Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Mar 14;48(5):3529–3541. doi: 10.1007/s10753-025-02282-9

TXM-CB13 Improves the Intestinal Mucosal Barrier and Alleviates Colitis by Inhibiting the ROS/TXNIP/TRX/NLRP3 and TLR4/MyD88/NF-κB/NLRP3 Pathways

Ruijie Cao 1, Jinhui Zhou 1, Jiale Liu 1, Yaxuan Wang 1, Yandong Dai 1, Yun Jiang 1, Akira Yamauchi 2, Daphne Atlas 3, Tiancheng Jin 1, Jiedong Zhou 1, Cuixue Wang 1, Qihuan Tan 1, Yifei Chen 1, Junji Yodoi 4, Hai Tian 1,5,✉
PMCID: PMC12596331  PMID: 40085192

Abstract

The activation of inflammasomes (NLRP3 and NLRP1) is central to the pathogenesis of inflammatory bowel disease (IBD). Here we examined the protective effects of a thioredoxin-mimetic peptide CB13 (TXM-CB13), known for its antioxidative stress and anti-inflammatory properties. We examined the effects of TXM-CB13 on dextran sulfate sodium (DSS)-induced colitis and lipopolysaccharide (LPS)-induced NLRP3 inflammasome activation in RAW264.7 macrophages. TXM-CB13 appeared to alleviate symptoms of DSS-induced colitis and to significantly suppress the protein and mRNA levels of NLRP3, Mlck, and IL-1β in colonic tissues. Additionally, TXM-CB13 treatment increased the levels of the intestinal barrier proteins Occludin, ZO-1, and NLRP1, as shown through immunohistochemistry and Western blot analysis. In vitro, TXM-CB13 inhibited LPS-induced TLR4 signaling, reducing MyD88 levels and consequently attenuating the activation of the NF-κB pathways, including p-IκB-α/IκB-α and p-NF-κB-p65/NF-κB-p65. This inhibition further reduced the activation of the NLRP3 inflammasome components, NLRP3, ASC, Caspase-1, GSDMD, and IL-1β. In addition, TXM-CB13 prevented the ROS-mediated dissociation of TXNIP from TRX, inhibiting NLRP3 activation. These findings suggest that TXM-CB13 is a potential therapeutic candidate for IBD through its modulation of the TLR4/MyD88/NF-κB/NLRP3 and ROS/TXNIP/TRX/NLRP3 pathways.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-025-02282-9.

Keywords: TXM-CB13, Inflammatory bowel disease, NLRP3, TXNIP, NF-κB

Introduction

Inflammatory bowel diseases (IBDs), including Crohn's disease and ulcerative colitis, are chronic inflammatory conditions resulting from immune dysregulation in the gastrointestinal tract, although their exact etiology remains unclear. Various colitis models have been developed to explore IBD pathogenesis [1]. Recent research highlights the role of inflammasome activation in IBD, where triggers such as infection, mucosal injury, and oxidative stress activate inflammasomes, leading to the conversion of pro-interleukin (IL)−1β and pro-IL-18 into their active forms, IL-1β and IL-18 [2]. IL-1β interacts with IL-1R complexes, promoting T -cell proliferation and neutrophil migration, thereby intensifying colitis by further activating the NF-κB and MAPK pathways [3, 4].

Inflammasomes are cytoplasmic complexes involved in the immune response to microbial infections and tissue damage, with caspase-1 and IL-1β acting as downstream effectors in the NOD-like receptor protein (NLRP)3 and NLRP1 signaling pathways [5, 6]. NLRP3 and NLRP1 are implicated in colitis pathogenesis, as the activation of NLRP3 triggers the formation of the ASC speck or pyroptosome, a hallmark of inflammasome activation [7]. This pathway subsequently activates caspase-1, leading to the processing and release of GSDMD, IL-1β, and IL-18, which exacerbates inflammation [8]. Inhibiting NLRP3 expression has been shown to reduce the incidence of colitis, as NLRP3-deficient mice exhibit resistance to DSS-induced colitis [9].

Macrophages play roles in the initiation and maintenance of the acute inflammatory response. The NLRP3 inflammasome, an intracellular complex that is primarily activated in macrophages, triggers an inflammatory response during IBD [10, 11]. Moreover, the number of gram-negative bacteria increases in the intestinal epithelial lesions of IBD patients [12, 13], and LPS is released via the internalization of gram-negative bacterial outer membrane vesicles in human intestinal epithelial cells, resulting in intestinal barrier dysfunction and the initiation and aggravation of intestinal inflammation [14]. LPS released from gram-negative bacteria increases intestinal inflammation by stimulating TLR4, activating NF-κB through MyD88, and inducing the NLRP3 inflammasome [15] enhancing NLRP3 expression and inflammasome formation [16]. Additionally, an increase in reactive oxygen species (ROS), which dissociates thioredoxin-interacting proteins (TXNIP) from thioredoxin, promote the binding and the activation of NLRP3 [17]. Other compounds that activate the NLRP3 inflammasome via ROS production, highlight the role of oxidative stress in inflammasome activation [18]. The activation of NLRP3 triggers the cleavage of pro-caspase-1 into active caspase-1, which subsequently processes pro-inflammatory cytokines such as IL-1β and IL-18, contributing to inflammatory responses. Interestingly, NLRP1 has both protective and harmful effects on colitis, modulating IL-1β and IL-18 levels, and affecting the pathogenic bacterial environment in the colon [19–21].

The thioredoxin reductase/thioredoxin (TRXR/TRX) is a major cellular redox system, which in response to oxidative stress activates the mitogen-activate-proteins-kinases (MAPK) anti-inflammatory and antiapoptotic pathways. Activation occurs when oxidized TRX releases apoptosis-signal-regulating kinase 1 (ASK1), which triggers downstream MAPK signaling cascades, such as the p38MAPK and JNK pathways, leading to cell death. A family of tri- and tetra-peptides derived from the TRX-active site, and termed thioredoxin mimetic (TXM) peptides, has been shown to mimic the anti-inflammatory and antioxidative functions of TRX, effectively restoring redox balance and inflammatory induced cell death [22, 23]. TXM-CB13, has been shown to protect cognitive function after Mild Traumatic Brain Injury (mTBI) [23], and inhibit inflammatory pathways associated with high-glucose [24].

In the present study we aimed to evaluate the protective effects and mechanisms of TXM-CB13 in DSS-induced colitis in mice and LPS-induced macrophage inflammation in RAW264.7 and THP-1 cells. We focused mainly on the effects of TXM-CB13 on NLRP3 inflammasome activity during colitis progression.

Result

TXM-CB13 Treatment Alleviates DSS-induced Colitis in Mice

The chemical structure of TXM-CB13 is shown in Fig. 1A. To investigate the therapeutic effects of TXM-CB13 on mouse colitis, during the animal modeling period, the mice were divided into three groups: Water-stroke-physiological saline solution (SPSS), DSS-SPSS, and DSS-CB13 (Fig. 1B). Body weights and colon lengths were measured, which revealed that Water‒SPSS mice maintained weight gain, whereas DSS treatment led to weight loss and colon shortening. These adverse effects were significantly mitigated in the TXM-CB13 group (Fig. 1C-E). Histological analysis via H&E staining revealed that the TXM-CB13-treated colonic tissue had better glandular structure, more intact goblet cells, and showed less inflammation compare to the DSS-SPSS group (Fig. 1F), with notably lower histologic scores in the DSS-CB13 group than in the DSS-SPSS group (Fig. 1G). These findings indicate that TXM-CB13 significantly alleviates DSS-induced colitis symptoms.

