SUCNR1 Deficiency Alleviates Liver Ischemia–Reperfusion Injury by Regulating Kupffer Cell Activation and Polarization Through the ERK/NF-κB Pathway in Mice

Abstract

Succinate regulates inflammation through its receptor, succinate receptor 1 (SUCNR1). However, the effects of this interaction on Kupffer cell (KC)-driven inflammation during liver ischemia–reperfusion injury (IRI) remain unclear. Herein, we investigated the succinate/SUCNR1 axis in the progression of liver IRI. In this study, succinate levels and SUCNR1 expression were analyzed in mice underwent segmental liver IRI. Sucnr1 deficiency (Sucnr1^−/−) and Wild-type mice were treated with or without clodronate before liver IRI modeling, and a co-culture system was established to assess the impact of Sucnr1 deficiency in KCs on hepatocyte viability and apoptosis. KC activation status and polarization were determined, in vivo and in vitro. Furthermore, the downstream pathways in regulating KC polarization were investigated. We observed a significant increase in succinate levels in the serum and liver, and SUCNR1 expression in KCs after IRI. Sucnr1 deletion alleviated liver IRI and hepatocyte apoptosis either in vivo or in vitro. However, the aforementioned hepatoprotective effects were abolished by the depletion of KCs with clodronate. Sucnr1 deletion inhibited KC activation and M1 polarization, and dampened proinflammatory cytokine release after liver IRI. In addition, Sucnr1 knockout reversed the increasing phosphorylation of ERK and NF-κB p65 in KCs following liver IRI. The phosphorylation of ERK/NF-κB p65 and M1 polarization in KCs were also inhibited by the SUCNR1 antagonist Compound 4C or ERK inhibitor SCH772984. Together, these findings suggest that SUCNR1 deficiency protects against liver IRI by modulating KC activation and polarization probably through the ERK/NF-κB pathway.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-025-02290-9.

Introduction

Liver ischemia–reperfusion injury (IRI) remains a significant problem in many clinical scenarios, such as hemorrhagic shock, trauma, liver resection, and transplant surgery. In particular, it is recognized as a risk factor predisposing recipients to early hepatic dysfunction or failure, thus causing high rates of morbidity and mortality [1, 2]. Unresolved liver inflammation significantly contributes to IRI in the liver. Kupffer cells (KCs), the resident macrophage population in the liver, are believed to be major initial drivers of hepatic inflammation, the activation of which is followed by enhanced production of proinflammatory cytokines and reactive oxygen species, resulting in the amplification of inflammatory cascades and acceleration of hepatocyte apoptosis during the early stage of liver IRI [3, 4]. Despite increasing attention toward this pathological process, the cellular and molecular mechanisms of KC activation-driven inflammation in liver IRI remain elusive.

The mitochondrial metabolite succinate might be a crucial mediator of inflammatory signaling [5–7]. Under normal conditions, succinate is generated from the tricarboxylic acid cycle in mitochondria, providing substrates for oxidative phosphorylation. However, intracellular succinate is released into the extracellular environment under conditions of ischemia, hypoxia, and oxidative stress [5, 8]. Abnormally accumulated succinate is emerging as a proinflammatory stimulus that regulates the immune response in several inflammatory disorders, including obesity, diabetes, rheumatoid arthritis, and inflammatory bowel disease [8–12].

Succinate selectively binds to its cognate receptor, G-protein coupled receptor 91 (GPR91), also called as succinate receptor 1 (SUCNR1). This crucial receptor is present on the plasma membrane of various types of cells, such as macrophages and other immune cells [10–13]. Activation of SUCNR1 by succinate exacerbates and sustains chronic inflammation in rheumatoid arthritis and obesity [10, 11]. Additionally, activation of SUCNR1 is crucial for the infiltration of macrophages and the inflammation of adipose tissue in obesity [10], and for promoting proinflammatory cytokine release, macrophage polarization, and fibroblast activation in the progression of intestinal inflammation and fibrosis [13]. In the liver, hepatic stellate cells have been reported to express SUCNR1, and the role of SUCNR1-mediated succinate signaling in the formation of hepatic fibrosis has been well established [14, 15]. However, the involvement of SUCNR1 in KC-driven inflammation during liver IRI has not been fully elucidated.

In the current work, we sought to determine whether succinate and SUCNR1 expression levels are upregulated in KCs after liver IRI and to investigate the possible role of SUCNR1 and underlying mechanisms using a murine model of liver IRI. Our findings revealed enhanced SUCNR1 expression on KCs and its pivotal role in KC activation during liver IRI, leading to the identification of SUCNR1 as a promising therapeutic target for liver IRI.

Materials and Methods

Animals

Eight-week-old wild-type (WT) and Sucnr1-deficient (Sucnr1^−/−) male mice of a C57BL/6 background were purchased from Cyagen Biosciences Inc. (Suzhou, China). All animals were housed in specific pathogen-free conditions, and all experimental procedures were conducted following the National Institutes of Health Guidelines for the Use of Laboratory Animals, with the approval of the Animal Care and Use Committee of University of South China (Hunan, China).

