treatment on neuronal apoptosis. E. Statistical analysis of the ratio of neurons double-positive for TUNEL and NeuN to NeuN-positive cells based on representative immunofluorescence images of mouse brain tissue. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001, A-C, n = 4, D-E, n = 3
DMC Exerts its Effects through the TREM2/PI3K/AKT/NF-κB Pathway
In order to investigate the underlying molecular mechanism through which DMC mitigates TBI, we utilized a network pharmacology strategy to anticipate the mode of action of DMC. First, potential DMC targets were predicted using the Swiss Target Prediction tool based on the 2D and 3D structures of DMC (Fig. 6A-B). The potential targets of DMC were mapped and visualized using Cytoscape software (Fig. 6C). Initially, data from the OMIM TBI database and the GeneCards TBI database were integrated, resulting in the identification of 3,401 potential TBI-related targets (Fig. 6D). The potential TBI-related targets were integrated and cross-referenced with the predicted molecular targets of DMC, followed by cross-analysis. The analysis identified 55 interrelated targets (Fig. 6E). PPI results revealed that targets such as Csf1r, Pik3cg, and Casp7 held central positions within the network (Fig. 6F). Following this, we conducted GO and KEGG enrichment analyses on the 55 identified genes. GO analysis indicates that DMC is involved in key biological processes related to TBI, such as inflammatory responses and microglial activation (Fig. 6G). KEGG enrichment analysis suggests that the effects of DMC on TBI may be mediated through the PI3K/AKT pathway (Fig. 6H). Western blotting analysis offered further support, revealing that the total protein levels of AKT, PI3K, and NF-κB were consistent across the Sham, TBI, and DMC-treated groups (Fig. 7A). The phosphorylated form of AKT, PI3K, and NF-κB, along with IL-1β, showed a significant increase following TBI, indicating their activation after TBI. Crucially, DMC administration notably lowered the concentrations of these phosphorylated proteins and IL-1β (Fig. 7A-E). Alongside the observations related to TREM2, these outcomes indicate that DMC hinders TBI-induced activation of crucial signaling pathways. This appears to occur mainly by reducing TREM2 expression and inhibiting the phosphorylation of AKT, PI3K, and NF-κB, thereby alleviating the excessive activation of inflammatory pathways. The concomitant reduction in IL-1β levels further supports the anti-inflammatory role of DMC.
Fig. 6.
Network pharmacology study of the interaction targets between TBI and the drug DMC. A-B. 2D and 3D structure diagrams of DMC obtained from PubChem. C. DMC's 2D structure diagram imported into the Swiss Target Prediction website, followed by target data visualization in Cytoscape. In the diagram, green nodes represent the drug DMC, while purple nodes indicate its predicted target proteins. D. Database search for “traumatic brain injury” conducted using OMMI and GeneCards, yielding a total of 3,001 disease targets. E. Intersection analysis of 3,001 TBI targets with 100 DMC action targets, resulting in the identification of 55 overlapping gene targets. F. Protein–protein interaction (PPI) network representation of the 55 overlapping targets identified from the intersection of TBI and DMC action targets. G. GO analysis of associated biological functions. H. KEGG pathway enrichment analysis of relevant pathways
Fig. 7.