Fig. 1.

Fig. 1

Open in a new tab

TXM-CB13 treatment alleviates DSS-induced colitis in mice. A The chemical structure of TXM-CB13 (Acetyl-Cys-Met-Lys-Cys-amide). TXM-CB13, derived from the canonical- C-x-x-C- motif of the TRX-active site, called the thioredoxin mimetic (TXM) peptide, reversed inflammatory and oxidative stress. B Experimental design of acute DSS-induced colitis. The mice were divided into three groups:, water-SPSS, DSS-SPSS, and DSS-TXM-CB13. Drug administration was 11 for days, and animals euthanized on the 12th day. C) Mouse weight loss was recorded daily from the 1 to11th day. The average body weight in each group was calculated and compared with that in the DSS-SPSS group, the average loss of body weight was significantly greater after nine days in the DSS-TXM-CB13 group. The values are the means ± SEMs of six mice per group, Student’s t test *p < 0.05. D, E Changes in colon length. A representative colon from each group on the 12th day is shown. D The length of the colon was measured, and the average length was analyzed. E The change in colon length was significantly larger in the TXM-CB13-treated group. The data are expressed as the means ± SEMs of six mice per group, Student’s t test (***p < 0.001). F Representative images of colon tissue stained with H&E. Compared with DSS-SPSS, TXM-CB13 suppressed the pathological progression of colon tissue, the in glandular structure, reduction in goblet cell and in neutrophil infiltration. The upper set of images was photographed by a low-power microscope (Bar, 200 µm). The lower set of images is the enlargement of the tissues in the box of the above group (100 µm). (n = 6 per group). G Histological injury scores were calculated from inflammatory cell infiltration and tissue damage data. The values are the means ± SEMs of three mice per group Student’s t test; (****p < 0.0001)

TXM-CB13 Reduces NLRP3 Inflammasome Activation and Protects the Intestinal Mucosal Epithelium

To further explore the effects of TXM-CB13 on NLRP3 inflammasome activation, qRT‒PCR and Western blot analysis revealed decreased NLRP3 RNA and protein expression levels in the DSS-CB13 group compared with those in the DSS-SPSS group (Fig. 2A, F, and M). Since the upregulation and activation of NLRP3 promote caspase-1 activation and lead to ASC recruitment, their RNA and protein expression levels were examined. TXM-CB13 inhibited the activation of caspase-1 and the recruitment of ASCs to DSS-induced colonic tissues (Fig. 2B, C, G, H, and M). Additionally, TXM-CB13 downregulated the activation of GSDMD and IL-1β (Fig. 2D, E, I, J and M). The tight junction proteins Occludin and ZO-1, which are critical for mucosal integrity, were also significantly increased in TXM-CB13-treated mice (Fig. 2N, K and O). These molecular changes were confirmed by immunohistochemistry analysis. They demonstrate that TXM-CB13 exerts a protective effect on the intestinal barrier, and reduces inflammation (Fig. 2O). Furthermore, these results indicate that TXM-CB13 inhibits the expression of NLRP3 and IL-1β in colonic tissues and increases the expression of Occludin, and ZO-1, implying an improvement in the intestinal mucosal epithelium and inflammatory response (Fig. 2O).

Fig. 2.

Fig. 2

Open in a new tab

TXM-CB13 reduced NLRP3 inflammasome activation, the expression of NLRP3 inflammasome-related factors, and the secretion of IL-1β in colonic tissues from DSS-induced mice. A–E The mRNA expression levels of NLRP3, ASC, Caspase-1, GSDMD, and IL-1βin DSS-induced colon tissues were detected via qRT‒PCR. The results revealed that the mRNA expression levels of NLRP3, ASC, Caspase-1, GSDMD, and IL-1β were significantly inhibited after TXM-CB13 treatment. The values are the means ± SEMs of six mice per group Student’s t test; ****p < 0.0001, ***p < 0.001, **p < 0.01, and *p < 0.05. F–K Densitometric analysis was used to quantify the protein expression levels of NLRP3 inflammasome activation-related proteins in colon tissue.). The values are the means ± SEMs of six mice per group. Student’s t test; ****p < 0.0001, ***p < 0.001, **p < 0.01, and *p < 0.05. M, N A Western blot analysis detecting the expression levels of NLRP3, ASC, procaspase-1, Caspase-1 (p20), GSDMD, Pro-IL-1β, and IL-1β (p17) in DSS-induced colon tissues treated with TXM-CB13. TXM-CB13 significantly decreased the activation and expression of NLRP3, the expression of ASC, Caspase-1 (p20), and IL-1β (p17); and increased the expression of Occludin. (n = 6 per group). O Immunohistochemistry detecting the expression of NLRP3, IL-1β, and Occludin in colon tissue sections. Expression of NLRP3 and IL-1β was inhibited by TXM-CB13 and Occludin. ZO-1 expression increased by TXM-CB13 (bars: 100 μm, n = 6 per group)

TXM-CB13 Promotes NLRP1 Expression in Colon Tissue and RAW264.7 Macrophages

To evaluate the impact of TXM-CB13 on NLRP1 activation, Western blotting and immunohistochemistry were employed, which revealed that DSS treatment suppressed NLRP1 expression, whereas TXM-CB13 significantly increased NLRP1 expression in colonic tissues and in LPS-stimulated RAW264.7 macrophages (Fig. 3A-D). These findings suggest that TXM-CB13 protects against colitis by promoting NLRP1 activation.

Fig. 3.

Fig. 3

Open in a new tab

TXM-CB13 promoted the expression of NLRP1 in colon tissue and RAW264.7 cells. A, B Densitometric analysis of NLRP1 expression levels in colon tissues. (A) The values are presented as the means ± SEMs of six mice per group (Student’s t test), and of macrophages. B Values are shown as the mean ± SEM of three experiments (Student’s t test). (****p < 0.0001 and **p < 0.01). C Western blot analysis of NLRP1 protein expression levels in LPS-induced RAW264.7 macrophages. NLRP1 after TXM-CB13 treatment (upper image). Western blot analysis of NLRP1 protein expression levels in DSS-induced colon tissues (lower image). D Immunohistochemistry was used to detect NLRP1 expression in colon tissue. The upper set of images was photographed with a low-power microscope (Bar, 200 µm). The lower set of images shows the enlargement of the tissues in the box of the above group (100 µm, n = 6 per group)

TXM-CB13 Inhibits IL-1β and IL-18 in LPS-Stimulated RAW264.7 Macrophages

To test whether TXM-CB13 affects inflammasome-specific cytokine expression, the RNA expression levels of IL-1β and IL-18 were measured in LPS-induced RAW264.7 macrophages via qRT‒PCR, which revealed that LPS increased the expression of both cytokines, whereas TXM-CB13 effectively reducedthe expression of both cytokines (Fig. 4B, D). Western blot analysis further confirmed that TXM-CB13 decreased the protein levels of IL-1β (p17)/Pro-IL-1β (Fig. 4A, C), highlighting its potential to suppress inflammatory cytokines.

Fig. 4.