Liver IRI Model

As previously described, an animal model of partial (70%) hepatic IRI was established [16]. Briefly, WT and Sucnr1^−/− mice were anesthetized with 30 mg/kg sodium pentobarbital (intraperitoneally, i.p.). After a midline laparotomy, the structures within the portal triad, which include the hepatic artery, portal vein, and bile duct supplying the left and median liver lobes, were occluded using an atraumatic microvascular clip for 60 min to induce partial hepatic warm ischemia, and reperfusion was initiated by removing the clamp. Ischemia was confirmed by visualizing the blanching of ischemic lobes, and reperfusion was confirmed based on immediate color recovery. Body temperature was maintained at 37 °C using a warming pad and a heat lamp. The mice were anesthetized and sacrificed for blood and tissue collection at the end of the predetermined reperfusion period. In comparison, the mice in the sham group underwent the same procedure but without the induction of vascular occlusion.

To ablate endogenous KCs, a 200 μL suspension of liposomes containing clodronate (from Dr. N. Van Rooijen, VUMC, Amsterdam, The Netherlands) was injected (i.p.) 72 h before IRI, as described [17, 18]. Mice in the control group were treated with the same volume of phosphate-buffered saline (PBS)-containing liposomes before IRI. The depletion of KCs was assessed by immunohistochemical staining of liver sections for CLEC4F (C-type lectin domain family 4), a murine KC-specific marker [18, 19].

Histopathological Assessment

Liver samples were fixed in formalin, embedded in paraffin, and then cut into 5-μm-thick sections. The sections were stained with hematoxylin–eosin (HE), analyzed in a blinded manner, and graded on a scale of 0–4 using the Suzuki criteria for liver damage [20]. Sinusoidal congestion, hepatocyte necrosis, and ballooning were evaluated. The absence of necrosis, congestion, or ballooning was scored as 0, whereas severe congestion, ballooning, degeneration, and > 60% lobular necrosis were scored as 4.

Serum Alanine Aminotransferase (sALT) Assay

To assess liver function and hepatocyte injury following liver IRI, sALT activity was detected using a commercial kit (Jiancheng Bioengineering, Nanjing, China) according to the manufacturer’s instructions.

Succinate Colorimetric Assay

Concentrations of succinate in serum and liver tissue were determined using a Succinate Colorimetric Assay Kit (BioVision Inc., Milpitas, CA, USA) following the manufacturer's instructions.

Isolation of KCs and Hepatocytes

KCs and hepatocytes were isolated from mice as described [21]. The isolated liver tissues were cut into pieces, filtered, centrifuged, and digested with type IV collagenase (Sigma-Aldrich) and DNase I (Sigma-Aldrich) at 37 °C for 1 h. KCs and hepatocytes were separated from non-parenchymal cells using density gradient centrifugation and a Percoll gradient (75%, 25%). KCs were further purified by removing non-adherent cells after incubation for 6 h at 37 °C in 5% CO₂. The purity of KCs and hepatocytes was assessed under light microscopy, and cell viability was assessed using Trypan blue assays. KCs and hepatocytes were cultured in RPMI 1640 medium with 10% fetal bovine serum (FBS) and 1% streptomycin and penicillin.

Cell Treatment

KCs were incubated with 0.1, 0.5, 1, and 5 mM succinate (Sigma-Aldrich) or lipopolysaccharide (LPS; 1 μg/mL; Sigma-Aldrich) for 6 h, as reported previously [13, 22]. For some experiments, KCs were pretreated with Compound 4C (a GPR91 antagonist; 5 μM; MedChemExpress, Monmouth Junction, NJ, USA) and SCH772984 (an ERK inhibitor; 10 μM; Selleck Chemicals, Houston, TX, USA) for 24 h prior to stimulation with succinate (1 mM), based on the previous studies [22, 23].

Co-Culture Assay and Apoptosis Analysis

Alternatively, KCs obtained from ischemia livers in WT mice and Sucnr1^−/− mice were placed onto 0.4-μm Transwell membrane inserts (EMD Millipore, Danvers, MA, USA). Concurrently, hepatocytes were cultured in the wells of the plates for 24 h. After 24 h of co-culture, hepatocytes were harvested for apoptosis assays using Annexin-V-FITC Apoptosis Detection Kits (Vazyme Biotech Co., Ltd., Nanjing, China) following the manufacturer’s protocols. Annexin-V-positive cells were identified as apoptotic and counted using the FlowJo software (version 10.0, Tree Star Inc., Ashland, OR, USA).

Cell Viability and Lactate Dehydrogenase (LDH) Assays

A Cell Counting Kit-8 (CCK-8) (Vazyme Biotech Co., Ltd., Nanjing, China) was used to assess cell viability, and an LDH Assay kit (Jiancheng Bioengineering, Nanjing, China) was utilized to measure LDH activity in the culture medium. The cell viability and LDH activity were detected according to the manufacturer's instructions.

Flow Cytometry

For characterization of KCs, the following antibodies were used: Alexa Fluor 647 anti-mouse CLEC4F (BioLegend, San Diego, CA, USA); PE-cyanine5 anti-mouse CD40 (Clone 1C10), PE anti-mouse CD80 (Clone B7-1), FITC anti-mouse major histocompatibility complex class II (MHC II) (Clone M5/114.15.2), PE anti-mouse CD11c (Clone N418), APC anti-mouse CD206 (Clone MR6F3) (eBioscience, San Diego, CA, USA). Isolated KCs were stained with antibodies against surface antigens (CLEC4F, CD11c, CD40, CD80, and MHC-II) in PBS containing 2% FBS and intracellular antigens (CD206) in Intracellular Fixation & Permeabilization Buffer Set (BD Biosciences, San Jose, CA, USA). Appropriate rat IgG antibodies (eBioscience, San Diego, CA, USA) were used as isotype controls. After a 30-min incubation at 4 °C, the cells were washed with FBS staining buffer and assessed using a Fortessa XII cytometer (BD Biosciences, USA). Flow cytometry data were analyzed using the FlowJo Software.