DMC inhibits the phosphorylation of the PI3K/AKT/NF-κB signaling pathway and reduces the elevated IL-1β protein levels after TBI. A. Western blot analysis of mouse brain tissue from Sham, TBI, Vehicle, and DMC groups, measuring the protein expression levels of phosphorylated-PI3K, total-PI3K, phosphorylated-NF-κB, total-NF-κB, phosphorylated-AKT, total-AKT, and IL-1β. B. Statistical analysis of the protein ratio of phosphorylated-PI3K to total-PI3K in mouse brain tissue from Sham, TBI, Vehicle, and DMC groups. C. Statistical analysis of the protein ratio of phosphorylated-NF-κB to total-NF-κB in mouse brain tissue from Sham, TBI, Vehicle, and DMC groups. D. Statistical analysis of the protein ratio of phosphorylated-AKT to total-AKT in mouse brain tissue from Sham, TBI, Vehicle, and DMC groups. E. Statistical analysis of IL-1β protein levels in mouse brain tissue from Sham, TBI, Vehicle, and DMC groups. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001, ****, p ≤ 0.0001, n = 4
To summarize, DMC substantially reduces inflammatory responses and abnormal activation of signaling pathways induced by TBI. This effect is achieved by lowering the expression levels of TREM2, NF-κB, and IL-1β, as well as inhibiting the phosphorylation of AKT, PI3K, and NF-κB within the TBI model. These results establish an important experimental basis for considering DMC as a potential treatment for TBI, underscoring its crucial function in regulating essential inflammatory signaling pathways.
Discussion
TBI initiates a series of subsequent injury mechanisms, such as cerebral swelling, immune response, programmed cell death, and oxidative stress, which are the main factors leading to enduring neurological impairment in individuals with TBI [8]. Within these, neuroinflammation assumes a pivotal function in subsequent injury [38]. Pathologic process of secondary injury begins with the stimulation of the CNS’s internal immune system after TBI, engaging different categories of glial cells and intricate exchanges among signal molecules and inflammatory agents. These occurrences ultimately disturb the equilibrium of the CNS. As the CNS’s inherent immune cells, microglia act as the primary defense mechanism post-injury and assume a vital function in the response to TBI [15]. Nevertheless, the role of microglia in neuroinflammation is multifaceted [11, 39]. While they generate factors that protect neurons, clear away dead cell fragments, and facilitate neural restoration, their excessive activation leads to the secretion of inflammatory cytokines and harmful agents, hindering neurological recuperation, worsening inflammation, and prolonging the progression of the condition [40]. Given this dual role, the regulation of microglial activation may emerge as a pivotal therapeutic target in the treatment of TBI. In our study, it was shown that DMC notably decreased the excessive activation of microglia and lowered the levels of inflammatory molecules like IL-1β in both animal and cell culture models.
Neuronal damage following TBI is a key factor contributing to long-term neurological dysfunction and additional brain tissue damage. Among the various pathophysiological alterations that take place after TBI, calcium overload, oxidative stress, and neuroinflammation all exacerbate neuronal apoptosis, thereby worsening the injury [8]. Given that neuronal apoptosis following TBI is closely associated with further damage and prolonged brain dysfunction, it represents one of the factors contributing to the slow recovery of neurological functions post-injury [41]. In our study, as observed in previous research, we observed marked neuronal loss and apoptosis following TBI, which was associated with substantial deficits in learning and memory functions. However, following DMC treatment, neuronal apoptosis was considerably reduced, and there was a noticeable improvement in the previously compromised neurological functions. These findings suggest that DMC serves not only as an anti-inflammatory agent but also possesses the potential to promote neurorepair, thus improving the neurological deficits caused by TBI.
TREM2 playing a critical role in regulating microglial function during neuroinflammation. However, existing studies have shown that TREM2 expression is not limited to microglia, but also occurs in astrocytes [42], and it can also regulate neuronal metabolic adaptability, controlling the role of neurons during development [43]. Studies in various TBI models have shown that TREM2 expression is closely associated with microglia-mediated neuroinflammatory responses. TREM2-deficient mice exhibit significantly improved neurological recovery after TBI compared to wild-type mice, accompanied by a reduction in the overactivation of microglia and the release of pro-inflammatory cytokines [24]. Furthermore, the TREM2 agonist COG1410 has been shown to alleviate neuroinflammation and inhibit neuronal apoptosis by activating the Akt/CREB/BDNF signaling pathway [22]. And the study has revealed that TREM2 expression reaches its peak on the third day post-TBI and is predominantly localized to microglia. These findings underscore the protective function of TREM2 in TBI, especially regarding microglia-mediated inflammation. In the absence of TREM2, neuroinflammation escalates significantly, leading to more severe neuronal damage. Conversely, the activation of TREM2 helps alleviate excessive neuroinflammation and neuronal injury [22–24].