Fig. 4

Open in a new tab

TXM-CB13 inhibited the expression of IL-1β and IL-18 in LPS-induced RAW264.7 macrophages. A Densitometric analysis of IL-1β (p17) and Pro-IL-1β in the LPS-induced RAW264.7 macrophages. The values are shown as the means ± SEMs of three experiments. Student’s t test; (**p < 0.01). B, D qRT‒PCR was used to detect the expression levels of IL-1β and IL-18 mRNAs in LPS-induced RAW264.7 macrophages treated with TXM-CB13. The values are shown as the means ± SEMs of three experiments. Student’s t test (***p < 0.001, and ****p < 0.0001). C Western blotting of IL-1β (p17) and Pro-IL-1β expression levels in LPS-induced RAW264.7 macrophages treated with TXM-CB13

TXM-CB13 Reduces NLRP3 Activation via the TLR4/MyD88/NF-κB Pathway in RAW264.7 Macrophages and THP-1 Cells

NF-κB plays a crucial role in oxidative stress and NLRP3-activated inflammatory responses. To investigate the effect of TXM-CB13 on NLRP3 inflammasome activation in LPS-induced RAW264.7 macrophages, the expression of related target proteins was detected by Western blot analysis. The expression of NLRP3 was increased under LPS stimulation, but this increase was reduced by subsequent treatment with TXM-CB13 (Fig. 5A and F), and decreased ASC recruitment and caspase-1 activation (Fig. 5B, C, and F). Additionally, TXM-CB13 prevented GSDMD cleavage and IL-1βp17 production (Fig. 5D, E, and F), suggesting that TXM-CB13 can reduce the secretion of IL-1β by regulating NLRP3 inflammasome activation and related factors.

Fig. 5.

Fig. 5

Open in a new tab

TXM-CB13 reduced NLRP3 inflammasome activation by modulating the TLR4/MyD88/NF-κB pathway in LPS-induced RAW264.7 macrophages and THP-1 cells. A-E Densitometric analysis of the expression levels of proteins related to NLRP3 inflammasome activation in RAW264.7 macrophages. Testing the expression of NLRP3, ASC, caspase-1 (p20)/ pro-caspase-1, GSDMD-N/GSDMD, and Il-β (p17)/pro-IL-1β. (*p < 0.05, **p < 0.01 with or without TXMCB13. The values are shown as the means ± SEMs of three experiments Student’s t test; (***p < 0.001, and ****p < 0.0001). F Western blotting of the protein expression levels of NLRP3, ASC, pro-caspase-1, Caspase-1 (p20), GSDMD, GSDMD-N, Pro-IL-1β, and IL-1β (p17) in LPS-induced RAW264.7 macrophages treated with TXM-CB13. G-J Densitometric analysis of the expression levels of proteins associated with the TLR4/MyD88/NF-κB signaling pathway in RAW264.7 macrophages. The expression of TLR4, MyD88, IκB/pIκB, and p-NF-κB (p65)/NF-κB (p65). The values are shown as the means ± SEMs of three experiments Student’s t test; (*p < 0.05, **p < 0.01, and ****p < 0.0001). K Western blotting of TLR4, MyD88, IκB, pIκB, NF-κB (p65), and p-NF-κB (p65) expression in LPS-induced RAW264.7 macrophages treated with TXM-CB13. L Western blotting was used to detect NLRP3, Myd88, and IL-1β expression in LPS-induced THP-1 cells. M‒O Densitometric analysis of the protein expression levels of NLRP3, MyD88 and IL-1β. The values are shown as the means ± SEMs of three experiments. Student’s t test; (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001)

Analysis of the TLR4/MyD88/NF-κB pathway revealed decreased TLR4 and MyD88 levels following TXM-CB13 treatment (Fig. 5G, H), along with reduced p-IKB-α/IKB-α and p-NF-κB-p65/NF-κB-p65 levels (Fig. 5I-K), indicating pathway inhibition. Validation in THP-1 cells corroborated these results, with reductions in MyD88, NLRP3, and IL-1β upon TXM-CB13 addition, especially in the MyD88 inhibitor group (Fig. 5L-O). These findings suggest that TXM-CB13 reduces NLRP3 inflammasome activation through the TLR4/MyD88/NF-κB pathway.

TXM-CB13 Decreases ROS Production and Regulates TXNIP/TRX in RAW264.7 Macrophages

ROS facilitate the activation of the NLRP3 inflammasome. To explore the mechanism by which TXM-CB13 regulates ROS-mediated NLRP3 inflammasome activation in RAW264.7 macrophages, ROS levels, and the RNA and protein levels of TXNIP and TRX were assessed via a ROS kit, flow cytometry, Western blot, and qRT‒PCR analysis. ROS production was markedly reduced (Fig. 6A–C), and the RNA and protein expression levels of TXNIP were significantly decreased by TXM-CB13 (Fig. 6E, G, and H). The RNA and protein expression levels of TRX were significantly reduced in LPS-induced RAW264.7 macrophages, but TXM-CB13increased these levels (Fig. 6D, F, and H). These findings suggest that TXM-CB13 diminishes NLRP3 inflammasome activation by reducing ROS and modulating TXNIP/TRX.

Fig. 6.

Fig. 6

Open in a new tab

TXM-CB13 decreased the production of ROS induced by LPS and blocked the separation of TXNIP from TRX and the activation of NLRP3 inflammatory bodies. A, B ROS content in LPS-induced RAW264.7 macrophages after TXM-CB13 treatment (Bar, 200 µm). C The ROS content TXM-CB13 in LPS-induced RAW264.7 macrophages. The values are shown as the means ± SEMs of three experiments Student’s t test; (**p < 0.01, and ****p < 0.0001). D, E qRT‒PCR of mRNA expression levels of TRX and TXNIP in LPS-induced RAW264.7 macrophages treated with TXM-CB13. The values are shown as the means ± SEMs of three experiments. Student’s t test **p < 0.01, ***p < 0.001, and ****p < 0.0001). F, G Densitometric analysis of protein expression levels of TRX and TXNIP.. The values are shown as the means ± SEMs of three experiments. Student’s t test; (**p < 0.01, ***p < 0.001, and ****p < 0.0001). H Western of protein expression levels of TXNIP and TRX in LPS-induced RAW264.7 macrophages treated with TXM-CB13

Discussion

A previous study demonstrated that transgenic overexpression of thioredoxin (TRX) and systemic administration of recombinant human thioredoxin (rhTRX) effectively alleviated DSS-induced colitis by suppressing macrophage inhibitory factor (MIF) and other cytokines. However, researchers have not clearly determined whether TRX can improve enteritis by regulating signaling pathways that inhibit inflammatory factors [25]. This study explored the role of TXM-CB13 in DSS-induced colitis, yielding several important findings: (1) TXM-CB13 ameliorates inflammatory status and pathological damage, (2) it reduces NLRP3 inflammasome activation by inhibiting the TLR4/MyD88/NF-κB signaling pathway, (3) it increases the expression of occludin and NLRP1, and (4) suppresses the ROS/TXNIP/TRX signaling pathway.

Intestinal inflammation is closely associated with disruption of the intestinal mucosal barrier, leading to changes in body weight and colon length in mice with inflammatory bowel disease (IBD). These changes are closely correlated with the production and release of inflammatory factors [26–28]. Our findings indicate that TXM-CB13 improved murine colitis symptoms, such as weight loss, alterations in colon length, neutrophil infiltration, IL-1β production, and intestinal mucosal protein occludin expression. Additionally, blood stools were observed on the sixth day and worsened by the ninth day following DSS administration, whereas the condition in the DSS-CB13 group was significantly alleviated (data not shown). Weight loss was also markedly reduced in the DSS-CB13 group by the ninth day (Fig. 1). Therefore, we speculate that TXM-CB13 alleviates colitis symptoms by continuously reducing the production of inflammatory factors and protecting the intestinal mucosal barrier.

