The Protective Effects of Vanillic Acid on LPS-induced Acute Lung Injury by Inhibiting STIM1-mediated NLRP3 Inflammasome Activation

Abstract

Acute lung injury (ALI), which can progress to acute respiratory distress syndrome (ARDS), has inflammation as a crucial factor, especially the NOD-like receptor thermal protein domain associated protein 3 (NLRP3) inflammasome involvement. Stromal interaction molecule 1 (STIM1) can block NLRP3 activation, but the mechanism is unclear. Vanillic acid, possessing anti-inflammatory properties, has a role in acute lung injury (ALI) whose specific mechanism remains unclear. This study aimed to investigate the effectiveness of vanillic acid in ALI induced by lipopolysaccharides (LPS) and to elucidate the potential mechanisms. In vitro and in vivo experiments were conducted using cells and a mouse model to find out the impact and underlying mechanisms. We found that vanillic acid demonstrated significant inhibition of IL-1β and IL-18 release triggered by LPS and nigericin in J774A.1 cells. The in vivo findings indicated that vanillic acid not only mitigated acute lung injury but also suppressed NLRP3 inflammasome activation in mice. Mechanistically, vanillic acid inhibited the LPS-induced increase in STIM1 expression through the lysosomal degradation pathway. The reduced STIM1 expression diminished intracellular Ca²⁺ levels, thereby suppressing inflammasome activation and impeding the cleavage and maturation of Caspase-1 and GSDMD, and eventually attenuating cell pyroptosis. Vanillic acid exerts its inhibitory effects on NLRP3 inflammasome activation by promoting STIM1 degradation, thereby ameliorates ALI through impeding NLRP3-GSDMD mediated pyroptosis. The STIM1-NLRP3 signaling axis represents a promising avenue for potential therapeutic interventions in ALI.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-025-02293-6.

Introduction

Acute Lung Injury (ALI) manifested as an extensive inflammatory reaction and tissue damage in the lungs, resulting in impaired respiratory function. And in severe instances, it can evolve into acute respiratory distress syndrome (ARDS). The incidence of ALI/ARDS exhibits significant regional and population heterogeneity. Studies have shown that the incidence of ALI/ARDS is significantly elevated in high-risk patient populations, such as those with sepsis, pneumonia, and trauma, with ARDS accounting for approximately 10% of patients in intensive care units (ICUs) [1]. To date, no breakthrough has been achieved in the development of targeted pharmacological therapies for ALI/ARDS, and the mortality rate remains high at 30% to 40% [2]. ALI is usually triggered by infection, trauma, burns, exposure to drugs or chemicals, circulatory disorders, or immune system abnormalities [3]. Multifactorial interactions are involved in the development of ALI, among which the inflammatory response plays a crucial role [4]. Macrophages, crucial constituents of the innate immune system, play a pivotal role in modulating the inflammatory response. In ALI, over-activated macrophages release a large amount of diverse pro-inflammatory mediators including cytokines (such as TNF-α and interleukins), chemokines, prostaglandins et al., to eradicate infection and mitigate inflammation. Overactivation of macrophages results in the disproportionate release of inflammatory agents, leading to a cytokine storm and further exacerbating lung injury [5]. Therefore, there is an urgent need to further elucidate the mechanism of macrophage overactivation in order to develop new therapeutic strategies for ALI.

The inflammasome family member NOD-like receptor thermal protein domain-associated protein 3 (NLRP3) inflammasome, an intracellular heterogeneous complex, consists of three main components: NLRP3, along with apoptosis-associated speck-like protein containing a CARD domain (ASC) which acts as an adaptor protein, and the cysteine protease known as Caspase-1 [6]. Activation of the NLRP3 inflammasome is mainly initiated by damage-associated molecular patterns (DAMPs) or pathogen-associated molecular patterns (PAMPs), coupled with a second signal, which can involve the changes of intracellular calcium signal, the efflux of potassium, the generation of reactive oxygen species (ROS) or mitochondrial uncoupling [7, 8]. Upon assembly, the complete NLRP3 inflammasome triggers autocleavage to activate pro-caspase-1, leading to the formation of Gasdermin D (GSDMD)-mediated inflammatory cell death known as pyroptosis [9]. Research indicates that overactivated NLRP3 inflammasome leads to augmented release of active IL-1β and IL-18, facilitating the infiltration and activation of inflammatory cells, further exacerbating inflammation and lung damage. Pyroptosis-mediated inflammatory cascades lead to the disruption of the alveolar-capillary barrier, resulting in pulmonary edema and respiratory failure [10]. Consequently, targeting the NLRP3 inflammasome for inhibition or regulatory modulation presents a viable approach to mitigate inflammatory responses and reduce the severity of pulmonary damage [11].

