IRGM Inhibits the AKT/mTOR Signaling Pathway by Interacting with TRIM21 to Alleviate Sepsis-Induced Acute Lung Injury

Abstract

Acute lung injury (ALI) is a severe complication of sepsis, and its underlying pathological mechanisms remain poorly understood. This study aims to investigate the role and mechanisms by which IRGM mediates autophagy through the regulation of the AKT/mTOR signaling pathway in sepsis-induced ALI. Initially, a sepsis-induced ALI mouse model was established using cecal ligation and puncture (CLP). Our results demonstrated that Irgm1 expression was significantly upregulated in the ALI model. Subsequently, Irgm1 was knocked down in vivo using AAV vectors, and changes in ALI symptoms were assessed. In vitro, a sepsis-induced ALI cell model was generated by stimulating A549 cells with lipopolysaccharide (LPS). The effects of IRGM overexpression on autophagy and apoptosis were evaluated, and its impact on the AKT/mTOR signaling pathway was analyzed. Furthermore, mass spectrometry and co-immunoprecipitation (COIP) experiments were conducted to explore the interaction between IRGM and TRIM21. In vivo results showed that Irgm1 knockout exacerbated CLP-induced ALI, as evidenced by a significant reduction in autophagic activity, increased apoptosis, and aberrant activation of the AKT/mTOR pathway. Further cellular experiments suggested that IRGM may enhance autophagy by inhibiting the AKT/mTOR signaling pathway, thereby attenuating LPS-induced cell damage. Additionally, COIP experiments revealed that IRGM interacts with TRIM21 to inhibit AKT/mTOR pathway activation, thereby promoting autophagy and mitigating sepsis-induced ALI. In conclusion, IRGM regulates autophagy through the AKT/mTOR signaling pathway and exerts protective effects in sepsis-induced ALI, suggesting that it may serve as a potential therapeutic target for sepsis-related ALI.

Introduction

Sepsis, triggered by uncontrolled infections, leads to multi-organ failure and is associated with high mortality rates [1]. Acute lung injury (ALI), characterized by severe acute inflammatory responses in the lungs, is a serious complication of sepsis, potentially resulting in non-cardiogenic pulmonary edema, hypoxemia, and even death [2, 3]. Studies indicate that approximately 40% of ALI cases are sepsis-related [4, 5]. Despite considerable efforts, effective treatment options for ALI remain exceedingly limited [6]. To improve therapeutic strategies, a deeper understanding of the underlying mechanisms of ALI is essential. Extensive evidence from both animal models and human studies demonstrates that autophagy plays a crucial role in the onset and progression of sepsis-induced multi-organ dysfunction and injury [7, 8].

Autophagy is a process in which cytoplasmic components are encapsulated by double-membraned vesicles to form autophagosomes, which are then transported to lysosomes for degradation. It plays a crucial role in maintaining cellular metabolism, homeostasis, and genomic integrity [9–11]. Under conditions of stress, such as hypoxia, nutrient deprivation, infection, and oxidative stress, autophagy provides essential energy for cellular metabolic activities and survival [12]. Research by Saitoh et al. [13] showed that macrophages deficient in the autophagy-related protein Atg16L1 (autophagy-related protein 16-like 1) produced significantly higher levels of the inflammatory cytokines interleukin (IL)−1β and IL-18 after lipopolysaccharide (LPS) stimulation compared to wild-type cells. This finding highlights the important role of autophagy in regulating endotoxin-induced inflammatory responses. Cellular autophagy is regulated by various signaling pathways, among which the AKT/mTOR pathway has been shown to be closely involved in the autophagic process [14]. Qu et al. [15] demonstrated that glycyrrhizin (GA) ameliorated LPS-induced ALI by regulating autophagy through inhibition of the AKT/mTOR signaling pathway. Additionally, other studies have indicated that autophagy plays a protective role in hyperoxia-induced lung injury [16]. Therefore, modulation of autophagy via the AKT/mTOR signaling pathway may offer a novel approach for the treatment of sepsis-induced ALI.