The level of IL-1β is associated with the progression of various autoinflammatory diseases, including IBD [29]. IL-1β is produced primarily by innate immune cells, such as monocytes, dendritic cells (DCs), and macrophages, with macrophages in the lamina propria being the main source in the colon. IL-18 is another multifunctional cytokine mainlythat is expressed mainly in the intestinal epithelium of both mice and humans [11]. Previous studies have demonstrated that TRX can inhibit the production and secretion of IL-1β and IL-18, thereby exerting significant anti-inflammatory effects [30, 31]. Although IL-1β production is beneficial for host defense during infections and metabolic processes [32], its overproduction can lead to sterile inflammation, increasing the risk of metabolic and autoinflammatory diseases. Other studies have shown that IL-1β secretion can trigger and exacerbate mucosal inflammation [33]. Elevated levels of IL-1β are found in IBD patients and mouse models [34].

In this study, high expression levels of IL-1β and IL-18 in DSS-induced colitis mice and LPS-induced RAW264.7 macrophages significantly improved following TXM-CB13 treatment (Figs. 2, 4). Thus, we believe that IL-1β and IL-18 playproinflammatory roles in the mucosal immune response and IBD. Furthermore, we propose that TXM-CB13 reduces the secretion of IL-1β and IL-18, resulting in anti-inflammatory effects similar to those of TRX. Both IL-1β and IL-18 are major downstream targets regulated by NLRP3 inflammasome signaling, with IL-1β being the primary proinflammatory cytokine triggered by the NLRP3 inflammasome. A decrease in (LPS)-induced cytokines in mice by TXM-CB3 has recently been shown [35].

NLRP3 inflammasome-mediated inflammatory responses are critical mechanisms underlying intestinal inflammation in the DSS-induced colitis model [9]. Researchers have confirmed that the release of IL-1β and IL-18 is tightly regulated by NLRP3 inflammasome activation [3]. Consequently, inhibiting the formation and activation of the NLRP3 inflammasome may be an effective therapeutic strategy for IBD. Reactive oxygen species (ROS), particularly mitochondrial ROS, promote NLRP3 activation through a well-elucidated mechanism involving the oxidation of reduced TRX and the interplay between TXNIP and NLRP3 [36]. TRX inhibits the expression of NLRP3 and the secretion of IL-1β and caspase-1 (p10) [37]. ROS stimulate NLRP3 inflammasome activation, which is inhibited by TRX [37]. Our results revealed that the RNA and protein expression levels of NLRP3 in DSS-induced colitis and LPS-induced RAW264.7 macrophages were greatly, increased and promoted NLRP3 inflammasome activation (Fig. 2, 5). In contrast, TXM-CB13 regulated the activation of the NLRP3 inflammasome and its related factors, including NLRP3, ASC, caspase-1, GSDMD, and IL-1β. These findings suggest that TXM-CB13 may be beneficial in treating IBD by suppressing NLRP3 inflammasome activation (Figs. 2, 5).

Moreover, our data indicate that TXM-CB13 enhances NLRP1 expression in DSS-induced colitis mice and LPS-induced RAW264.7 macrophages (Fig. 3). The mechanism and effects of NLRP1 remain unclear or controversial. Some studies suggest that NLRP1 plays a protective role in the gastrointestinal mucosal immune response [19], which aligns with our experimental results. NLRP1 inflammasomes consist of NACHT, LRR, FIIND, and CARD domains, whereas other NLRP proteins have a tripartite domain organization. Furthermore, NLRP1 inflammasomes exhibit notable differences between murine and human models [38], potentially leading to differing effects compared with those of other NLRP proteins due to functional mechanisms that depend on structural characteristics.

Two major signaling pathways activate NLRP3. The first involves NF-κB-induced transcription, which regulates NLRP3 inflammasome expression, necessitating stimulation from cytokine signaling pathways or sensitization via a TLR or CLR ligand [2]. In this study, LPS stimulation activated the TLR4‒NF-κB signaling pathway, increasing NLRP3 expression in RAW264.7 macrophages. TXM-CB13 blockade reduced NLRP3 activation by modulating NF-κB-related proteins (TLR4, MyD88, p-p65/p65, and p-IKB-α/IKB-α) (Fig. 5). These results suggest that blocking the NF-κB signaling pathway with TXM-CB13 protects against colitis.

The second signaling pathway involves the ROS/TXNIP/NLRP3 inflammasome pathway. ROS generated by inflammatory infiltrates are thought to contribute to IBD progression [39]. Previous studies have shown that TXNIP expression is correlated with NLRP3 activity [40–42]. LPS stimulation controls TXNIP protein levels, regulating NLRP3, pro-IL-1β, and pro-IL-18 expression. TXNIP serves as an NLRP3-binding protein; when TRX is oxidized by ROS, it separates from TXNIP, allowing TXNIP to bind to and activate the NLRP3 inflammasome [17]. Our study demonstrated that TXM-CB13 inhibits ROS production in LPS-induced RAW264.7 macrophages, increases intracellular TRX levels, and reduces TXNIP binding to the NLRP3 inflammasome (Fig. 6). These results indicate that the protective effect of TXM-CB13 against colitis is also linked to its ability to inhibit ROS-mediated TXNIP and TRX oxidative stress, further elucidating its protective mechanism in IBD.

The imbalance between oxidants and antioxidants is a major pathogenic mechanism underlying intestinal inflammation and mucosal injury, contributing to IBD development [43]. Unlike single cysteine residue compounds such as N-acetyl-cysteine (NAC) or AD4 (an amide form of NAC), TXM-CB13 is a tetrapeptide derived from the classical -C-x-x-C- motif of the TRX active site containing two cysteine residues (Fig. 1), and TXM-CB3 (NAc-Cys-Pro-Cys-amide) contains the -C-x-C-motif. These peptides exhibit increased efficacy and function in eliminating ROS, preventing NF-κB nuclear translocation, and inhibiting MAPK. Compared with NAC or AD4 [22, 44–47]. In previous studies, TXM-CB3 was shown to reduce inflammatory cell counts in the lungs and alleviate airway hyperresponsiveness in mice [46]. TXM-CB13, comprises of methionine and lysine which are precursors of carnitine. Acetylcarnitine —has been shown to protect against various neurological diseases improving mitochondrial function and enhancing antioxidant activity [48]. Additionally, TXM-CB3 has been shown to have significant anti-inflammatory effects in LPS-treated mice [35] and also on dermatitis (unpublished data).

Existing NLRP3 inhibitors have demonstrated severe side effects, such as nausea, fatigue, dizziness, and vomiting, leading to failures in clinical trials [49]. This underscores the urgent need to develop a safer, more effective small-molecule NLRP3 inhibitor that is close to clinical application. Additionally, while several small molecules have been reported to inhibit NLRP3 inflammasome activation, many of these small molecules either target the upstream signaling pathways of NLRP3 or inhibit other inflammatory signaling pathways, lacking specificity for NLRP3 inflammasome activation. Since the NLRP3 inflammasome binds to TRX and TXNIP, and TRX has also been shown to interact with NLRP1 [50], we strongly suggest that TXM-CB13, a TRX mimetic peptide, could interact directly with both the NLRP3 and the NLRP1 inflammasome. Testing the effect and mechanism of TXM-CB13 in inflammatory bowel disease (IBD), we demonstrated that TXM-CB13 indeed regulates the activation of both NLRP3 and NLRP1. Furthermore, as a ROS scavenger, TXM-CB13 helps reduce the number of stimuli that trigger NLRP3 activation.