Real-Time Quantitative Reverse Transcription PCR (RT-qPCR)

Total RNA was extracted from liver tissues and KCs using TRIzol reagent (Invitrogen). Complementary DNA was synthesized using PrimeScript RT Kits (Toyobo, Osaka, Japan) and amplified via RT-PCR using SYBR Green PCR Master Mix (Takara Bio Inc., Kusatsu, Japan) and a Bio-Rad iQ5 real-time PCR System (Bio-Rad Inc., Hercules, CA, USA). Relative gene expression levels were calculated using the ΔΔCt method, and gene expression was normalized against GAPDH. The primers utilized for amplifying the targeted genes are listed in Table 1.

Table 1.

The sequences of primers used for RT-qPCR

Gene	Forward (5’ → 3’)	Reverse (5’ → 3’)
Sucnr1 F4/80 Clec4f Vsig4 iNOS Cox-2 Arg1 Ym1 Tnf Il6 Il1b Il10 GAPDH	CATATCATGCGCAATTTGAGGA TTCCTGCTGTGTCGTGCTGTTC ACCAGGGCACAGAGGGCATC TGGTAAGACACGGCTCTGACTCC TTCTGTGCTGTCCCAGTGAG ATTCCAAACCAGCAGACTCATA CATATCTGCCAAAGACATCGTG CAGTGTTCTGGTGAAGGAAATG AGGGTCTGGGCCATAGAACT TGATGCACTTGCAGAAAACA TCGCAGCAGCACATCAACAAGAG TTCTTTCAAACAAAGGACCAGC AACTTTGGCATTGTGGAAGG	GCCGTGTCAGTGTGTATATAGA GCCGTCTGGTTGTCAGTCTTGTC TCTCGCTCTCCGTTCCTATGTCTC CAGGCGGCCTCTGTACTTTGC TGAAGAAAACCCCTTGTGCT CTTGAGTTTGAAGTGGTAACCG GACATCAAAGCTCAGGTGAATC ACCCAGACTTGATTACGTCAA CCACCACGCTCTTCTGTCTA ACCAGAGGAAATTTTCAATAGGC AGGTCCACGGGAAAGACACAGG ACCAGAGGAAATTTTCAATAGGC GGATGCAGGGATGATGTTCT

Enzyme-linked Immunosorbent Assay (ELISA)

Concentrations of TNF-α, IL-1β, IL-6, and IL-10 in murine liver tissues were measured using ELISA Kits (Boster Biotech, Wuhan, China) according to the manufacturer’s instructions. Results are expressed as picograms per milliliter (pg/mL).

Western Blot

Total proteins extracted from homogenized frozen liver tissues and KC pellets obtained from WT and Sucnr1^−/− mice were resolved by SDS-PAGE, transferred to PVDF membranes, and incubated with rabbit primary antibodies: anti-SUCNR1 (diluted 1:500; Novus Biologicals LLC., Littleton, CO, USA), anti-Caspase3 (1:1000; CST), anti-Cleaved-caspase3 (1:1000; CST), anti-p65 (1:500; CST), anti-p-p65 (1:500; CST), anti-ERK1/2 (1:1000; CST), anti-p-ERK1/2 (1:1000; CST), anti-p38 (1:1000; CST), anti-p-p38(1:1000; CST), anti-JNK1/2 (1:500; CST) and anti-p-JNK1/2 (1:500; CST) overnight at 4 °C. The membranes were carefully washed and then treated with a secondary HRP-conjugated mouse antibody (Proteintech Group Inc., Rosemont, IL, USA). The internal control was β-actin (Sigma-Aldrich Corp.), and blots were quantified using the ImageJ software (version 1.52a, NIH, Bethesda, MD, USA).

Immunohistochemical (IHC) Staining

Liver tissue specimens were preserved with 2% paraformaldehyde overnight, embedded in paraffin, and frozen at an optimal cutting temperature. Sections were cut into 6-μm-thick slices and incubated with primary antibodies targeting rat anti-mouse CLEC4F (1:600; R&D Systems), VISG4 (1:400; R&D Systems), F4/80 (1:200; Abcam), iNOS (1:100; Abcam), Arg1 (1:100; Abcam), TNF-α (1:200; Abcam), IL-6 (1:100; Abcam), IL-1β (1:500; Abcam) and IL-10 (1:100; Abcam) followed by incubation with secondary antibodies (Abbkine Scientific Co., Beijing, China).

Immunofluorescence

For KC detection, sections were incubated with rat anti-mouse CLEC4F (diluted 1:1000; R&D Systems) together with a rabbit polyclonal anti-SUCNR1 primary antibody (diluted 1:200; Novus Biologicals LLC). Subsequently, they were incubated with a secondary goat anti-rabbit IgG H&L antibody (diluted 1:2000; Abcam). All slides were visualized using an Olympus BX63 microscope and analyzed using the ImageJ software.

Terminal Deoxynucleotidyl Transferase dUTP-biotin Nick End Labeling (TUNEL) Assay

Samples were dewaxed, incubated with proteinase K, and then stained using a red fluorescence TUNEL kit (Roche, Penzberg, Germany) as described by the manufacturer. Nuclei were visualized with DAPI, and apoptotic cells appeared red on a blue background and were analyzed using the ImageJ software.