Vanillic acid, a natural organic compound present in an array of plant species, exhibits anti-inflammatory, anti-oxidant, and anti-carcinogenic characteristics. Vanillic acid significantly inhibits the inflammatory response in lipopolysaccharide (LPS)-induced mouse peritoneal macrophages and alleviates hydrogen peroxide (H₂O₂)-induced cellular damage by modulating mitophagy. Furthermore, vanillic acid exhibits a pronounced inhibitory effect on the proliferation of human colon cancer HCT116 cells [12–14]. However, its role and mechanism in lipopolysaccharide (LPS)-induced ALI are still unexplored. Hence, this research seeks to evaluate the influence of vanillic acid on ALI and to elucidate the mechanisms associated with the inhibition of the NLRP3 inflammasome activiation.

Materials and Methods

Reagents and Antibodies

Vanillic acid (purity ≥ 98%, ST02000120) and resveratrol (purity ≥ 98%, ST00670120) were obtained from Shanghai Standard Technology Co., Ltd. (Shanghai, China). ExCell Bio (Shanghai, China) provided Fetal Bovine Serum (FBS). Selleck Chemicals (Houston, US) provided LPS (L4391) and Nigericin (S6653). Hoechst 33,342 (C1025) and Fluo-4 (S1060) were purchased from Beyotime (Shanghai, China).

Primary antibodies used in this study were: anti-ASC (Abcam, ab283684), anti-NLRP3 (Cell Signaling Technology, 15,101), anti-Caspase-1 (Proteintech, 22,915–1-AP), anti-IL-1β (Cell Signaling Technology, 12,242), anti-GSDMD (Cell Signaling Technology, 39,754), anti-ATF4 (Cell Signaling Technology, 11,815), anti-STIM1 (Cell Signaling Technology, 39754), anti-CHOP (Cell Signaling Technology, 2895), and anti-β-Actin (Beyotime, AF0003).

Animals and Materials

Male C57BL/6 mice, aged 8 weeks and with an average weight of 20 g, were acquired from SLAC Laboratory Animal Co., Ltd. based in Shanghai, China. Mice were kept under regulated conditions with a stable temperature maintained at 25 ± 1 °C. They were provided with unlimited access to sterilized water and food, and experienced a consistent 12-h light/dark cycle within their housing facility. The experiment procedures involving mice were performed in accordance with the guidelines delineated in the National Institutes of Health’s “Guide for the Care and Use of Laboratory Animals.” The Shanghai Medical Experimental Animal Ethics Committee at Fudan University provided ethical approval for the protocols employed in this study (license number: 2022–07-YL-WHB-84, license date: 2022.07.08).

Cell Culture and in vitro Treatment

J774A.1 cells, provided by the Academy of Sciences Cell Bank (Shanghai, China), were incubated in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and a 1 × concentration of penicillin–streptomycin. Concurrently, THP-1 cells, also cultured under suitable conditions, were grown in RPMI 1640 medium enriched with 10% FBS and 1 × penicillin–streptomycin. For differentiation induction, phorbol 12-myristate 13-acetate (PMA, 100 nM) was used to treat THP-1 cells for 24 h prior to experimental assays.

RNA-seq

PMA induced THP-1 cells were treated with vanillic acid for 1 h. Subsequently, the cells were stimulated with LPS (1 μg/ml)) for 4 h and subsequently incubated with 10 μM nigericin for an additional hour. Genes differential expression analysis was performed by DESeq2 software between two different groups (and by edgeR between two samples). The genes with the parameter of false discovery rate (FDR) below 0.05 and absolute fold change ≥ 2 were considered differentially expressed genes. Differentially expressed genes were then subjected to enrichment analysis of GO functions, KEGG pathways, Reactome gene set and DO database.

Cell Viability and ELISA

CCK-8 assay kit (Beyotime, China, C0038) was used to assess cell viability. The concentrations of IL-1β and IL-18 in the cell culture supernatant were quantified using specific ELISA kits. ELISA kits used in this study were: Mouse IL-1β Precoated ELISA Kit (Dakewe, Beijing, China, 1210122), Mouse IL-18 ELISA Kit (Genie, MOES01225).

Real-Time Quantitative PCR

Total RNA was extracted by TRIzol reagent (Invitrogen, California, USA), and reversely transcripted using Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR (Yeasen, Shanghai, China, 11123ES60). Subsequently, real-time PCR was performed employing SYBR Green Master Mix (Yeasen, Shanghai, China, 11201ES08) to amplify the cDNA and quantify gene expression levels.

All primers used in the experiments were designed based on murine sequences. Sequences prepared by Genepharma (Shanghai, China) are described below:

IL-6	(F) ACAAGTCGGAGGCTTAATTACACAT (R) TTGCCATTGCACAACTCTTTTC
IL-1β	(F) TCGCTCAGGGTCACAAGAAA (R) CATCAGAGGCAAGGAGGAAAA
TNF-α	(F) AGGCTGCCCCGACTACGT (R) GACTTTCTCCTGGTATGAGATAGCAAA
IL-18	(F) GCCATGTCAGAAGACTCTTGCGTC (R) GTACAGTGAAGTCGGCCAAAGTTGTC
STIM1	(F) TGGATGAGGAGATTGTCGCC (R) GACTCCGAATCGGAATGGGTCA
β-actin	(F) CTGTCCCTGTATGCCTCTG (R)ATGTCACGCACGATTTCC