The use of corticosteroids (GCs) to treat patients with IBD has been the basis of IBD therapeutics has no efficacy in maintaining remission and is known to have significant short- and long-term side effects, including a risk of increased mortality [51]. Some patients develop resistance or steroid dependence [52]. The anti-inflammatory effects of GC, which is different from the TRX [53, 54] can also induce MIF and enhance GC resistance by inhibiting MAP kinase phosphatase-1 (MKP-1) [55, 56]. MIF also affects the NF-kB/IkB signal cascade, leading to increased inflammation and GC resistance [57]. TRX can bind to the GC receptor and enhance the response of cells to GCs [58]. and can bind directly to MIF inside and outside the cell [59] suggesting that TRX improves GC resistance via MIF. Since TRX-mimetic peptides easily ceposs into the cell as opposed to the recombinant TRX [60] they are potentially excellent candidates for IBD treatmnent [61].

In conclusion, our study confirms the protective effect of TXM-CB13 in colitis and elucidates its mechanism of action, which involves the inhibition of NF-κB signaling and a reduction in ROS-triggered oxidative stress pathways, thereby suppressing NLRP3 inflammasome activation. These findings highlight TXMs as promising candidates for future anti-inflammatory drug development.

Experimental Procedures

Animals

Wild-type male C57BL/6 mice (6 weeks old) were purchased from Hangzhou Hansi Biotechnology Co., Ltd. (Hangzhou, China). All animals were housed in microisolation cages under a 12-h light/12-h dark cycle with standard feed and water. All the experiments were conducted in accordance with the agency's guidelines and regulations.

Animal Models

After one week of acclimation, the mice were randomly divided into three groups: Water-SPSS, DSS-SPSS, and DSS-CB13. TXM-CB13 was a gift from Professor Daphne Atlas, who is working at Hebrew University of Jerusalem, Israel. Owing to the lack of reported studies on intraperitoneal injection of TXM- CB13 in mice, we referred to the effective dose of TXM-CB3 injection in published papers to conduct this experiment [62]. To establish the colitis models, the DSS-SPSS group and the DSS-CB13 group received 2.5% DSS in the drinking water for 11 days to induce colitis. The mice in the Water- SPSS groups received normal drinking water. During this period, the mice in the DSS-CB13 group were intraperitoneally injected with 0.1 ml of 0.40 mg/ml TXM-CB13 (dissolved in stroke-physiological saline solution) once a day. The mice in the Water-SPSS group and the DSS-SPSS group received the same volume of SPSS daily. The mice were weighed daily. On the 12th day, following the conclusion of the experiment, the mice were euthanized, target tissue samples were collected, and the coloniccolon length was measured.

Hematoxylin‒eosin (HEosin) Staining

Colon tissue samples were fixed in 10% formalin for six days, dehydrated, and embedded in paraffin. The selected samples were stained with hematoxylin and eosin (H&E) for pathological analysis. Two parameters were used to calculate the histological damage score: tissue damage (score: 0–3) and infiltration of inflammatory cells (score:0–3) in a double-blind fashion [63]. Three sections obtained from each of three sites at a 100 μm distance were evaluated, and the mice were scored individually, with each score representing the mean of nine sections [64].

Immunohistochemical Analysis

Five-micron-thick tissue samples were prepared from paraffin-embedded blocks and dewaxed in 3% hydrogen peroxide methanol to inhibit endogenous peroxidase activity for 30 min and then in 10% bovine serum for 30 min at room temperature to block nonspecific binding. The tissue samples were incubated with primary antibodies (see Table 1) at 4 °C for 16 h. After rinsing with PBS, the sections were incubated with anti-rabbit immunoglobulin conjugated to horseradish peroxidase (Boster Biotechnology, Inc.) for 30 min at room temperature. Finally, the sections were counterstained with a working solution of 3,3'-diaminobenzidine (Beyotime Biotechnology, Inc.).

Table 1.

Experimental materials

Reagent or resource Dilution ratio Source Identifier
Antibodies for western blot
NLRP1 1:1000 Abclonal A16212
NLRP3 1:1000 Abclonal A5652
ASC 1:1000 Abclonal A16672
Caspase-1 1:1000 Abclonal A0964
GSDMD 1:1000 Abcam ab219800
IL-1β 1:500 Bioss bs-0812R
TLR4 1:1000 Affinity AF7071
MyD88 1:1000 Affinity AF5159
NF-κB-p65 1:1000 Affinity AF5006
P-NF-κB-p65 1:1000 Affinity AF2006
IκB-α 1:1000 Affinity AF5002
P-IκB-α 1:1000 Affinity AF2002
Occludin 1:1000 Bioss bs-10011R
TXNIP 1:2000 Affinity DF7506
TRX 1:10,000 RedoxBioScience
β-Tubulin 1:50,000 Proteintch 66,240–1-lg
β-actin 1:10,000 Bioss bs-0061R
GADPH 1:50,000 Proteintch 60,004–1-lg
Antibodies for immunofluorescence staining
NLRP1 1:200 Abclonal A16212
NLRP3 1:200 Abclonal A5652
IL-1β 1:200 Bioss bs-0812R
ZO-1 1:100 Affinity AF5145
Occludin 1:200 Bioss bs-10011R
Open in a new tab

Cell Culture and Treatment

RAW264.7 macrophages sourced from the American Type Culture Collection (ATCC; Manassas, Virginia, USA) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% streptomycin and penicillin in a humidified incubator at 37 °C with 5% carbon dioxide. To assess the effect of TXM-CB13 on the viability of the cells, we used 10, 20, 40, 80, and 160 (μg/ml) TXM-CB13 in the CCK8 cell viability assay. The results indicated that none of the concentrations inhibited cell viability, and the maximum cell viability was observed for 40 μg/ml TXM-CB13. Therefore, 40 μg/mL TXM-CB13 was selected as the dosing concentration for all the cell experiments (data not shown). The cells were divided into three groups: the LPS, LPS-CB13, and control groups. The LPS group received LPS; the LPS-CB13 group was first treated with LPS and subsequently with TXM-CB13; the control group was treated with only an equivalent amount of PBS.

A human monocyte leukemia cell line (THP-1) was obtained from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences. The cells were cultured at a density of 5 × 105 cells/mL in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin solution (Biological Industries, Israel), HEPES (10 mM), sodium pyruvate (1 mM; all from Invitrogen) and β-mercaptoethanol (0.05 mM) at 37 °C in a 5% CO2 incubator. In all the experiments, THP-1 monocytes were cultured in 6-well plates treated with 25 nM phorbol 12-myristate 13-acetate (PMA) for 48 h to transform into adherent macrophages, followed by a recovery period of 24 h in culture in the absence of PMA. The cells were divided into the control, LPS, LPS + CB13 and LPS + MyD88 inhibitor + CB13 groups, and the MyD88 inhibitor (MCE, HY-139397) was 40 µM.

Measurement of ROS Generation

Reactive oxygen species were detected via a ROS assay kit with the fluorescent probe DCFH-DA. Initially, nonfluorescent, DCFH-DA can cross the cell membrane and is converted by cellular esterases to DCFH, which remains inside the cell. Reactive oxygen species within the cells oxidize DCFH to fluorescent DCF, the levels of which wereare quantified via a FACS flow cytometer. The results are expressed as the mean fluorescence intensity and were analyzed via FlowJo 7.6 software.