Immunity-related GTPase M (IRGM) and its murine homolog Irgm1 are key members of the GTPase family [17], and both share a high degree of similarity in regulating autophagic functions [18]. Previous studies have shown that the expression of IRGM is closely associated with the induction and execution of autophagy during bacterial infections, such as tuberculosis, and that its expression levels correlate positively with autophagic formation [19]. Furthermore, genetic polymorphisms of IRGM have been implicated in the pathogenesis of inflammatory bowel disease and play a critical role in autophagic regulation [20]. Further research has revealed that IRGM regulates autophagy under conditions of nutrient deprivation and bacterial or viral infections by inhibiting the mTOR signaling pathway [21]. While the significant role of IRGM in various inflammatory and autoimmune diseases has been extensively studied, its specific function and underlying mechanisms in sepsis-induced ALI remain unclear.

To further elucidate its mechanism of action, we employed immunoprecipitation coupled with mass spectrometry to identify TRIM21 as a potential interacting protein of IRGM. Previous studies have demonstrated that TRIM21 can modulate the activity of the AKT signaling pathway [22]. Therefore, this study aims to investigate the interaction between IRGM and TRIM21 and explore how this interaction regulates sepsis-induced ALI through the AKT/mTOR signaling pathway, providing new theoretical insights for the pathophysiological understanding of ALI.

Materials and Method

Microarray Analysis

Three gene expression profiles (GSE2411, GSE18341, and GSE60088) were downloaded from the GEO database, with all data generated from control lung tissue samples and sepsis-induced ALI samples. Microarray data were integrated and data processing were performed using R software with the limma package. Differentially expressed genes (DEGs) were defined as |log2 (Fold Change)|> 1 and a P value < 0.05, which were then intersected to obtain the overlapped DEGs.

Establishment of Animal Models

Male C57BL/6 J mice, aged 6–8 weeks, were purchased from the Laboratory Animal Center of Lanzhou University and housed under specific pathogen-free (SPF) conditions with a controlled environment (temperature: 22 °C ± 1 °C, humidity: 60% ± 10%, 12-h light/dark cycle). Mice had free access to food and water. All animal experiments were approved by the Animal Welfare Committee of the First Hospital of Lanzhou University (Approval No: LDYYLL2024-400). After a one-week acclimation period, mice were randomly divided into four groups (n = 6 per group): Sham, CLP, CLP + AAV-NC, and CLP + AAV-shIrgm1. In the CLP + AAV-NC and CLP + AAV-shIrgm1 groups, AAV-shIrgm1 and its control AAV-NC vector were administered via tail vein injection, respectively. The viral vectors and control constructs were synthesized and packaged by Jikai Gene (Shanghai, China), with a viral titer of 10^10/mL. Four weeks after viral injection, CLP-induced sepsis model was established as described in the literature [23]. Mice were anesthetized with intraperitoneal injection of 1% pentobarbital sodium (50 mg/kg). The cecum was ligated approximately one-third of the distance from its tip using 3/0 silk thread, and two punctures were made with a 21-gauge needle to gently extrude the intestinal contents. The cecum was then repositioned, the abdominal incision was sutured in layers, and final disinfection was performed. Mice in the Sham group underwent identical procedures, excluding cecal ligation and puncture. Following the CLP surgery, all mice received subcutaneous injection of saline (50 mL/kg) for fluid resuscitation. At 24 h post-surgery, all mice were euthanized under anesthesia, and tissue samples were collected for subsequent analysis.

Hematoxylin and Eosin (H&E) Staining

Mice were euthanized 24 h after CLP surgery. The left lung lower lobe was harvested and fixed in 4% paraformaldehyde for 24 h. After fixation, the lung tissue was embedded in paraffin and sectioned into 5 μm thick slices. H&E staining was performed, with hematoxylin staining for 10 min and eosin staining for 3 min, both at 25 °C. The morphological changes of the lung tissue were examined under a microscope, and the histopathological lung injury score was assessed according to previously established methods [24, 25].