Western Blotting

The lysates prepared from J774A.1 and THP-1 cells with RIPA buffer (Beyotime, Shanghai, China) were subjected to centrifugation at 2000 g and 4 °C for 15 min. Protein quantification of each sample was conducted using the BCA protein assay kit (Thermo Scientific, Massachusetts, United States) to ensure equal loading of the groups. After separation of the different samples by gel electrophoresis, the distinct samples were transferred onto Millipore nitrocellulose membranes (Massachusetts, United States). Subsequent to a 1-h blocking period at room temperature with 5% skimmed milk (Biosharp, Beijing, China), the proteins were reacted with primary antibodies at 4 °C overnight, followed by the treatment of horseradish peroxidase-conjugated secondary antibodies for 1 h. Protein bands were imaged after enhanced chemiluminescence (ECL) treatment, and quantified by Image J software. The results were normalized against the internal control protein β-actin.

Immunofluorescence Confocal Microscopy

Immunostaining was performed to study the assembling of ASC specks. THP-1 cells seeded onto coverslips were subjected to the indicated treatments. Following fixation in 4% paraformaldehyde, cells were subjected to permeabilization with 0.1% Triton X-100 (Sigma-Aldrich) for a duration of 5 min, and blockage with 10% goat serum for one hour, and then, ASC antibody was added. After overnight reaction at 4 °C, the cells were exposed to a goat anti-rabbit secondary antibody for 1 h at ambient temperature. After three subsequent washes, nuclei were stained with DAPI, and cellular imaging was conducted employing a Zeiss confocal microscope.

Small Interfering RNA (siRNA) Transfection

STIM1-targeting siRNA was supplied by RiboBio (Guangzhou, China). The siRNA sequences are listed as: CTGGTGGTGTCTATCGTTA. The siRNA was transfected into cells using Lipofectamine RNAiMAX (Invitrogen, California, USA) in accordance with the manufacturer’s recommendations.

Establishment of LPS-induced ALI Model in Mice

Five groups of mice (n = 6) were randomly assigned: Sham surgery, LPS stimulation (LPS 3 mg/kg, model), LPS + VA (30 or 60 mg/kg), and LPS + RSV (60 mg/kg). Based on the classic LPS-induced acute lung injury (ALI) mouse model [15], Mice were subjected to modeling by intratracheal instillation with LPS, and normal saline (NS, sham surgery group) for Sham surgery. Two hours after surgery, the sham surgery group and model groups were intragastrically administered with vehicle, or different doses of vanillic acid. RSV served as a positive control [16]. All mice were euthanized 24 h after treatment.

Collection and Measurement of Bronchoalveolar Lavage Fluid (BALF)

After treatment, bronchoalveolar lavage fluid (BALF) was collected from the left lung of euthanized mice via tracheal cannulation, followed by centrifugation at 800 g for 15 min. The supernatant was harvested and the concentrations of proteins were quantified utilizing a BCA protein assay kit. The preserved BALF at −80 °C was subjected to subsequent ELISA analyses for the concentrations of IL-1β and IL-18.

Statistical Analysis

GraphPad Prism software (version 9) was utilized for statistical analyses. Quantitative data are presented as mean ± standard deviation (SD). Unless otherwise specified, the data herein are derived from a minimum of three independent experiments. Group comparisons were performed using one-way analysis of variance (ANOVA), followed by Bonferroni’s post hoc test for detailed pairwise comparisons. A p-value less than 0.05 was defined as statistically significant.

Results

Vanillic Acid can Attenuate LPS-induced Macrophage Inflammatory Response and Improve ALI in Mice

To investigate the effects of vanillic acid (Fig. 1A) on the NLRP3 inflammasome, J774A.1 cells were used. The results from CCK8 showed that vanillic acid did not affect cell viability at concentrations up to 100 μM/L (Fig. 1B). By RT-qPCR, our findings indicate that vanillic acid reduced the expression of LPS-stimulated IL-1β and IL-6 mRNA, while had no significant effect on TNF-α and IL-18 levels (Fig. 1C, D). To substantiate the anti-inflammatory properties of vanillic acid in vivo, an acute lung injury mouse model was established by LPS intratracheal instillation. After LPS instillation, the mice exhibited symptoms such as tremors, piloerection, and inactivity. However, mice in the groups treated with vanillic acid or the positive drug (resveratrol) showed milder symptoms, indicating a significant anti-inflammatory activity of vanillic acid in vivo. Bronchoalveolar lavage fluid (BALF) collected from the mice 24 h after modelling. The protein concentration within the BALF served as an indicator of vascular permeability and the degree of pulmonary inflammation [17]. Our results revealed that vanillic acid reduced the protein content in the BALF of mice experiencing acute lung injury (Fig. 1E). Instillation of LPS resulted in an elevated wet-to-dry lung weight ratio, signifying increased pulmonary edema severity. This effect was markedly ameliorated following treatment with vanillic acid (Fig. 1F). Additionally, HE staining validated the incidence of lung injury. The instillation of LPS was associated with alveolar wall thickening, inflammatory cell infiltration, and expansion of the interstitial space, all indicative of pulmonary damage. These phenomena were markedly ameliorated by vanillic acid and the positive drug, as evidenced by a decrease in the lung injury score (Fig. 1G, H). We also discovered that vanillic acid can reduce the levels of IL-1β and IL-18 in the BALF (Fig. 1I, J).