RNA Extraction and Quantitative Real-Time PCR

Total RNA was extracted from colonic tissues or macrophages via a rapid tissue/cell RNA extraction kit (Aidlab). The RNA was reverse transcribed to cDNA via a kit (Bio-Rad), and then used for quantitative real-time PCR with SYBR RT‒PCR reagents (Thermo Fisher Scientific) in a LightCycler 480 Real-time PCR System (Roche). Assays were performed in triplicate in 10 μl volumes and quantified via the 2-ΔΔCT method, with the results normalized to GAPDH expression. The expression levels of specific genes in the mice were analyzed relative to those in the controls via the designated primers (see Table 2).

Table 2.

Primers used in this study

Primer or primer sequences
NLRP3

F: GCTGCGATCAACAGGCGAGAC

R: CCATCCACTCTTCTTCAAGGCTGTC
ASC

F: ACAATGACTGTGCTTAGAGACA

R: CACAGCTCCAGACTCTTCTTTA
Caspase-1

F: AGAGGATTTCTTAACGGATGCA

R: TCACAAGACCAGGCATATTCTT
GSDMD

F: CTAGCTAAGGCTCTGGAGACAA

R: GATTCTTTTCATCCCAGCAGTC
IL-1β

F: CACTACAGGCTCCGAGATGAAC

R: TGTCGTTGCTTGGTTCTCCTTGTAC
IL-18

F: AGACCTGGAATCAGACAACTTT

R: TCAGTCATATCCTCGAACACAG
TXNIP

F: GTCTTTTGAGGTGGTCTTCAAC

R: TCACACACTTCCACTATTACCC
TRX

F: TTCCCTCTGTGACAAGTATTCC

R: TCAAGCTTTTCCTTGTTAGCAC
Open in a new tab

Western Blot Analysis

The cell and tissue samples were lysed in 1 × RIPA buffer (Beyotime), and the colonic tissue was homogenized via a tissue crusher. After centrifugation at 13,000 rpm for 10 min at 4 °C, the supernatant was collected for further analysis. Proteins were separated by SDS‒PAGE on a 12% gel and transferred to a PVDF membrane. The membrane was blocked with 10% skim milk for one hour at room temperature and subsequently incubated overnight at 4 °C with specific primary antibodies (Table 1). The membrane was then incubated with the appropriate secondary antibodies for one hour at room temperature, and protein bands were visualizedvia an enhanced chemiluminescence (ECL) reagent (Beyotime). The images presented are representative of at least three independent biological experiments.

Statistical Analysis

The results are presented as themeans and standard errors (SEMs) of three or more independent experiments. Differences between two groups were evaluated via Student’s t-test, whereas differences among three or more groups were analyzed usingvia one-way ANOVA. Statistical analyses were performed via Graph Pad Prism 9.0 software, and a p- value less than 0.05 was considered statistically significant.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (PDF 311 KB) (310.7KB, pdf)

Acknowledgements

We deeply appreciate Prof. Akira Mitsui for their pointed advice and discussion for writing this paper.

Abbreviations

NLRP3

Nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing-3

NLRP1

Nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing-1

GSDMD

Gasdermin-D

ZO-1

Zonula occludens-1

TXM

Thioredoxin-mimetic

SPSS

Stroke-physiological saline solution

TLR4

Toll-like receptor 4

TXNIP

Thioredoxin interacting protein

MyD88

Myeloid differentiation factor 88

NF-κB

Nuclear factor kappa-light-chain-enhancer of activated B cells

MAP

Mitogen-activated protein kinase

IBD

Inflammatory bowel disease

IκB

Inhibitor of κB

ROS

Reactive oxygen species

TRX

Thioredoxin

IL

Interleukin

rhTRX

Recombinant human thioredoxin

MIF

Macrophage inhibitor factor

AD4

NAC-amide (N-acetylcysteine amide)

Author Contributions

Ruijie Cao: Study design, Material preparation, Experiment conduct, Investigation， Data acquisition and analysis, Writing the manuscript. Jinhui Zhou, Jiale Liu, Yaxuan Wang, Yandong Dai: Data acquisition and analysis, Experiment conduct. Tiancheng Jin, Yun Jiang, Jiedong Zhou, Cuixue Wang, Qihuan Tan, Yifei Chen: literature searches and extensive discussions, Akira Yamauchi, Atsushi Fukunaga, Daphne Atlas, Junji Yodoi: the conception and writing of the manuscript. Hai Tian： Study design, Experiment conduct, Data curation, Investigation， Validation, Visualization， Editing the manuscript. All authors agreed to publish the paper.

Funding

No funding was received for this article.

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Competing Interest

The authors declare no competing interests.