Statistical Analysis

All values are expressed as mean ± SEM. Comparisons between the two groups were conducted using unpaired Student t-tests, and multiple comparisons were performed using one-way analysis of variance (ANOVA) followed by post hoc Bonferroni’s tests as appropriate. Statistical analyses were performed using GraphPad Prism Software (version 9.0, La Jolla, CA, USA). Differences were considered significant at P < 0.05.

Results

Hepatic Succinate Levels and SUCNR1 Expression in KCs Increased After Liver IRI in Mice

We first analyzed succinate and SUCNR1 levels in the livers of mice after partial hepatic IRI. Liver succinate levels significantly increased after 1 h of ischemia followed by 6 h of reperfusion compared with sham-operated mice (Fig. 1A). In parallel, serum succinate levels were significantly higher in mice after IRI than sham surgery (Fig. 1B). The mRNA expression of Sucnr1 was remarkably increased in liver tissues of IRI, compared with sham-operated mice (Fig. 1C). Additionally, levels of the SUCNR1 protein were upregulated in the livers of the IRI group (Fig. 1D). Immunofluorescence staining revealed that SUCNR1 is co-localized with CLEC4F, the specific surface protein expressed on KCs but absent on other hepatic macrophages [19, 20]. The SUCNR1⁺CLEC4F⁺ cells were primarily localized within the hepatic sinusoids that surrounding the central veins, a characteristic distribution pattern of KCs. Moreover, the proportion of SUCNR1 co-localized with CLEC4F was significantly increased after liver IRI, further confirmed SUCNR1 localization to the cellular membrane of KCs (Fig. 1E).

Fig. 1.

Hepatic succinate levels and SUCNR1 expression increased after liver ischemia–reperfusion injury (IRI) in mice. C57BL/6 mice were subjected to 60 min of liver ischemia followed by 1, 6, or 24 h of reperfusion as indicated. Control mice were sham-operated. (A) Succinate levels in liver tissues increased after IRI. (B) Succinate levels in serum increased after IRI. (C) Sucnr1 mRNA expression in liver tissues was upregulated after IRI (n = 6). (D) Representative western blots of liver tissues show increased SUCNR1 protein levels after IRI (n = 3). (E) Representative immunofluorescence images show the co-localization of SUCNR1- and CLEC4F-positive cells in liver tissues. The double-positive cells are located within the hepatic sinusoids (indicated by the white triangle) surrounding the central venous (indicated by the white asterisk). Proportions of SUCNR⁺CLEC4F⁺ cells increased after IRI (n = 3). Bar = 50 µm. Results are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Deletion of Sucnr1 Ameliorates Liver IRI

Mice with Sucnr1 knockout (KO) and WT mice underwent liver IRI, and damaged liver tissues were harvested. Histopathological results revealed that liver IRI induced liver tissue necrosis in mice of both groups; the area of hepatocellular necrosis was remarkably reduced in Sucnr1^−/− mice compared with WT mice (Fig. 2A). Livers from Sucnr1^−/− mice had lower histological scores, with less lobe edema, congestion, ballooning, and necrosis (Fig. 2A). In agreement with these findings, Sucnr1 deletion inhibited the sALT elevation caused by IRI (Fig. 2B). No significant differences were observed in sALT levels and histopathological characteristics between Sucnr1^−/− mice and WT mice that underwent a sham operation.

Fig. 2.

Deletion of Sucnr1 alleviated liver ischemia–reperfusion injury (IRI) and hepatocyte apoptosis. Wild-type (WT) and Sucnr1^−/− mice underwent 60 min of ischemia followed by 6 h of reperfusion. (A) Representative images of hematoxylin–eosin (HE)-stained liver sections. Liver damage was quantified using Suzuki’s scores (n = 6).Bar = 200 µm. (B) Serum ALT levels reflect liver function and hepatocellular injury (n = 6). (C) Intrahepatic apoptosis was measured by TUNEL assay. Representative fluorescent sections are shown (red spots with DAPI-stained blue background represent TUNEL-positive cells) (n = 3). Bar = 200 µm. (D) Representative western blots of Cleaved caspase 3 and Caspase 3 in liver tissues after IRI, and relative protein expression ratio of Cleaved caspase 3 to Caspase 3 was evaluated in each group (n = 3). (E–G) In vivo, hepatocytes were cultured without Kupffer cells (KCs) (the Control) or co-cultured with KCs isolated from Sucnr1^−/− mice (the Sucnr1^−/− group) and WT mice (the WT group) after IRI. The percentage of apoptotic hepatocytes (E) was increased under co-culture with KCs from WT mice after liver IRI and alleviated under co-culture with KCs from Sucnr1^−/− mice after liver IRI (n = 3). Relative cell viability (F) and relative lactate dehydrogenase (LDH) activity (G) of hepatocytes under co-culture with KCs from WT mice and Sucnr1^−/− mice after liver IRI (n = 6). Results are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Deletion of Sucnr1 in KCs Suppressed Hepatocyte Apoptosis

We observed a significantly decreased number of TUNEL-positive cells (Fig. 2C) and a markedly increased ratio of Cleaved caspase-3 to Caspase-3 (Fig. 2D) in liver tissues from Sucnr1^/− mice compared to WT mice, indicating the absence of Sucnr1 reduced liver cell apoptosis. To further investigate whether the deletion of Sucnr1 in KCs could affect hepatocyte apoptosis, hepatocytes were cultured without KCs (the control) or co-cultured with KCs isolated from Sucnr1^−/− mice (the Sucnr1^−/− group) and WT mice (the WT group) following IRI. The results revealed that Sucnr1-deficient KCs induced lesser hepatocyte apoptosis than intact KCs from WT mice (Fig. 2E). In addition, Sucnr1 absence in KCs increased cell viability and decreased LDH levels among hepatocytes (Fig. 2F, G).