Fig. 1.

Vanillic acid inhibited inflammatory response in J774A.1 cells and improved ALI in mice. (A) The chemical structure of vanillic acid is presented. (B) The viability of J774A.1 cells was assessed after treatment with varying doses of vanillic acid for 24 h using the Cell Counting Kit-8 (CCK-8). (C, D) The TNF-α, IL-6, IL-18 and IL-1β mRNA levels in J774A.1 cells after 6 h of Vanillic acid treatment, n = 3. (E) Protein in BALF from LPS-induced ALI mice without or with Vanillic acid (VA) treatment was quantified using the BCA assay, n = 6. (F) Dry–wet ratio of mouse lungs 24 h after LPS modeling. (G, H) Representative H&E images (G) and injury analysis (H) of lung tissues. Scale bar: 200 μm. (I, J) IL-1β and IL-18 levels in BALF from LPS-induced ALI mice without or with VA treatment was quantified by ELISA kits. Each experiment was repeated at least three times. Data are expressed as the mean ± SD. Significance markers indicate *p < 0.05, **p < 0.01, ***p < 0.001 when compared with the model group, and ^##p < 0.01, ^###p < 0.001 in relation to the control group

DEGs were Enriched in the NLRP3 and Ca²⁺Signaling Pathways After VA Treatment

RNA-seq was used to analyze PMA-induced THP1 cells. Six samples (three in each group) were analyzed by RNA-seq. Compared with LPS group, there were lots of both up-regulated genes and down-regulated genes LPS + VA group (Fig. 2A). Reactome enrichment analysis of DEGs showed that Ca²⁺ and NLRP3 signal ranked high (Fig. 2B). GO analysis results show that, positive regulation of NLRP3 inflammasome complex assembly and autophagosome assembly in biology procress ranked high and had a large number of related genes (Fig. 2C and D). KEGG pathway enrichment analysis showed that the NOD-like receptor signaling pathway was one of the signaling pathways with a large number of enriched genes (Fig. 2E). The results of DO analysis showed that DEG was enriched in various inflammatory diseases and lung diseases (Fig. 2F).

Fig. 2.

RNA-seq analysis showed that DEGs were enriched in the NLRP3 and Ca²⁺ signaling pathways. (A) Volcano plot of DEGs between LPS and LPS + VA groups. (B) Cycle diagram of Reactome pathway analysis. (C, D) The enriched WEGO percent and GO items of DEGs in the biological process, molecular function and cellular components. (E) Enriched KEGG pathway of DEGs in bubble chart. (F) Cycle diagram of DO pathway analysis

Vanillic Acid Can Inhibit NLRP3 Inflammasome Activation Both in vitro and in vivo

Whereas the results of RNA-seq showed that DEGs were enriched in the NLRP3 and Ca²⁺ signaling pathways after VA treatment. We verified this both in vitro and in vivo. The data from ELISA showed that vanillic acid effectively suppressed the release of IL-1β and IL-18 from J774A.1 cells stimulated by LPS and nigericin (Fig. 3A). Immunoblot analysis demonstrated a remarkable increase in the release of maturated IL-1β (p17) and active caspase-1 (p20) into the supernatant of J774A.1 cells upon dual stimulation with nigericin and LPS. This suggests the activation of the NLRP3 inflammasome. Administering vanillic acid led to a dose-dependent decrease in the release of mature IL-1β and the active caspase-1 p20 variant in J774A.1 cells. This effect was observed in cells stimulated with LPS and nigericin. However, the administration of vanillic acid did not influence ASC, NLRP3, pro-caspase-1 and pro-IL-1β levels in J774A.1 cell (Fig. 3B, C). In addition, IL-6, IL-1β and IL-18 mRNA expression in the lung tissue was reduced by vanillic acid (Fig. 3D), and the formation of inflammasomes in lung tissue was also inhibited (Fig. 3E, F).

Fig. 3.