In our study, we observed that DMC treatment alleviated the neuroinflammation, functional deficits, and neuronal apoptosis induced by TBI. However, the expression of TREM2 was significantly reduced compared to the TBI-alone group, which seems to contradict the previously established protective role of TREM2 in TBI. The role of TREM2 is, however, quite intricate. Some studies have shown that TREM2-deficient mice exhibit distinct neuropathological features in tau-related neurodegenerative diseases, including less brain atrophy, diminished microglial activation, and reduced tau hyperphosphorylation and synaptic damage [44]. The function of TREM2 may differ at various stages of injury. During the early stages of TBI, TREM2 activation likely contributes to the suppression of unnecessary inflammatory responses and promotes tissue repair, while in the recovery phase, TREM2 may aid neuronal recovery by promoting macrophage repair functions [45]. Although our results suggest that the downregulation of TREM2 contradicts its generally recognized protective role in TBI, the decrease in TREM2 expression following DMC treatment may not necessarily reflect suppression by DMC. Instead, it could represent a result of the complex mechanisms governing TREM2. Additionally, the dosage and duration of the treatment could also be critical factors affecting TREM2 signaling. We noted that DMC effectively mitigated the overactivation of microglia and reduced neuroinflammation, suggesting that the DMC-induced downregulation of TREM2 may help prevent the excessive activation of microglia and reduce the long-term burden of neuroinflammation. This possible effect deserves further exploration.
In summary, this study thoroughly investigates the potential of DMC in the treatment of TBI. Our results indicate DMC effectively suppressed excessive activation of microglia, reduced neuroinflammation, decreased neuronal apoptosis, and enhanced learning and memory deficits caused by TBI in both in vitro and in vivo experiments. Additionally, through a combination of network pharmacology and experimental validation, our findings suggest that DMC may exert its neuroprotective effects by modulating the TREM2/PI3K/AKT/NF-κB signaling pathways. This study presents novel therapeutic targets and mechanisms for TBI treatment, offering promising strategies for future clinical applications.
Nonetheless, our research has certain limitations. We have solely explored the impacts of DMC on microglia and have not explored its effects on other cell types, such as astrocytes. Additionally, we have only validated the relationship between TREM2 and microglia, despite growing evidence indicating that TREM2 also has a regulatory role in astrocytes and neurons. It is well-known that both microglia and TREM2 operate through intricate mechanisms. The precise mechanism by which DMC induces the downregulation of TREM2 expression remains ambiguous, and whether this effect is mediated by the modulation of microglial polarization-leading to changes in TREM2 expression-represents another important question that needs to be addressed in future studies.
Summary
In summary, our study indicates that DMC significantly enhances neurological recovery after TBI by influencing microglial activation, decreasing neuronal apoptosis, and demonstrating considerable anti-inflammatory and neuroprotective properties. Furthermore, DMC effectively revitalizes learning and memory capabilities. Mechanistically, it appears that DMC mitigates neuroinflammation through the modulation of the TREM2/PI3K/AKT/NF-κB pathway, pointing to its promise as a therapeutic option for TBI. These results underscore the promising clinical applications of DMC in treating TBI, providing new optimism for improving patient outcomes and overall quality of life.
Acknowledgements
We thank all the team members and students of the Translational Research Institute for Neurological Disorders, Department of Neurosurgery, the First Affiliated Hospital of Wannan Medical College (Yijishan Hospital of Wannan Medical College) for their help on this project.