SUCNR1 Contributes to Liver IRI in a KC-Dependent Manner

To investigate whether the hepatoprotection of Sucnr1 deficiency specifically relies on SUCNR1 on KCs and not on other cell types, we depleted KCs in WT and Sucnr1^−/− mice using liposome-encapsulated clodronate prior to IRI. Control mice were administered liposomes containing PBS. The number of CLEC4F-positive KCs was substantially reduced in liver sections from both Sucnr1^−/− and WT mice after clodronate pretreatment (Fig. 3A, C), indicating that KCs were successfully depleted. As expected, clodronate significantly reduced liver damage and resulted in lower Suzuki’s scores with diminished areas of hepatocellular necrosis after IRI compared with the vehicle in both Sucnr1 KO and WT mice (Fig. 3 A, B). Furthermore, sALT levels were considerably lower than those in vehicle group mice (Fig. 3D). These findings indicate that KCs are essential for the protective role of Sucnr1 deficiency against liver IRI in mice.

Fig. 3.

The critical role of SUCNR1 on Kupffer cells (KCs) in liver ischemia–reperfusion injury (IRI). Wild-type (WT) and Sucnr1^−/− mice were injected with clodronate or vehicle 72 h before ischemia, and samples were harvested after 6 h of reperfusion. Naïve WT mice served as control without any treatment. (A) Representative images of hematoxylin–eosin (HE)-stained liver sections. Immunohistochemical (IHC) staining of CLEC4F shows the efficiency of KC depletion in the liver. (B) Suzuki’s scores (n = 6). Bar = 200 µm. (C) Ratios (%) of CLEC4F-positive cells (n = 3). (D) Serum AST values from WT and Sucnr1^−/− mice were measured after 6 h of reperfusion (n = 6). Results are presented as mean ± SEM. **P < 0.01, ***P < 0.001

Deletion of Sucnr1 Attenuates KC Activation After Liver IRI

To further characterize the effect of Sucnr1 deficiency in KCs after liver IRI, we isolated KCs from IRI livers and analyzed the expression of costimulatory molecules on the surface by flow cytometry. We observed far fewer KCs from Sucnr1^−/− than WT mice that expressed CD40, CD80, and MHC II (Fig. 4A).

Fig. 4.

Deletion of Sucnr1 inhibits the activation of Kupffer cells (KCs) following liver ischemia–reperfusion injury (IRI). (A) Expressions of CD40, CD80, and MHC II in KCs from wild-type (WT) and Sucnr1^−/− mice after liver IRI were analyzed by flow cytometry (n = 3). (B) Expressions of F4/80, CLEC4F, and VSIG4 in liver tissues from WT and Sucnr1^−/− mice after liver IRI was evaluated through immunohistochemical staining (n = 3). Scale bar = 200 µm. (C) Primary KCs were incubated with various concentrations of succinate or stimulated with LPS (1 μg/mL) for 6 h. The mRNA expression of KC markers (F4/80, Clec4f, and Vsig4) was analyzed (n = 5). (D) Primary KCs from WT and Sucnr1^−/− mice stimulated with succinate or LPS (1 μg/mL) for 6 h. Relative mRNA expression of KC markers (F4/80, Clec4f, and Vsig4) was analyzed (n = 5). Results are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

KCs are characterized by specific surface markers such as F4/80, CLEC4F and VSIG4 (V-set and immunoglobulin domain containing 4), distinguishing them from other hepatic macrophages that may lack or have not yet acquired these markers [19, 20]. Our results revealed a marked increase in the number of F4/80-, CLEC4F- and VSIG4-positive cells in Sucnr1^−/− mice compared with WT mice (Fig. 4B). In vitro, we incubated KCs with various concentrations of succinate or LPS to assess the immunomodulatory effect of succinate on KCs. Consistent with the LPS effects, succinate significantly increased the mRNA expression of the KC markers F4/80, Clec4f, and Vsig4 (Fig. 4C). However, succinate and LPS failed to induce the expression of F4/80, Clec4f, and Vsig4 in KCs when from Sucnr1 KO mice (Fig. 4D). Taken together, these observations demonstrate that succinate and its receptor SUCNR1 are required for the accumulation and activation of KCs following liver IRI.

Deletion of Sucnr1 Inhibits M1 Polarization of KCs and Proinflammatory Cytokine Release After Liver IRI

It is widely accepted that the contribution of macrophages to liver damage is inextricably linked to macrophage polarization and the resulting M1 proinflammatory or M2 anti-inflammatory phenotypes [24, 25]. Thus, we investigated the effect of SUCNR1 on KC polarization in vivo and in vitro. We observed that the number of Arg1- and iNOS-positive cells significantly increased and decreased, respectively, in Sucnr1^−/− mice compared with WT mice (Fig. 5A). The Sucnr1-deficient mice harbored a substantially higher ratio of CD11c⁻CD206⁺ KCs and significantly fewer CD11c⁺CD206⁻ KCs than WT mice after liver IRI (Fig. 5B). In addition, Sucnr1^−/− animals exhibited significantly lower expression levels of M1 markers (iNOS and Cox-2) and considerably higher levels of M2 markers (Arg1 and Ym1) (Fig. 5C). In vitro, succinate caused an increase in M1 markers and a decrease in M2 markers in KCs from WT mice but not in KCs from Sucnr1^−/− mice (Fig. 5D). Therefore, the deletion of Sucnr1 inhibits KC M1 polarization and shifts the polarization of KCs toward the M2 phenotype in the progression of liver IRI.