Vanillic acid inhibited NLRP3 inflammasome activation. (A) The concentration of IL-1β and IL-18 in the culture medium of J774A.1 cells pretreated with vanillic acid for 1 h, followed by additional 1ug/ml LPS stimulation for 4 h and 10 μM nigericin stimulation for 1 h, n = 3. (B, C) J774A.1 cells were pre-incubated with vanillic acid for 1 h, followed by the stimulation of 1 μg/ml LPS for 4 h and 10 μM nigericin for 1 h. The culture supernatant and cell lysate were collected and were subjected to immunoblotting using specific antibodies. (D) Relative mRNA levels of IL-6, IL-1β and IL-18 in mouse lung tissues 24 h after induction. (E, F) Levels of inflammasome-related proteins in lung tissues. Each experiment was repeated at least three times. Data are expressed as the mean ± SD. Significance markers indicate **p < 0.01, ***p < 0.001 when compared with the model group, and ^#p < 0.05, ^###p < 0.001 in relation to the control group

Vanillic Acid Impeded Pyroptosis and ASC Speck Formation Caused by NLRP3 Inflammasome Activation in Macrophages

Upon activation, the NLRP3 inflammasome triggers caspase-1 activation, which subsequently mediates the conversion of gasdermin D (GSDMD) into its active N-terminal segment, ultimately leading to cell membrane perforation. As a result, the cell membrane swells, leading to pyroptosis [18]. The influence of vanillic acid on nigericin-induced pyroptosis in LPS-stimulated J774A.1 cells was examined. Western blot analysis showed that nigericin-stimulation promoted the cleavage activation of GSDMD in LPS-primed J774A.1 cells, which could be significantly inhibited by vanillic acid treatment (Fig. 4A, B). The difference between pyroptosis and apoptosis lies in the swollen cell membrane [19]. Under a light microscope, the J774A.1 cell membrane continued to swell until it ruptured and died. Nonetheless, cells treated with vanillic acid exhibited a notable dose-dependent decrease in the incidence of cell membrane swelling (Fig. 4C). Cell death by pyroptosis can be assessed by PI staining. As shown in Fig. 4D and E, PI staining was significantly reduced by vanillic acid treatment in J774A.1 cells, indicating a decrease of the nigericin-induced pyroptosis. The activation of Caspase-1 caused by inflammasomes necessitates the involvement of the adaptor protein known as apoptosis-associated speck-like protein containing a caspase recruitment domain (CARD), abbreviated as ASC. When the inflammasome is activated, ASC assembles to form a large protein complex known as "speck", which is critical for activating the NLRP3 inflammasome [20]. Interestingly, the formation of ASC speck was nearly imperceptible in cells stimulated solely by LPS. Approximately 55% of J774A.1 cells formed ASC spots after nigericin stimulation. While, Vanillic acid markedly diminished the ASC spots induced by nigericin (Fig. 4F, G). The findings imply that vanillic acid has the capacity to suppress macrophage pyroptosis and the NLRP3 inflammasome-induced formation of ASC specks.

Fig. 4.

Vanillic acid impedes pyroptosis and ASC speck formation caused by NLRP3 inflammasome activation in macrophages. (A, B) J774A.1 cells were pre-treated with vanillic acid for 1 h before the stimulation induced by LPS (1 μg/ml) for 4 h and nigericin (10 μM) for 1 h. The cell lysate was extracted and subjected to immunoblotting using specific antibodies. (C) J774A.1 cells underwent pre-treatment with vanillic acid for a duration of 1 h, subsequently stimulated with LPS (1 μg/ml) for 4 h, and then with nigericin (10 μM) for 1 h. Changes in cell morphology were monitored using light microscopy. Scale bar: 200 μm. (D, E) All nuclei were determined using Hoechst 33,342 staining, and cell death was detected using PI staining. The scale bar is 200 μm. The pyroptosis ratio was used to count PI-positive cells in in six areas selected at random. (F, G) ASC immunostaining was performed on J774A.1 cells, with a scale bar representation of 40 μm. Quantification of ASC speck formation involved comparing the prevalence of cells with ASC specks to the aggregate cell count across six sites chosen at random. Data are reported as the mean ± SD. Each experiment was repeated at least three times. Levels of statistical significance were denoted as *p < 0.05; **p < 0.01; ***p < 0.001 relative to the model group; ^#p < 0.05, ^###p < 0.001, when contrasted with the control group

Vanillic Acid Inhibited Endoplasmic Reticulum Stress by Downregulated STIM1 Expression Through the Lysosomal Degradation Pathway

Intracellular calcium concentration has been associated with the activation of inflammasomes [21]. A key role in maintaining intracellular calcium balance is played by the endoplasmic reticulum (ER). Therefore, we investigated the expression of ER stress-associated proteins in response to LPS stimulation. Immunoblot analysis revealed that vanillic acid reduced the upregulation of p-eIF2, ATF4, and CHOP proteins induced by LPS stimulation (Fig. 5A, B). Fluo-4 AM calcium ion fluorescent probe revealed a significant increase in intracellular calcium levels upon LPS stimulation, which could be decreased by vanillic acid treatment (Fig. 5C). Furthermore, immunoblot analysis showed that LPS upregulated the phosphorylation of calcium-regulated kinases (p-CaMK), which could be reduced by vanillic acid (Fig. 3D). STIM1 is an important ER calcium sensor in immune cells [22]. We then explored the involvement of STIM1 in regulating intracellular calcium concentration under LPS stimulation. Our research demonstrated that stimulation with LPS significantly augmented the protein expression of STIM1, an effect that was mitigated by treatment with vanillic acid (Fig. 5D, E). However, no significant changes were found in STIM1 mRNA level (Fig. 5F).