Abbreviations
- DMC
4,4’-Dimethoxychalcone
- TBI
Traumatic Brain Injury
- CNS
Central Nervous System
- TREM2
Triggering Receptor Expressed on Myeloid Cells 2
- PI3K
Phosphoinositide 3-Kinase
- AKT
Protein Kinase B
- NF-κB
Nuclear Factor kappa-light-chain-enhancer of activated B cells
- GO
Gene Ontology
- KEGG
Kyoto Encyclopedia of Genes and Genomes
- MWM
Morris Water Maze
- mNSS
Modified Neurological Severity Score
- ELISA
Enzyme-Linked Immunosorbent Assay
- qRT-PCR
Quantitative Real-Time Polymerase Chain Reaction
- HE
Hematoxylin and Eosin (staining)
- PPI
Protein-Protein Interaction
- FPI
Fluid Percussion Injury
- CCK-8
Cell Counting Kit-8 (used for cell viability assays)
- BSA
Bovine Serum Albumin
- PVDF
Polyvinylidene Difluoride
- DAPI
4’,6-Diamidino-2-phenylindole
- NeuN
Neuronal Nuclei
- IBA1
Ionized calcium-binding adapter molecule 1 (a microglial marker)
- DMSO
Dimethyl Sulfoxide
- TUNEL
Terminal deoxynucleotidyl transferase dUTP nick-end labelling
- Bax
Bcl-2-associated X protein
- Bcl-2
B-cell lymphoma 2
Author Contribution
Mengran Wang: Writing-original draft, Methodology, Investigation, Data curation, Formal analysis, Validation, Visualization. Rui Zhao: Data curation, Software, Formal analysis. Yue Su: Data curation, Software, Formal analysis. Duhuan Zhai: Data curation, Formal analysis. Hengyan Liang: Data curation, Formal analysis. Lingkun Zhang: Data curation, Formal analysis. Weicheng Wang: Data curation, Formal analysis. Zhichun Wang: Methodology, Funding acquisition. Min Qi: Methodology, Resources. Xiaochun Jiang: Resources, Conceptualization, Funding acquisition, Supervision. Shizhang Ling: Writing – review & editing, Resources, Conceptualization, Supervision. Guangfu Di: Writing – review & editing, Resources, Funding acquisition, Conceptualization, Supervision. All authors reviewed and approved the manuscript.
Funding
This study was funded by the Peak Training Program for Scientific Research of Yijishan Hospital (Guangfu Di, grant number: GF2019G01 and KPF2019003), the Talent Introduction Foundation of Yijishan Hospital (Guangfu Di, grant number: YR202112), 2022 Anhui University Research Program Projects (Xiaochun Jiang, grant number: 2022AH010073), 2022 Wannan Medical College University-level Research Programs (Zhichun Wang, grant number: WK2022F34).
Data Availability
No datasets were generated or analysed during the current study.
Declarations
Ethics Approval and Consent to Participate
The protocols for animal experiments procedures were approved by the Medical Ethics Committee of Wannan Medical College (Approval WNMC-AWE-2024132). The care and experiments were conducted in strict accordance with the National Institutes of Health guidelines.
Conflict of Interests
The authors declare no competing interests.
Clinical Trial Number
Not applicable.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Xiaochun Jiang, Email: jiangxiaochun2019@hotmail.com.
Shizhang Ling, Email: sling@wnmc.edu.cn.
Guangfu Di, Email: wuhusjwk@163.com.