Fig. 5.

Deletion of Sucnr1 inhibits M1 polarization of Kupffer cell (KC) following liver ischemia–reperfusion injury (IRI). (A) Polarization of KCs was assessed by immunohistochemical staining for iNOS and Arg1 in Wild-type (WT) and Sucnr1^−/− mice with or without liver IRI (n = 3). Bar = 200 µm. (B) Sucnr1 deficiency decreased the ratio (%) of M1 KCs (CD11c⁺ CD206⁻) and increased that of M2 KCs (CD11c⁻ CD206⁺) (n = 3). (C, D) Relative mRNA expression of M1 markers (iNOS and Cox2) and M2 markers (Arg1 and Ym1) in WT and Sucnr1^−/− mice with or without liver IRI (C) (n = 6) and in WT and Sucnr1^−/− KCs stimulated with succinate or LPS (1 μg/mL) for 6 h (D) (n = 5). Results are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

In addition, the IHC staining of liver tissues revealed that the absence of Sucnr1 reduced the number of positive cells for pro-inflammatory cytokines (TNF-α, IL-6, and IL-1β), while concurrently increasing those for the anti-inflammatory cytokine (IL-10) in Sucnr1^−/− mice compared with WT mice (Fig. 6A). Similarly, there was a significant reduction in the secretion of TNF-α, IL-6, and IL-1β, along with an increase in IL-10 levels in Sucnr1^−/− mice compared with WT mice (Fig. 6B). In vitro, succinate or LPS stimulation resulted in significantly lower expression of Tnf, Il6, and Il1b and higher expression of Il10 in KCs from WT mice but not in those from Sucnr1^−/− mice (Fig. 6C). Collectively, these findings suggest that Sucnr1 deficiency attenuates the release of pro-inflammatory cytokines following liver IRI.

Fig. 6.

Deletion of Sucnr1 inhibits proinflammatory cytokine release following liver ischemia–reperfusion injury (IRI). (A) Expressions of cytokines (TNF-α, IL-6, IL-1β and IL-10) in liver tissues from WT and Sucnr1^−/− mice mice after liver IRI was analyzed by immunohistochemical staining (n = 3). Scale bar = 200 µm. (B) Concentrations of cytokines (TNF-α, IL-6, IL-1β and IL-10) in liver tissues from WT and Sucnr1^−/− mice with or without liver IRI (n = 6). (C) Relative mRNA expression levels of cytokines (Tnf, Il6, Il1b and Il10)) genes in WT and Sucnr1^−/− KCs stimulated with succinate or LPS for 6 h (n = 5). Results are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

SUCNR1 Mediated KC Polarization Following Liver IRI Through the ERK/NF-κB Signaling Pathway

This study further explored the downstream molecular pathways of SUCNR1 in regulating KC polarization in our model. Previous studies have shown that nuclear factor kappa B (NF-κB) and the mitogen-activated protein kinase (MAPK) signaling (JNK, p38, and ERK) are crucial in modulating macrophage activation, metabolism, and polarization [26, 27]; meanwhile, these signaling cascades might be triggered upon SUCNR1 activation [5]. In this study, liver IRI led to the overexpression of phosphorylated ERK and phosphorylated NF-κB p65 subunit in KCs obtained from WT mice (Fig. 7A), as well as in liver tissues (Supplemental Fig. 1). However, the JNK and p38-MAPK pathways were not activated (Supplemental Fig. 1 and and Supplemental Fig. 2 A), indicating that MAPK pathway activation is selective. The phosphorylation of ERK and p65 was inhibited in KCs obtained from IRI-treated Sucnr1^−/− mice (Fig. 7A), and in corresponding liver tissues (Supplemental Fig. 1).

Fig. 7.

SUCNR1 mediated Kupffer cell (KC) polarization following liver ischemia–reperfusion injury (IRI) via the ERK/NF-κB signaling pathway. (A) Protein expression was detected by Western Blot taken from KCs in Wild-type (WT) and Sucnr1^−/− mice with or without liver IRI (n = 3). (B-D) KCs from WT mice were pretreated with Compound 4C (GPR91 antagonist, 5 μM) and SCH772984 (SCH; ERK inhibitor; 10 μM) 24 h prior to stimulation with succinate (1 mM), and the expression of KC protein levels was detected by Western Blot (B) (n = 3), and the mRNA expression of M1-related genes (C) and pro-inflammatory genes (D) were measured by real-time polymeric chain reaction (n = 5). Hepatocytes were co-cultured with WT mice-derived KCs that pretreated with Compound 4C and SCH772984 before stimulation with succinate. The percentage of apoptotic hepatocytes (E) (n = 3), cell viability of hepatocytes (F) (n = 6), and LDH activity were determined (G) (n = 6). Results are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Subsequently, we treated KCs from WT mice with Compound 4C (a GPR91 antagonist) and SCH772984 (an inhibitor of ERK) before stimulation with succinate. We found that Compound 4C or SCH772984 did not alter the expression of the SUCNR1 protein in succinate-treated KCs (Supplemental Fig. 2 B). However, Compound 4C reversed the succinate-induced increase of phosphorylated ERK and p65 levels, and SCH772984 reversed the succinate-induced increased of phosphorylated p65 levels in KCs (Fig. 7B). Furthermore, we found that Compound 4C and SCH772984 inhibited succinate-induced mRNA upregulation of M1-related markers (iNOS and Cox2) (Fig. 7C) and proinflammtory genes (Tnf, Il6, and Il1b) in KCs (Fig. 7D). In addition, when co-cultured with WT mice-derived KCs that pretreated with these pharmaceutical inhibitors, the cell viability of hepatocytes increased, and hepatocyte apoptosis as well as LDH levels reduced (Fig. 7E-G). Taken together, the ERK/NF-κB signaling pathway participated in succinate-SUCNR1 axis-induced KC activation and polarization following liver IRI.