Fig. 5.

Vanillic acid reduces the level of STIM1 and intracellular Ca²⁺, and inhibits endoplasmic reticulum stress-related pathways. (A, B) J774A.1 cells were pre-treated with VA for 1 h, after the 6 h stimulation induced by LPS (1 μg/ml). The cell lysate was extracted and subjected to immunoblotting using specific antibodies. (C) Intracellular Ca²⁺ levels post stimulation with 1000 ng/ml LPS for 6 h were measured utilizing the Fluo-4 AM kit. Representative images are provided with scale bars of 100 μm and 10 μm, respectively. (D, E) Cells were pre-incubated with vanillic acid for 1 h prior to stimulation with 1000 ng/ml LPS for a duration of 6 h. Post-stimulation, immunoblotting analyses were conducted on the cellular lysates using targeted antibodies. (F) Total RNA extracted from the cells stimulated with 1000 ng/ml LPS stimulation for 6 h were used for RT-qPCR analysis. (G) Prior to LPS stimulation (1 μg/ml) for 6 h, J774A.1 cells underwent a 1-h pre-treatment with the inhibitors MG132 and BafA1. Cellular lysates were harvested and analyzed via immunoblotting employing antibodies specific to the proteins of interest. Each experiment was repeated at least three times. Data are expressed as the mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001 when contrasted with the model group; ^##p < 0.01, ^###p < 0.001 in comparison to the control group

To investigate the underlying mechanism through which vanillic acid reduces STIM1 protein levels, the proteasome inhibitor MG132 and the lysosome inhibitor Baf A1 were used. Immunoblot analysis showed that vanillic acid inhibited the upregulation of STIM1 induced by LPS stimulation, and this was reversed by the lysosome inhibitor Baf A1. Furthermore, it was discovered that stimulation with LPS upregulated the levels of the autophagy markers LC3II and P62. This suggests that LPS stimulation can initiate autophagy, but the progression of the autophagic process appears to be hindered. In contrast, treatment with vanillic acid reduced the levels of LC3II and P62, and the addition of the lysosomal inhibitor Baf A1 was able to reverse this effect. Vanillic acid seems to impede the onset of autophagy while simultaneously promoting the amalgamation of autophagosomes and lysosomes, culminating in the degradative phase of the autophagic process (Fig. 5G). Based on the aforementioned findings, it is hypothesized that vanillic acid reduces the level of STIM1 by promoting its autophagic degradation. This, in turn, diminishes the intracellular Ca²⁺ concentration, further inhibiting the activation of the inflammasome.

Knockdown of STIM1 Exhibited the Similar Effects with Vanillic Acid on Inflammasome Activation

To ascertain the potential involvement of STIM1 in the activation of the NLRP3 inflammasome, STIM1 expression was silenced in THP-1 cells. As shown in Fig. 6A and B, vanillic acid treatment remarkably inhibited the increase of STIM1 as well as ER stress marker ATF4 and CHOP induced by LPS. Similarly, STIM1 knockdown also inhibited the upregulation of ATF4, but significantly increased the level of CHOP, suggesting ER stress-related signaling pathways other than ATF4 was affected by STIM1 siRNA (Fig. 6A, B). Importantly, immunoblot analysis indicated that the downregulation of STIM1 diminished the secretion of mature IL-1β and active Caspase-1 induced by nigericin, as well as the cleavage of GSDMD, in the context of LPS priming. Fascinatingly, it was observed that the suppressive action of vanillic acid on mature IL-1β, active caspase-1, and the cleavage of GSDMD was nullified when STIM1 siRNA was applied (Fig. 6C-F). Notably, the knockdown of STIM1 led to a decrease in pro-IL-1β protein levels, which warrants further investigation.

Fig. 6.

Knockdown of STIM1 exhibited the similar effects with vanillic acid on inflammasome activation. (A, B) THP-1 cells, post-transfection with either negative control siRNA or STIM1 siRNA, received an incubation treatment with the specified concentration of vanillic acid for 1 h. This was followed by 6 h exposure to LPS (1 μg/ml). Upon completion, cell lysates were harvested for subsequent immunoblotting using the designated antibodies. (C-F) Following transfection with either negative control siRNA or STIM1 siRNA, THP-1 cells were treated with vanillic acid at the indicated dosage for 1 h. Subsequently, the cells were stimulated with LPS (1 μg/ml) for 4 h and subsequently incubated with 10 μM nigericin for an additional hour. Both the culture supernatant and the cell lysate were then collected and prepared for western blot analysis using the specified antibodies. Experiments were performed using a sample size of at least n = 3. Results are reported as the mean ± SD. **p < 0.01; ***p < 0.001 compared to the model group

Vanillic Acid Inhibited Endoplasmic Reticulum Stress in ALI Mouse Lung Tissue Through STIM1 Signaling Pathway

Immunoblot analysis revealed an increase in STIM1 expression in the lungs of mice following LPS instillation, which was reduced by vanillic acid treatment (Fig. 7A). The RT-PCR results also confirmed the inhibitory effect of vanillic acid on the upregulation of STIM1 mRNA in the lungs of LPS-induced mice (Fig. 7B). Furthermore, immunofluorescence results confirmed that vanillic acid reduced STIM1 and ATF4 levels in the lungs of mice receiving intratracheal LPS instillation (Fig. 7C, D). As a result, vanillic acid showed effectively protect mice from acute lung injury induced by LPS.