References
- 1.Wilson, L., W. Stewart, K. Dams-O’Connor, R. Diaz-Arrastia, L. Horton, D.K. Menon, and S. Polinder. 2017. The chronic and evolving neurological consequences of traumatic brain injury. Lancet Neurology 16: 813–825. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Yang, C., L. Lang, Z. He, J. Hui, J. Jiang, G. Gao, and J. Feng. 2022. Epidemiological characteristics of older patients with traumatic brain injury in China. Journal of Neurotrauma 39: 850–859. [DOI] [PubMed] [Google Scholar]
- 3.Raja, I.A., A.H. Vohra, and M. Ahmed. 2001. Neurotrauma in Pakistan. World Journal of Surgery 25: 1230–1237. [DOI] [PubMed] [Google Scholar]
- 4.Morganti-Kossmann, M.C., B.D. Semple, S.C. Hellewell, N. Bye, and J.M. Ziebell. 2019. The complexity of neuroinflammation consequent to traumatic brain injury: From research evidence to potential treatments. Acta Neuropathologica 137: 731–755. [DOI] [PubMed] [Google Scholar]
- 5.Maas, A.I.R., D.K. Menon, P.D. Adelson, N. Andelic, M.J. Bell, A. Belli, P. Bragge, A. Brazinova, A. Büki, R.M. Chesnut, et al. 2017. Traumatic brain injury: Integrated approaches to improve prevention, clinical care, and research. Lancet Neurology 16: 987–1048. [DOI] [PubMed] [Google Scholar]
- 6.Thapa, K., H. Khan, T.G. Singh, and A. Kaur. 2021. Traumatic brain injury: mechanistic insight on pathophysiology and potential therapeutic targets. Journal of Molecular Neuroscience 71: 1725–1742. [DOI] [PubMed] [Google Scholar]
- 7.Kaur, P., and S. Sharma. 2018. Recent advances in pathophysiology of traumatic brain injury. Current Neuropharmacology 16: 1224–1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Freire, M.A.M., G.S. Rocha, L.O. Bittencourt, D. Falcao, R.R. Lima, and J. Cavalcanti. 2023. Cellular and molecular pathophysiology of traumatic brain injury: What have we learned so far? Biology 12: 1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Jarrahi, A., M. Braun, M. Ahluwalia, R.V. Gupta, M. Wilson, S. Munie, P. Ahluwalia, J.R. Vender, F.L. Vale, K.M. Dhandapani, et al. 2020. Revisiting traumatic brain injury: From molecular mechanisms to therapeutic interventions. Biomedicines 8: 389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Algattas, H., and J.H. Huang. 2013. Traumatic Brain Injury pathophysiology and treatments: Early, intermediate, and late phases post-injury. International Journal of Molecular Sciences 15: 309–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Theus, M.H. 2024. Neuroinflammation and acquired traumatic CNS injury: A mini review. Frontiers in Neurology 15: 1334847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Simon, D.W., M.J. McGeachy, H. Bayır, R.S. Clark, D.J. Loane, and P.M. Kochanek. 2017. The far-reaching scope of neuroinflammation after traumatic brain injury. Nature Reviews. Neurology 13: 171–191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhao, Z., A.R. Nelson, C. Betsholtz, and B.V. Zlokovic. 2015. Establishment and dysfunction of the blood-brain barrier. Cell 163: 1064–1078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Loane, D.J., and A. Kumar. 2016. Microglia in the TBI brain: The good, the bad, and the dysregulated. Experimental Neurology 275 (Pt 3): 316–327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kumar, A., and D.J. Loane. 2012. Neuroinflammation after traumatic brain injury: Opportunities for therapeutic intervention. Brain, Behavior, and Immunity 26: 1191–1201. [DOI] [PubMed] [Google Scholar]
- 16.Ransohoff, R.M., and V.H. Perry. 2009. Microglial physiology: Unique stimuli, specialized responses. Annual Review of Immunology 27: 119–145. [DOI] [PubMed] [Google Scholar]