Discussion

The current study identified SUCNR1 as a key player in modulating KC-driven inflammation during liver IRI for the first time. We observed increased levels of succinate in the sera and livers of mice and enhanced expression of SUCNR1 in KCs after liver IRI. Moreover, our results supported the involvement of SUCNR1 in the activation and polarization of KCs. SUCNR1 deficiency reduced liver inflammation and hepatocyte apoptosis by inhibiting KC activation and M1 polarization following liver IRI. Furthermore, we discovered that the ERK/NF-κB signaling pathway is involved in the SUCNR1-mediated KC activation and M1 polarization following liver IRI. These findings indicated that SUCNR1-mediated KC activation and polarization plays a crucial role in the development of liver IRI in mice.

SUCNR1, also known as GPR91, is a plasma membrane G-protein-coupled receptor widely expressed in the kidneys, intestine, liver, and adipose tissues, as well as in immune cells such as dendritic cells and macrophages [10, 13, 28]. In the present study, we investigated the expression of SUCNR1 on KCs in mice. As expected, we found that SUCNR1 co-localizes with CLEC4F, a surface protein specifically expressed on KCs. The SUCNR1⁺ CLEC4F⁺ cells were predominantly located within the liver sinusoids and exhibited the distribution characteristic of KCs. Furthermore, the proportion of these cells significantly increased after IRI. We have also observed a significant increase in the expression of SUCNR1 in liver tissues after IRI, along with an increase in succinate levels in the livers and sera of mice that underwent liver IRI. Emerging evidence has suggested that succinate not only serves as a metabolic intermediate but also a proinflammatory mediator that actively participates in tissue-specific and systemic inflammatory responses [6–8]. Therefore, we speculate that the presence of various stimuli, such as ischemia, hypoxia, and oxidative and metabolic changes resulting from liver ischemia and secondary reperfusion insults, could accelerate the release of succinate into the extracellular microenvironment. The accumulation of extracellular succinate triggers the activation of SUCNR1 on KCs, and the succinate-SUCNR1 interaction on KCs subsequently exacerbates the inflammation in the progression of liver IRI. However, it is essential to recognize that SUCNR1 can be activated by other potential ligands, such as maleate and methylmalonate [29, 30]. Therefore, understanding of the succinate-SUCNR1 interaction on KCs, the roles of these alternative ligands, and the detailed molecular mechanisms involved in SUCNR1 activation is essential for unraveling the complex regulatory network of inflammation in liver IRI.

The activation of KCs is a crucial step for triggering and accelerating liver inflammation in IRI [3, 4]. We further investigated the role of SUCNR1 in regulating liver IRI using Sucnr1^−/− mice. Deficiency in Sucnr1 protected against liver IRI, as shown by the attenuation of lobe congestion, edema, and hepatocellular necrosis, as well as lower histological scores, sALT levels, and liver cell apoptosis in Sucnr1^−/− mice. Our in vitro experiments further supported this, which showed that hepatocellular apoptosis was reduced in co-cultures with Sucnr1-deficient KCs obtained from Sucnr1-deficient mice after IRI. Following the depletion of KCs with clodronate, we observed a significant reduction in IRI liver histological damage and sALT levels both in WT and Sucnr1^−/− mice, which further supported a crucial role of SUCNR1 in KCs, rather than stellate cells or other immune cells, in triggering liver IRI. Although clodronate-liposomes target mainly KCs, the effects of KC depletion on liver IRI are controversial in literature findings [31–33]. Studies using clodronate to deplete KCs have shown both exacerbation of liver IRI with enhancement of liver inflammatory immune response [31, 32], as well as protection of livers from IRI [33]. The different types of liver IRI models and duration of action may be responsible for the inconsistency in our results. In addition, accumulating evidence from transgenic studies has confirmed that SUCNR1 is critically essential for the infiltration and activation of macrophages in adipose tissues, intestine, and lung tumors [10, 13, 28]. In the present study, we found that the absence of Sucnr1 inhibited KC activation and decreased the expression of costimulatory molecules on the surface of KCs, as reflected by the reduced levels of CD40, CD80, and MHC II on KCs isolated from Sucnr1-deficient mice following IRI. In vitro, succinate induced a dose-dependent increase in mRNA and protein expression of specific markers KCs, CLEC4F, and VSIG4. Conversely, the succinate-induced upregulation of CLEC4F and VSIG4 was abolished in KCs from Sucnr1^−/− mice. These results strongly suggest that SUCNR1 functions in activating KCs in the progression of liver IRI.