Fig. 7.

Vanillic acid inhibited STIM1-NLRP3 signaling in the lungs of mice with acute lung injury. (A, B) Lung tissue is ground for protein extraction, followed by immunoblotting with specified antibodies. (C) The relative mRNA levels of STIM1 in lung were measured. (D-E) Immunofluorescence staining was employed to assess the concentrations of STIM1 and ATF4 within lung macrophages across different groups. Scale bar: 100 μm. Each experiment was repeated at least three times. Data are expressed as the mean ± SD. ***p < 0.001 relative to the model group; ^###p < 0.001, when contrasted with the control group

Discussion

The NLRP3 inflammasome primarily orchestrates the regulation of inflammatory responses. Numerous diseases share a close association with the excessive immunological activation of the NLRP3 inflammasome, encompassing conditions such as inflammatory bowel disease, sepsis, rheumatoid arthritis and certain disorders of the central nervous system [23]. Dysregulation of NLRP3 inflammasome activity precipitates the overproduction of pro-inflammatory cytokines and subsequently caused tissue damage. Evidence suggests that vanillic acid possesses anti-inflammatory attributes. Our findings are consistent with those of previous studies, demonstrating that vanillic acid exerts significant anti-inflammatory effects by reducing the secretion of pro-inflammatory factors, such as IL-1β [24]. Although there are differences in disease models and specific mechanisms (e.g., Huang focused on osteoarthritis [25], while our study addresses pulmonary diseases), these findings further validate the broad anti-inflammatory pharmacological properties of VA. Our research provides new experimental evidence for the therapeutic potential of VA in pulmonary diseases, such as acute lung injury, and offers theoretical support for its clinical applications. Our results indicate that the anti-inflammatory properties of vanillic acid attribute to its ability to restrain the hyperactivation of the NLRP3 inflammasome, an effect that is linked with STIM-mediated calcium signaling pathways. This suppression of NLRP3 inflammasome activity and consequent attenuation of cell pyroptosis contribute to the amelioration of pulmonary injury in mice suffering from acute lung injury (ALI).

ER stress markedly impacts the activation and modulation of the NLRP3 inflammasome [26, 27]. Under ER stress, the balance of ER calcium (Ca²⁺) is disrupted, and high levels of Ca²⁺ can activate various cellular signaling pathways such as calcium/calmodulin-dependent protein kinase (CaMK), nuclear factor kappa B (NF-κB). This sequence of events ultimately results in the amplification of cellular damage and the initiation of inflammatory reactions, thereby promoting the formation and activation of the NLRP3 inflammasome [28, 29]. Recent researches have demonstrated that the release of Ca²⁺ during ER stress serves as a potent stimulus for NLRP3 inflammasome activation [28, 29]. The assembly and activation of the NLRP3 inflammasome can be modulated through the direct interaction of Ca²⁺ with the inflammasome complex, serving as a positive regulatory mechanism. On the other hand, during periods of stress, Ca²⁺ sequestered within the ER may be translocated to the mitochondria, where it intensifies the production of ROS and inflicts damage upon mitochondrial DNA, thereby triggering inflammasome activation [27]. Our experimental results also confirmed that under LPS stimulation, cells experienced pronounced ER stress, characterized by a notable elevation in intracellular Ca²⁺ levels and an upregulation of phosphorylated calcium-regulated kinases. However, treatment with vanillic acid was able to suppress these changes.

Stromal interaction molecule 1 (STIM1) situated on the ER membrane functions as an intracellular Ca²⁺ sensor and regulates Ca²⁺ homeostasis [30]. It becomes activated and translocated to the plasma membrane to mediate the influx of extracellular Ca²⁺ into the cytoplasm during endoplasmic reticulum stress [30]. Although some study has shown that inhibition of STIM1 reduces the NLRP3 inflammasome [31], the precise mechanism remains to be elucidated. In our experimental results, we observed that vanillic acid can suppress the upregulation of STIM1 induced by LPS stimulation, and this suppression is achieved by promoting the autophagic degradation of STIM1. Furthermore, the STIM1 knockdown experiment validated the efficacy of vanillic acid. STIM1 inhibition was found to prevent Nigericin-induced caspase-1, IL-1β and GSDMD cleavage and subsequent maturation, thereby inhibiting cellular pyroptosis. While STIM1 deficiency can suppress the cleavage and maturation of caspase-1, IL-1β, and GSDMD induced by Nigericin, thereby inhibiting the occurrence of cell pyroptosis. In conclusion, the findings of our investigation underscore the inhibitory effect of vanillic acid on the activation of the NLRP3 inflammasome by means of the modulation of the STIM1-Ca²⁺-NLRP3 signaling axis (Fig. 7).