- 17.Witcher, K.G., C.E. Bray, T. Chunchai, F. Zhao, S.M. O’Neil, A.J. Gordillo, W.A. Campbell, D.B. McKim, X. Liu, J.E. Dziabis, et al. 2021. Traumatic brain injury causes chronic cortical inflammation and neuronal dysfunction mediated by microglia. The Journal of Neuroscience : The official Journal of the Society for Neuroscience 41: 1597–1616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Burda, J.E., and M.V. Sofroniew. 2014. Reactive gliosis and the multicellular response to CNS damage and disease. Neuron 81: 229–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Garden, G.A., and T. Möller. 2006. Microglia biology in health and disease. Journal of Neuroimmune Pharmacology: The Official Journal of the Society on NeuroImmune Pharmacology 1: 127–137. [DOI] [PubMed] [Google Scholar]
- 20.Kober, D.L., and T.J. Brett. 2017. TREM2-Ligand Interactions in Health and Disease. Journal of Molecular Biology 429: 1607–1629. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Deczkowska, A., A. Weiner, and I. Amit. 2020. The physiology, pathology, and potential therapeutic applications of the TREM2 signaling pathway. Cell 181: 1207–1217. [DOI] [PubMed] [Google Scholar]
- 22.Yan, J., Y. Zhang, L. Wang, Z. Li, S. Tang, Y. Wang, N. Gu, X. Sun, and L. Li. 2022. TREM2 activation alleviates neural damage via Akt/CREB/BDNF signalling after traumatic brain injury in mice. Journal of Neuroinflammation 19: 289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li, Z., S. Yu, L. Li, C. Zhou, L. Wang, S. Tang, N. Gu, Z. Zhang, Z. Huang, H. Chen, et al. 2024. TREM2 alleviates white matter injury after traumatic brain injury in mice might be mediated by regulation of DHCR24/LXR pathway in microglia. Clinical and Translational Medicine 14: e1665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Cao, C., J. Ding, D. Cao, B. Li, J. Wu, X. Li, H. Li, G. Cui, H. Shen, and G. Chen. 2022. TREM2 modulates neuroinflammation with elevated IRAK3 expression and plays a neuroprotective role after experimental SAH in rats. Neurobiology of Disease 171: 105809. [DOI] [PubMed] [Google Scholar]
- 25.Kawabori, M., R. Kacimi, T. Kauppinen, C. Calosing, J.Y. Kim, C.L. Hsieh, M.C. Nakamura, and M.A. Yenari. 2015. Triggering receptor expressed on myeloid cells 2 (TREM2) deficiency attenuates phagocytic activities of microglia and exacerbates ischemic damage in experimental stroke. The Journal of Neuroscience: The Official Journal of the Society for Neuroscience 35: 3384–3396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Lee, C.Y.D., A. Daggett, X. Gu, L.L. Jiang, P. Langfelder, X. Li, N. Wang, Y. Zhao, C.S. Park, Y. Cooper, et al. 2018. Elevated TREM2 gene dosage reprograms microglia responsivity and ameliorates pathological phenotypes in alzheimer’s disease models. Neuron 97: 1032-1048.e1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ulrich, J.D., T.K. Ulland, M. Colonna, and D.M. Holtzman. 2017. Elucidating the role of TREM2 in Alzheimer’s disease. Neuron 94: 237–248. [DOI] [PubMed] [Google Scholar]
- 28.Chen, S., J. Peng, P. Sherchan, Y. Ma, S. Xiang, F. Yan, H. Zhao, Y. Jiang, N. Wang, J.H. Zhang, et al. 2020. TREM2 activation attenuates neuroinflammation and neuronal apoptosis via PI3K/Akt pathway after intracerebral hemorrhage in mice. Journal of neuroinflammation 17: 168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Scarano, A., M. Chieppa, and A. Santino. 2018. Looking at flavonoid biodiversity in horticultural crops: A colored mine with nutritional benefits. Plants (Basel, Switzerland) 7: 98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Nabavi, S.M., D. Šamec, M. Tomczyk, L. Milella, D. Russo, S. Habtemariam, I. Suntar, L. Rastrelli, M. Daglia, J. Xiao, et al. 2020. Flavonoid biosynthetic pathways in plants: Versatile targets for metabolic engineering. Biotechnology Advances 38: 107316. [DOI] [PubMed] [Google Scholar]