Immunohistochemical Staining

Paraffin blocks were prepared and sectioned into 5 μm thick slices, followed by deparaffinization and rehydration. The sections were incubated with 3% hydrogen peroxide at room temperature for 10 min to quench endogenous peroxidase activity, followed by washing with PBS. Antigen retrieval was performed under high temperature and pressure, and after another PBS wash, the primary antibody was applied. After PBS washing, the corresponding secondary antibody was incubated at room temperature for 30 min. Following another PBS wash, DAB staining was performed, and the slides were rinsed with water for 10 min. The sections were then counterstained with hematoxylin, dehydrated, cleared, and mounted with neutral resin. Finally, the slides were observed under a light microscope.

Lung Wet-to-dry (W/D) Weight Ratio Assay

After euthanizing the mice, the right middle lobe of the lung was first washed in pre-chilled PBS to remove surface blood, then blotted dry with filter paper, and weighed to obtain the wet weight. The tissue was subsequently placed in a heated oven at 80 °C for 48 h to dry. Once the weight stabilized, it was recorded as the dry weight. The W/D was calculated as the ratio of wet weight to dry weight.

Bronchoalveolar Lavage Fluid (BALF)

Following previous methodologies [26], BALF was collected from the mice. The protein concentration in the BALF was then measured using a bicinchoninic acid (BCA) protein assay kit, according to the manufacturer's instructions.

Enzyme‑linked Immunosorbent Assay (ELISA)

Under pentobarbital sodium anesthesia, blood samples were collected from the retro-orbital sinus of the mice. After allowing the blood to clot at room temperature for 90 min, serum was separated by centrifugation at 1800 × g and stored at −80 °C for subsequent analysis. The levels of IL-1β (Dakewe Biotech, Shenzhen, China, 1210122) and TNF-α (Dakewe Biotech, Shenzhen, China, 1217202) in the serum were then measured according to the standard protocol of the ELISA kits.

Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Staining

Cell apoptosis in lung tissue sections was assessed using a TUNEL Apoptosis Detection Kit (Servicebio, Wuhan, China, G1502) according to the manufacturer's instructions. Briefly, the samples were permeabilized and incubated with the TUNEL detection solution, followed by nuclear staining with DAPI. The samples were then analyzed under a fluorescence microscope.

Transmission Electron Microscopy (TEM)

Lung tissues were fixed using TEM fixative (Servicebio, Wuhan, China, G1102) and dehydrated through a gradient series of ethanol and acetone at room temperature. After resin polymerization, the lung tissues were sectioned into 80 nm-thick slices using an ultramicrotome. Finally, the samples were examined under a transmission electron microscope (HT7700, Japan).

Immunofluorescence

Paraffin-embedded lung tissue sections were deparaffinized and dehydrated through a series of ethanol washes of varying concentrations, then incubated in a 3% H₂O₂ solution. Subsequently, the sections were blocked with 5% BSA for 1–2 h at room temperature and incubated with the primary antibody against LC3 (1:200 dilution; CST) at 4 °C overnight. The sections were then incubated with the secondary antibody at room temperature for 60 min. After washing, the sections were mounted with an anti-fade reagent containing DAPI (Solarbio, Beijing, China, S2110) to prevent fluorescence quenching.