NLRP3 inflammasome activation is documented to have a substantial influence on the pathogenesis of acute lung injury [32]. ALI is a severe inflammatory lung disease characterised by tissue damage, increased permeability of alveolar walls and pulmonary capillaries, resulting in pulmonary oedema and inflammatory cell infiltration, ultimately leading to impaired oxygenation and respiratory distress [33]. Therefore, anti-inflammatory therapy is beneficial in acute lung injury, and conventional anti-inflammatory treatments include the use of corticosteroids, cytokine antagonists, and antioxidants to mitigate the inflammatory response and promote lung repair, but with limited efficacy [34]. Emerging studies propose that targeting the inhibition of NLRP3 inflammasome activation, thereby curtailing the secretion of IL-1β and other pro-inflammatory agents, could potentially surpass the effectiveness of traditional anti-inflammatory drugs [35]. Resveratrol has been demonstrated as an inhibitor of NLRP3 inflammasome activation [36], and therefore, we chose it as a positive control drug to examine the in vivo effectiveness of vanillic acid on the NLRP3 inflammasome. Based on the experimental results, we observed that intragastric administration of vanillic acid significantly alleviated lung pathology and reduced inflammatory infiltration in mice with LPS-induced acute lung injury. Consistent with the in vitro experimental results, vanillic acid notably diminished the concentration of pro-inflammatory cytokines in BALF and mitigated pulmonary inflammation. These findings provide evidence that vanillic acid may be efficacious as a therapeutic intervention in the attenuation of acute lung injury by impeding STIM1-mediated activation of the NLRP3 inflammasome (Fig. 8).

Fig. 8.

NLRP3 inflammasome activation is inhibited by vanillic acid via STIM1-Ca²⁺-NLRP3 signaling. Vanillic acid reduces the expression level of the STIM1 protein by promoting cellular autophagy. This reduction leads to a decrease in intracellular Ca²⁺ concentration, which specifically inhibits NLRP3 inflammasome activation and reduces cell pyroptosis, thereby alleviating lung injury in mice. This figure was created using Figdraw

Furthermore, vanillic acid confers a protective influence against LPS-induced acute lung injury by modulating the STIM1-regulated Ca²⁺-NLRP3 signaling pathway. Consequently, vanillic acid exhibits promise as a pharmaceutical drug or dietary supplement for the treatment of acute lung injury.

Certainly, this study has some limitations. Firstly, we primarily used the J774A.1 cell line for mechanistic exploration. Future studies could further validate the results using bone marrow-derived macrophages (BMDMs) or primary cells to enhance the generalizability and reliability of the findings. Secondly, although we included a solvent control group (e.g., DMSO) in the preliminary experiments and ruled out the influence of the solvent on the results, a dedicated drug control group was not included. Future studies will incorporate drug control groups to further exclude potential drug toxicity effects and ensure the robustness of the findings.

Conclusion

Vanillic acid demonstrates a protective role in LPS-induced acute lung injury through the inhibition of the STIM1-regulated Ca²⁺-NLRP3 axis, positioning it as a promising candidate for pharmacological intervention in the treatment of such injuries. Further studies are needed for the drug development.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

ALI

Acute lung injury

ARDS

Acute respiratory distress syndrome

ASC

Apoptosis-associated speck-like protein containing a CARD domain

BALF

Bronchoalveolar lavage fluid

CaMK

Calcium/calmodulin dependent protein kinase

DAMPs

Damage-associated molecular patterns

ER

Endoplasmic reticulum

FBS

Fetal bovine serum

GSDMD

Gasdermin D

LPS

Lipopolysaccharide

NLRP3

NOD-like receptor thermal protein domain associated protein 3

PAMPs

Pathogen-associated molecular patterns

ROS

Reactive oxygen species

RSV

Resveratrol

STIM1

Stromal interaction molecule 1

VA

Vanillic acid

Author Contributions

Xiaoyan Shen, Hao Fang, Hongbo Weng, Lei Wang, Haidong Li and Sun Xia conceptualized the project. Lei Wang, Haidong Li, Sun Xia, Jiahui Ni and Guize Feng carried out the experiment operation. Hao Fang and Xiaoyan Shen supervised the project. Lei Wang and Haidong Li wrote the original draft. Hongbo Weng and Xiaoyan Shen reviewed and edited the writing.

Funding

This research received funding support from the National Natural Science Foundation of China (No. 82272230, 81971488, 82073859). We extend our sincere gratitude for the financial assistance provided by the Natural Science Foundation of Shanghai, China (No. 22ZR1444700 for HF), the Special projects for the transformation of medical and enterprise integration innovation achievements, Shanghai Shenkang Hospital Development Center, China (No. SHDC2022CRD049 for HF) andPei You of Minhang Hospital, Fudan University (No. 2024MHPY07).

Data Availability

Data can be provided by contacting the corresponding author.

Declarations

Conflict of Interest

The authors declare no competing interests.