- 31.Gong, J., W. Zhang, L. Ding, M. Zhang, S. Zheng, R. Ma, J. Tang, W. Yi, H. Xu, and Y. Zhang. 2021. 4,4’-Dimethoxychalcone regulates redox homeostasis by targeting riboflavin metabolism in Parkinson’s disease therapy. Free Radical Biology & Medicine 174: 40–56. [DOI] [PubMed] [Google Scholar]
- 32.Zhang, W., H. Chen, L. Ding, J. Gong, M. Zhang, W. Guo, P. Xu, S. Li, and Y. Zhang. 2021. Trojan Horse Delivery of 4,4’-Dimethoxychalcone for Parkinsonian neuroprotection. Advanced science (Weinheim, Baden-Wurttemberg, Germany) 8: 2004555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yang, C., T. Wang, Y. Zhao, X. Meng, W. Ding, Q. Wang, C. Liu, and H. Deng. 2022. Flavonoid 4,4’-dimethoxychalcone induced ferroptosis in cancer cells by synergistically activating Keap1/Nrf2/HMOX1 pathway and inhibiting FECH. Free Radical Biology & Medicine 188: 14–23. [DOI] [PubMed] [Google Scholar]
- 34.Wang, T., C. Yang, Z. Li, T. Li, R. Zhang, Y. Zhao, T. Cheng, Z. Zong, Y. Ma, D. Zhang, et al. 2024. Flavonoid 4,4’-dimethoxychalcone selectively eliminates senescent cells via activating ferritinophagy. Redox Biology 69: 103017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Brown, G.C., and J.J. Neher. 2014. Microglial phagocytosis of live neurons. Nature Reviews Neuroscience 15: 209–216. [DOI] [PubMed] [Google Scholar]
- 36.Ma, X., A. Aravind, B.J. Pfister, N. Chandra, and J. Haorah. 2019. Animal models of traumatic brain injury and assessment of injury severity. Molecular Neurobiology 56: 5332–5345. [DOI] [PubMed] [Google Scholar]
- 37.Schmidt, R.H., and M.S. Grady. 1993. Regional patterns of blood-brain barrier breakdown following central and lateral fluid percussion injury in rodents. Journal of Neurotrauma 10: 415–430. [DOI] [PubMed] [Google Scholar]
- 38.Woodcock, T., and M.C. Morganti-Kossmann. 2013. The role of markers of inflammation in traumatic brain injury. Frontiers in Neurology 4: 18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Cherry, J.D., J.A. Olschowka, and M.K. O’Banion. 2014. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. Journal of neuroinflammation 11: 98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Jassam, Y.N., S. Izzy, M. Whalen, D.B. McGavern, and J. El Khoury. 2017. Neuroimmunology of traumatic brain injury: Time for a paradigm shift. Neuron 95: 1246–1265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Akamatsu, Y., and K.A. Hanafy. 2020. Cell death and recovery in traumatic brain injury. Neurotherapeutics: The Journal of the American Society for Experimental NeuroTherapeutics 17: 446–456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wang, C., J. Dong, H. Huang, K. Zhou, Z. Liu, R. Milner, and L. Li. 2024. Astrocyte-TREM2 alleviates brain injury by regulating reactive astrocyte states following ischemic stroke. Glia 72: 2061–2078. [DOI] [PubMed] [Google Scholar]
- 43.Tagliatti, E., G. Desiato, S. Mancinelli, M. Bizzotto, M.C. Gagliani, E. Faggiani, R. Hernández-Soto, A. Cugurra, P. Poliseno, M. Miotto, et al. 2024. Trem2 expression in microglia is required to maintain normal neuronal bioenergetics during development. Immunity 57: 86-105.e109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Leyns, C.E.G., J.D. Ulrich, M.B. Finn, F.R. Stewart, L.J. Koscal, J. Remolina Serrano, G.O. Robinson, E. Anderson, M. Colonna, and D.M. Holtzman. 2017. TREM2 deficiency attenuates neuroinflammation and protects against neurodegeneration in a mouse model of tauopathy. Proceedings of the National Academy of Sciences 114: 11524–11529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Saber, M., O. Kokiko-Cochran, S.S. Puntambekar, J.D. Lathia, and B.T. Lamb. 2017. Triggering receptor expressed on myeloid cells 2 deficiency alters acute macrophage distribution and improves recovery after traumatic brain injury. Journal of Neurotrauma 34: 423–435. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
No datasets were generated or analysed during the current study.