Western Blot Analysis

First, proteins were extracted from cells or tissues, and protein concentrations were determined using the BCA Protein Assay Kit (Boster, China). Equal amounts of denatured protein were separated by SDS-PAGE using 8% or 10% polyacrylamide gels. Subsequently, the separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was then blocked with 5% skimmed milk at room temperature for 2 h to prevent non-specific binding. After blocking, the membrane was incubated overnight at 4 °C with primary antibodies against Irgm1(1:1000, MA9427, Abmart), IRGM (1:1000, NBP1-76377, Novus), LC3(1:1000, #3868, CST), p62 (1:2000, 18420–1-AP, Proteintech), Beclin1(1:2000, 11306–1-AP, Proteintech), Bax(1:3000, 50599–2-Ig, Proteintech), Bcl2(1:2000, ab12858, abcame), Caspase9(1:1000, 10380–1-AP, Proteintech), AKT(1:2000, 10176–2-AP; Proteintech), p-AKT(1:1000, #9271, CST), mTOR(1:1000, 66888–1-Ig, Proteintech), p-mTOR(1:1000, #5536, CST), TRIM21(1:1000, 67136–1-Ig, Proteintech), GAPDH(1:3000, GB15004, Servicebio)and β-actin(1:3000, GB15003, Servicebio). The following day, the membrane was washed three times with TBST, then incubated with the appropriate secondary antibody at room temperature for 2 h. Finally, protein detection was performed using an enhanced chemiluminescence (ECL) detection kit (BioRad, USA), and protein bands were visualized by exposing the membrane. Gel and Western blot results were quantified using ImageJ software.

Quantitative Real‑time Polymerase Chain Reaction (qRT‑PCR)

RNA was extracted from cells or tissues using an RNA extraction kit (NCM, Suzhou, China), and cDNA was synthesized through reverse transcription using the Takara kit (Takara Biotechnology, Japan) according to standard protocols. Quantitative PCR amplification was performed using SYBR Green Master Mix (Tiangen, China). Relative gene expression levels were normalized to GAPDH. The primers used are as follows:

Species	Gene	Forward	Reverse
Mice	Irgm1	AACCGTAGAGGACTATGTGGAAGAG	TCTGATAGGACACTGGTGCTGAG
Mice	GAPDH	CATCACTGCCACCCAGAAGACTG	ATGCCAGTGAGCTTCCCGTTCAG
Human	IRGM	TCGAAACACAGGACATGAGGGTAAG	TGGGAAGAGAAATAGGAGGCACATC
Human	TRIM21	TCCTTCTACAACATCACTGACC	CAATATTCAGTGGACAGAGGGT
Human	GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Cell Culture and Treatment

A549 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS; Gibco, USA) at 37 °C in a humidified incubator with 5% CO₂. To establish an in vitro sepsis-associated acute lung injury (ALI) model, A549 cells were treated with lipopolysaccharide (LPS; Sigma, USA) to induce cellular damage. The lentivirus for overexpressing the IRGM gene (LV-IRGM) and its control virus (LV-NC) were provided by Gikai Gene (Shanghai, China) and transfected according to the manufacturer's instructions. Stable IRGM overexpressing cell lines were selected using puromycin. The cells were initially pretreated with the AKT activator SC79 (4 μg/mL) for 2 h. Subsequently, they were exposed to LPS (20 μg/mL) for 24 h to induce cellular damage. TRIM21 knockdown plasmids (GeneChem) were transiently transfected using Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA). Molecular analyses were performed following all treatments.

CCK‑8

A549 cells were seeded into 96-well plates at a rate of 5 × 10³ cells per individual well. After 48 h, CCK-8 reagent (Solarbio, Beijing, China, CA1210) was added at 10 μL per 100 μL of medium and incubated at 37 °C for 2 h. The optical density (OD) was measured at 450 nm. Cell viability was evaluated based on absorbance values compared to a standard curve. Each experiment was performed in triplicate.

EdU Assay

Cell proliferation was assessed using the BeyoClick™ EdU Cell Proliferation Detection Kit (Beyotime, Shanghai, China, C0075). A549 cells were initially grown in 6-well plates using DMEM medium with 10% serum. The cells were then incubated with EdU-containing medium for 2 h. Following the removal of the EdU-containing medium, the cells were rinsed with PBS and then fixed with formaldehyde to preserve the incorporated EdU. Following fixation, the cell membranes were permeabilized using an appropriate permeabilization buffer. The cells were incubated with the click chemistry reaction mixture containing the fluorescent probe for 30 min. Following incubation, the cells were rinsed with a suitable buffer to remove excess reagents. Subsequently, fluorescence microscopy was used to analyze the cells.