Clinical Trial Number

Not applicable.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Eichele, D.D., and K.K. Kharbanda. 2017. Dextran sodium sulfate colitis murine model: An indispensable tool for advancing our understanding of inflammatory bowel diseases pathogenesis. World Journal of Gastroenterology 23 (33): 6016–6029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Guarda, G., and A. So. 2010. Regulation of inflammasome activity. Immunology 130 (3): 329–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sahoo, M., et al. 2011. Role of the inflammasome, IL-1β, and IL-18 in bacterial infections. TheScientificWorldJOURNAL 11: 2037–2050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Meng, Y., et al. 2014. Angiotensin-converting enzyme 2/angiotensin-(1–7)/Mas axis protects against lung fibrosis by inhibiting the MAPK/NF-κB pathway. American Journal of Respiratory Cell and Molecular Biology 50 (4): 723–736. [DOI] [PubMed] [Google Scholar]
  • 5.Strowig, T., et al. 2012. Inflammasomes in health and disease. Nature 481 (7381): 278–286. [DOI] [PubMed] [Google Scholar]
  • 6.Schroder, K., and J. Tschopp. 2010. The inflammasomes. Cell 140 (6): 821–832. [DOI] [PubMed] [Google Scholar]
  • 7.Huang, M.T.-H., et al. 2009. Critical role of apoptotic speck protein containing a caspase recruitment domain (ASC) and NLRP3 in causing necrosis and ASC speck formation induced by Porphyromonas gingivalis in human cells. Journal of Immunology (Baltimore, Md.: 1950) 182 (4): 2395–2404. [DOI] [PubMed] [Google Scholar]
  • 8.Sharma, B.R., and T.-D. Kanneganti. 2021. NLRP3 inflammasome in cancer and metabolic diseases. Nature Immunology 22 (5): 550–559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bauer, C., et al. 2010. Colitis induced in mice with dextran sulfate sodium (DSS) is mediated by the NLRP3 inflammasome. Gut 59 (9): 1192–1199. [DOI] [PubMed] [Google Scholar]
  • 10.Na, Y.R., et al. 2019. Macrophages in intestinal inflammation and resolution: A potential therapeutic target in IBD. Nature Reviews. Gastroenterology & Hepatology 16 (9): 531–543. [DOI] [PubMed] [Google Scholar]
  • 11.Zhen, Y., and H. Zhang. 2019. NLRP3 Inflammasome and inflammatory bowel disease. Frontiers In Immunology 10: 276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Seksik, P., et al. 2003. Alterations of the dominant fecal bacterial groups in patients with Crohn’s disease of the colon. Gut 52 (2): 237–242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Martin, H.M., et al. 2004. Enhanced Escherichia coli adherence and invasion in Crohn’s disease and colon cancer. Gastroenterology 127 (1): 80–93. [DOI] [PubMed] [Google Scholar]
  • 14.Wang, X., et al. 2021. SNX10-mediated LPS sensing causes intestinal barrier dysfunction via a caspase-5-dependent signaling cascade. The EMBO Journal 40 (24): e108080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bauernfeind, F.G., et al. 2009. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. Journal of Immunology (Baltimore, Md.: 1950) 183 (2): 787–791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Peng, L., et al. 2020. Scutellarin ameliorates pulmonary fibrosis through inhibiting NF-κB/NLRP3-mediated epithelial–-mesenchymal transition and inflammation. Cell Death & Disease 11 (11): 978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhou, R., et al. 2010. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nature Immunology 11 (2): 136–140. [DOI] [PubMed] [Google Scholar]
  • 18.Bauernfeind, F., et al. 2011. Cutting edge: reactive oxygen species inhibitors block priming, but not activation, of the NLRP3 inflammasome. Journal of Immunology (Baltimore, Md.: 1950) 187 (2): 613–617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Williams, T.M., et al. 2015. The NLRP1 inflammasome attenuates colitis and colitis-associated tumorigenesis. Journal of Immunology (Baltimore, Md.: 1950) 194 (7): 3369–3380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ringel-Scaia, V.M., et al. 2019. Maternal Influence and Murine Housing Confound Impact of NLRP1 Inflammasome on Microbiome Composition. Journal of Innate Immunity 11 (5): 416–431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wang, Z., et al. 2020. secoisolariciresinol diglucoside suppresses Dextran sulfate sodium salt-induced colitis through inhibiting NLRP1 inflammasome. International Immunopharmacology 78: 105931. [DOI] [PubMed] [Google Scholar]
  • 22.Cohen-Kutner, M., et al. 2013. Thioredoxin-mimetic peptides (TXM) reverse auranofin-induced apoptosis and restore insulin secretion in insulinoma cells. Biochemical Pharmacology 85 (7): 977–990. [DOI] [PubMed] [Google Scholar]
  • 23.Baratz-Goldstein, R., et al. 2016. Thioredoxin-mimetic-peptides protect cognitive function after Mild Traumatic Brain Injury (mTBI). PLoS ONE 11 (6): e0157064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lejnev, K., et al. 2016. Thioredoxin-mimetic peptides (TXM) inhibit inflammatory pathways associated with high-glucose and oxidative stress. Free Radical Biology & Medicine 99: 557–571. [DOI] [PubMed] [Google Scholar]
  • 25.Tamaki, H., et al. 2006. Human thioredoxin-1 ameliorates experimental murine colitis in association with suppressed macrophage inhibitory factor production. Gastroenterology 131 (4): 1110–1121. [DOI] [PubMed] [Google Scholar]
  • 26.Huang, C., et al. 2022. Ketone body beta-hydroxybutyrate ameliorates colitis by promoting M2 macrophage polarization through the STAT6-dependent signaling pathway. BMC Medicine 20 (1): 148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.MacDonald, T.T., et al. 2011. Regulation of homeostasis and inflammation in the intestine. Gastroenterology 140 (6): 1768–1775. [DOI] [PubMed] [Google Scholar]
  • 28.Salim, S.Y., and J.D. Söderholm. 2011. Importance of disrupted intestinal barrier in inflammatory bowel diseases. Inflammatory Bowel Diseases 17 (1): 362–381. [DOI] [PubMed] [Google Scholar]
  • 29.Dinarello, C.A., A. Simon, and J.W.M. van der Meer. 2012. Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases. Nature reviews. Drug Discovery 11 (8): 633–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hoshino, T., et al. 2003. Redox-active protein thioredoxin prevents proinflammatory cytokine- or bleomycin-induced lung injury. American Journal of Respiratory and Critical Care Medicine 168 (9): 1075–1083. [DOI] [PubMed] [Google Scholar]
  • 31.Matsuo, Y., and J. Yodoi. 2013. Extracellular thioredoxin: A therapeutic tool to combat inflammation. Cytokine & Growth Factor Reviews 24 (4): 345–353. [DOI] [PubMed] [Google Scholar]
  • 32.Bersudsky, M., et al. 2014. Non-redundant properties of IL-1α and IL-1β during acute colon inflammation in mice. Gut 63 (4): 598–609. [DOI] [PubMed] [Google Scholar]
  • 33.Friedrich, M., et al. 2021. IL-1-driven stromal-neutrophil interactions define a subset of patients with inflammatory bowel disease that does not respond to therapies. Nature Medicine 27 (11): 1970–1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ligumsky, M., et al. 1990. Role of interleukin 1 in inflammatory bowel disease–enhanced production during active disease. Gut 31 (6): 686–689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Govednik, T., D. Lainšček, U. Kuhar, M. Lachish, S. Janežič, M. Štrbenc, U. Krapež, R. Jerala, D. Atlas, and M. Manček-Keber. 2024. TXM peptides inhibit SARS-CoV-2 infection, syncytia formation, and lower inflammatory consequences. Antiviral Research 222: 105806. 10.1016/j.antiviral.2024.105806. [DOI] [PubMed] [Google Scholar]
  • 36.Cox, L.A.T. 2018. Biological mechanisms of non-linear dose response for respirable mineral fibers. Toxicology and Applied Pharmacology 361: 137–144. [DOI] [PubMed] [Google Scholar]
  • 37.Wang, Y., et al. 2020. Thioredoxin-1 attenuates atherosclerosis development through inhibiting NLRP3 inflammasome. Endocrine 70 (1): 65–70. [DOI] [PubMed] [Google Scholar]