The M1/M2 polarization status of KCs is linked to the progression of liver IRI [34, 35]. As macrophages in other tissues, KCs have the capability to be activated and polarized into M1 proinflammatory and M2 anti-inflammatory phenotypes in response to diverse microenvironmental stimuli. We found that Sucnr1 deficiency reduced the levels of M1 markers (iNOS and Cox-2) and proinflammatory cytokines (TNF-α, IL-6, and IL-1β) while increasing those of M2 markers (Arg1 and Ym1) and anti-inflammatory cytokines (IL-10). Moreover, the absence of Sucnr1 led to a decrease in the number of M1 KCs and an increase in the number of M2 KCs. These findings confirmed that Sucnr1 modulated KC polarization, both in vivo and in vitro. Our data are in line with those of previous studies in which SUCNR1 activation promoted the release of proinflammatory cytokines and M1-related gene expression in intestinal macrophages, whereas the absence of Sucnr1led to a shift in polarization toward the M2 phenotype and protected mice from colitis induced by trinitrobenzene sulfonic acid [10]. However, a recent study showed that cancer cell-derived succinate polarized tumor-associated macrophages into a suppressive M2 phenotype via SUCNR1, and the absence of Sucnr1 led to a lack of anti-inflammatory M2 macrophages [28]. It seems likely that the SUCNR1-mediated regulation of macrophage polarization and inflammation is probably cell-type-dependent. Overall, we can conclude that a deletion of Sucnr1 significantly reduced liver inflammation and protected the liver from IRI by regulating KC polarization.

We further investigate the underlying molecular mechanisms of SUCNR1-mediated KC polarization during liver IRI. The MAPK and NF-κB pathways could be activated by various extracellular and intracellular stimuli (cytokines, hormones, ischemia, and hypoxia), including extracellular succinate interacting with SUCNR1 [5, 22, 36, 37]. In addition, these classical signaling pathways have been shown to regulate metabolic reprogramming of macrophages and macrophage polarization [26, 27]. Previous studies showed that SUCNR1 activation could induce NF-κB signaling activation in osteoclasts [22], and the phosphorylation of ERK in kidney cells [38]. In the current study, we observed that ERK and NF-κB pathways were activated in KCs after liver IRI or KCs treated with succinate in vitro, and when SUCNR1 knockout or inhibited with Compound 4C, the phosphorylation levels of ERK and NF-κB were reduced. Furthermore, we discovered that blocking SUCNR1 or pharmacological inhibitors of ERK inhibited NF-κB p65 expression, M1 polarization of KC, proinflammatory cytokine levels, and hepatocyte apoptosis. These data suggested that SUCNR1 regulates KC polarization partially through the ERK/NF-κB signaling pathway. However, it remains unclear whether other SUCNR1-activated signaling pathways are involved in the KC polarization process during liver IRI [28, 39]; further investigation is required. Additionally, the complex interactions and crosstalk between the downstream MAPK and NF-κB signaling pathways in the context of SUCNR1 activation require further exploration.

The present study has several limitations. First, we have not analyzed the concentration of succinate and SUCNR1 expression in human samples. Further investigations are required to prove the clinical relevance of the findings in this research. Second, recent evidence showed that succinate acts as an important metabolite of the gut microbiota [40, 41], and the gut microbiota and its metabolites play a crucial role in the pathogenesis and development of acute liver injury and metabolic liver disease [42, 43]. Therefore, the role of the gut microbe-derived succinate deserves further research. Third, it was demonstrated that SUCNR1 on hepatocytes, even if mainly expressed on KCs, is involved in liver pathophysiology [44]. The present study did not investigate the role of SUCNR1 on hepatocytes in liver IRI injury and survival in mice. In addition, the impact of SUCNR1 deficiency on other forms of hepatocyte cell death, such as necroptosis and pyroptosis, has not been well explored [45, 46]. Finally, future research that includes the conditional deletion of Sucnr1 in KCs will be crucial in elucidating the specific role of this receptor in liver IRI.

Conclusion

In conclusion, this study demonstrated that SUCNR1 is crucial in liver IRI, probably by modulating inflammation through KC activation and polarization via the ERK/NF-κB signaling pathway. Additionally, our study showed that a deletion of Sucnr1 protects mice from liver IRI. Therefore, interference with SUCNR1 function and its downstream signaling pathway might offer appealing therapeutic approaches to prevent liver IRI and other inflammatory diseases involving macrophages.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contributions

All authors contributed to the study conception and design. Conceptualization, funding acquisition, methodology, supervision, Y.W.; Investigation, H.Y., A.W., X.Z., and Z.C.; Data curation, Z.C.; Writing-original draft preparation, H.Y., A.W.; Writing-review and editing, Y.W. . All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Natural Science Foundation of Hunan Province, China (2024JJ5354; 2020JJ5509), the Scientific and Technology Research Projects of Health Commission of Hunan Province (202104110007), the scientific research project of Hunan Provincial Education (21C0300), and Hengyang Guided Science and Technology Project (202121034639).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval and Consent to Participate

This study was performed in line with the National Institutes of Health Guidelines for the Use of Laboratory Animals. Approval was granted by the Animal Care and Use Committee of University of South China.

Patient Consent for Publication

Not applicable.

Competing Interests

The authors declare no competing interests.