  • 38.Ciążyńska, M., et al. 2020. NLRP1 and the NLRP3 inflammasome as a new approach to skin carcinogenesis. Oncology Letters 19 (3): 1649–1656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Rogler, G. 2014. Chronic ulcerative colitis and colorectal cancer. Cancer Letters 345 (2): 235–241. [DOI] [PubMed] [Google Scholar]
  • 40.Han, Y., et al. 2018. Reactive oxygen species promote tubular injury in diabetic nephropathy: The role of the mitochondrial ros-txnip-nlrp3 biological axis. Redox Biology 16: 32–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Li, Y., et al. 2015. Ilexgenin A inhibits endoplasmic reticulum stress and ameliorates endothelial dysfunction via suppression of TXNIP/NLRP3 inflammasome activation in an AMPK dependent manner. Pharmacological Research 99: 101–115. [DOI] [PubMed] [Google Scholar]
  • 42.Li, Z., et al. 2022. PPARγ Alleviates Sepsis-Induced Liver Injury by Inhibiting Hepatocyte Pyroptosis via Inhibition of the ROS/TXNIP/NLRP3 Signaling Pathway. Oxidative Medicine and Cellular Longevity 2022: 1269747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tian, T., Z. Wang, and J. Zhang. 2017. Pathomechanisms of oxidative stress in inflammatory bowel disease and potential antioxidant therapies. Oxidative Medicine and Cellular Longevity 2017: 4535194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Bachnoff, N., M. Trus, and D. Atlas. 2011. Alleviation of oxidative stress by potent and selective thioredoxin-mimetic peptides. Free Radical Biology & Medicine 50 (10): 1355–1367. [DOI] [PubMed] [Google Scholar]
  • 45.Bartov, O., et al. 2006. Low molecular weight thiol amides attenuate MAPK activity and protect primary neurons from Abeta(1–42) toxicity. Brain Research 1069 (1): 198–206. [DOI] [PubMed] [Google Scholar]
  • 46.Kim, S.R., et al. 2011. A novel dithiol amide CB3 attenuates allergic airway disease through negative regulation of p38 mitogen-activated protein kinase. American Journal of Respiratory and Critical Care Medicine 183 (8): 1015–1024. [DOI] [PubMed] [Google Scholar]
  • 47.Cohen-Kutner, M., et al. 2014. Thioredoxin-mimetic peptide CB3 lowers MAPKinase activity in the Zucker rat brain. Redox Biology 2: 447–456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Shenk, J.C., et al. 2009. The effect of acetyl-L-carnitine and R-alpha-lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer’s disease. Journal of the Neurological Sciences 283 (1–2): 199–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ramalingam, V. 2023. NLRP3 inhibitors: Unleashing their therapeutic potential against inflammatory diseases. Biochemical Pharmacology 218: 115915. [DOI] [PubMed] [Google Scholar]
  • 50.Yoshihara, E., Y. Matsuo, S. Masaki, Z. Chen, H. Tian, H. Masutani, A. Yamauchi, K. Hirota, and J. Yodoi. 2024. Redoxisome Update: TRX and TXNIP/TBP2-Dependent Regulation of NLRP-1/NLRP-3 Inflammasome. Antioxidants Redox Signaling 40 (10–12): 595–597. [DOI] [PubMed] [Google Scholar]
  • 51.Dorrington, A.M., C.P. Selinger, G.C. Parkes, M. Smith, R.C. Pollok, and T. Raine. 2020. The Historical Role and Contemporary Use of Corticosteroids in Inflammatory Bowel Disease. Journal of Crohn’s & Colitis 14 (9): 1316–1329. 10.1093/ecco-jcc/jjaa053. [DOI] [PubMed] [Google Scholar]
  • 52.Manz, M., S.R. Vavricka, R. Wanner, P.L. Lakatos, G. Rogler, P. Frei, E. Safroneeva, and A.M. Schoepfer. 2012. Therapy of steroid-resistant inflammatory bowel disease. Digestion 86 (Suppl 1): 11–15. 10.1159/000341952. [DOI] [PubMed] [Google Scholar]
  • 53.Fukunaga, A., T. Horikawa, K. Ogura, K. Taguchi, X. Yu, Y. Funasaka, M. Takeda, H. Nakamura, J. Yodoi, and C. Nishigori. 2009. Thioredoxin suppresses the contact hypersensitivity response by inhibiting leukocyte recruitment during the elicitation phase. Antioxidants Redox Signaling 11 (6): 1227–35. 10.1089/ars.2008.2340. [DOI] [PubMed] [Google Scholar]
  • 54.Son, A., H. Nakamura, N. Kondo, Y. Matsuo, W. Liu, S. Oka, Y. Ishii, and J. Yodoi. 2006. Redox regulation of mast cell histamine release in thioredoxin-1 (TRX) transgenic mice. Cell Research 16 (2): 230–9. 10.1038/sj.cr.7310031. [DOI] [PubMed] [Google Scholar]
  • 55.Aeberli, D., M. Leech, and E.F. Morand. 2006. Macrophage migration inhibitory factor and glucocorticoid sensitivity. Rheumatology (Oxford) 45 (8): 937–943. 10.1093/rheumatology/kel142. [DOI] [PubMed] [Google Scholar]
  • 56.Kassel, O., A. Sancono, J. Krätzschmar, B. Kreft, M. Stassen, and A.C. Cato. 2001. Glucocorticoids inhibit MAP kinase via increased expression and decreased degradation of MKP-1. EMBO Journal 20 (24): 7108–7116. 10.1093/emboj/20.24.7108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wang, F.F., L.A. Zhu, Y.Q. Zou, H. Zheng, A. Wilson, C.D. Yang, N. Shen, D.J. Wallace, M.H. Weisman, S.L. Chen, and L.J. Lu. 2012. New insights into the role and mechanism of macrophage migration inhibitory factor in steroid-resistant patients with systemic lupus erythematosus. Arthritis Research & Therapy 14 (3): R103. 10.1186/ar3828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Makino, Y., K. Okamoto, N. Yoshikawa, M. Aoshima, K. Hirota, J. Yodoi, K. Umesono, I. Makino, and H. Tanaka. 1996. Thioredoxin: a redox-regulating cellular cofactor for glucocorticoid hormone action. Cross talk between endocrine control of stress response and cellular antioxidant defense system. Journal of Clinical Investigation 98 (11): 2469–77. 10.1172/JCI119065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Son, A., N. Kato, T. Horibe, Y. Matsuo, M. Mochizuki, A. Mitsui, K. Kawakami, H. Nakamura, and J. Yodoi. 2009. Direct association of thioredoxin-1 (TRX) with macrophage migration inhibitory factor (MIF): regulatory role of TRX on MIF internalization and signaling. Antioxidants Redox Signaling 11 (10): 2595–605. 10.1089/ars.2009.2522. [DOI] [PubMed] [Google Scholar]
  • 60.Kondo, N., Y. Ishii, Y.W. Kwon, M. Tanito, J. Sakakura-Nishiyama, M. Mochizuki, M. Maeda, S. Suzuki, M. Kojima, Y.C. Kim, A. Son, H. Nakamura, and J. Yodoi. 2007. Lipid raft-mediated uptake of cysteine-modified thioredoxin-1: apoptosis enhancement by inhibiting the endogenous thioredoxin-1. Antioxidants Redox Signaling 9 (9): 1439–48. 10.1089/ars.2007.1665. [DOI] [PubMed] [Google Scholar]
  • 61.Bachnoff, N., M. Trus, and D. Atlas. 2011. Alleviation of oxidative stress by potent and selective thioredoxin-mimetic peptides. Free Radical Biology & Medicine 50 (10): 1355–1367. 10.1016/j.freeradbiomed.2011.02.026. [DOI] [PubMed] [Google Scholar]
  • 62.Lejnev, K., L. Khomsky, K. Bokvist, S. Mistriel-Zerbib, T. Naveh, T.B. Farb, J. Alsina-Fernandez, and D. Atlas. 2016. Thioredoxin-mimetic peptides (TXM) inhibit inflammatory pathways associated with high-glucose and oxidative stress. Free Radical Biology & Medicine 99: 557–571. 10.1016/j.freeradbiomed.2016.09.011. [DOI] [PubMed] [Google Scholar]
  • 63.Wei, J., C. Wei, M. Wang, X. Qiu, Y. Li, Y. Yuan, C. Jin, L. Leng, J. Wang, X. Yang, and F. He. 2014. The GTPase-activating protein GIT2 protects against colitis by negatively regulating Toll-like receptor signaling. Proceedings of the National Academy of Sciences U S A 111 (24): 8883–8888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Stopfer, P., F. Obermeier, N. Dunger, W. Falk, S. Farkas, M. Janotta, A. Möller, D.N. Männel, and T. Hehlgans. 2004. Blocking lymphotoxin-beta receptor activation diminishes inflammation via reduced mucosal addressin cell adhesion molecule-1 (MAdCAM-1) expression and leucocyte margination in chronic DSS-induced colitis. Clinical and Experimental Immunology 136 (1): 21–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Afonina, I.S., et al. 2017. Limiting inflammation-the negative regulation of NF-κB and the NLRP3 inflammasome. Nature Immunology 18 (8): 861–869. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (PDF 311 KB) (310.7KB, pdf)

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Inflammation are provided here courtesy of Springer

RESOURCES