Autophagy Flux Analysis

Autophagic flux was monitored using the mRFP-GFP-LC3 lentiviral double fluorescence autophagy indicator system (GeneChem, Shanghai, China). Following the manufacturer’s instructions, cells were infected with the mRFP-GFP-LC3 lentivirus for 24 h. Autophagic flux was observed using a confocal microscope (Zeiss, Germany). Autophagosomes and autolysosomes were identified through confocal microscopy analysis, with yellow puncta representing autophagosomes and red puncta representing autolysosomes.

Flow Cytometry

Cells from each group were resuspended in 500 μL of 1 × Annexin V Binding Buffer to create a single-cell suspension. Subsequently, 5 μL of Annexin V-FITC and 5 μL of PI were added, and the mixture was gently mixed and incubated in the dark at room temperature for 15 min. Apoptosis was then assessed within 1 h using a flow cytometer.

Co-immunoprecipitation (Co-IP)

To collect 1 × 10⁷ cells, wash them twice with PBS, and then resuspend in 500 µL of IP lysis buffer (containing 1% protease inhibitor and 1% phosphatase inhibitor). Take 1/10 of the lysate as an input sample, mix with loading buffer, and heat to denature. The remaining protein samples were divided into two parts: one was incubated with IgG, and the other with IRGM(1:1000, M008718, Abmart) or TRIM21(1:1000, 12108–1-AP, Proteintech) antibody, rotating overnight at 4 °C. The next day, protein-A/G agarose beads were added to the antibody-protein mixture, followed by further incubation for 4 h with gentle rotation. After incubation, beads were separated using a magnetic rack, and the supernatant was discarded. The beads were washed three times with 1 mL of lysis buffer to remove non-specifically bound proteins. After washing, the beads were resuspended in loading buffer and heated at 100 °C for 10 min to elute the proteins. Finally, the expression of target proteins was detected by Western blotting.

Statistical Analyses

Statistical analyses and graphical representations were conducted using GraphPad Prism 9 software. Experimental data are presented as mean ± SD from at least three independent trials. Group differences were evaluated with one-way ANOVA or an unpaired t-test, with significance defined as a p-value of < 0.05.

Results

Irgm1 Knockdown Exacerbates CLP-induced ALI

To identify key genes whose expression changes during sepsis-induced ALI, we cross-referenced three gene expression datasets (GSE2411, GSE18341, and GSE60088) to obtain overlapping differentially expressed genes (DEGs) from the lungs of sepsis-ALI mice, resulting in the identification of 23 DEGs (Fig. 1A). Among these DEGs, we focused on Irgm1. We then performed CLP surgery to induce ALI and observed a significant increase in the expression of Irgm1 in the lungs post-CLP (Fig. 1B-D), suggesting that Irgm1 may be involved in the pathogenesis of CLP-induced ALI.

Fig. 1.

Irgm1 knockdown exacerbated CLP-induced ALI. A Identification of 23 DEGs from the three gene expression profiles; B Effect of CLP on Irgm1 expression at the mRNA level in the lung measured by qRT-PCR(n = 3); C Western blot showing the expression of Irgm1 in the lung tissues of mice with sham or CLP surgeries(n = 3); D Immunohistochemical staining showing the expression of Irgm1 in the lung tissue with or without CLP surgeries(n = 6); E Schematic diagram of injecting the constructed AAV-shRNA vector targeting Irgm1 into mice via the tail vein; F-G qRT-PCR and Western blot analysis were performed to detect the mRNA and protein expression levels of Irgm1 after its knockdown(n = 3); H HE staining was used to detect lung tissue morphology(n = 6). Scale bars: 50 um; I Lung wet/dry (W/D) ratio(n = 6); J Total cell protein concentrations(n = 6); K Expression of IL-1β and TNF-α in serum of mice in each group detected by ELISA(n = 6). Data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗P < 0.001, ^∗∗∗∗P < 0.0001

To further investigate the role of Irgm1 in sepsis-induced ALI, we constructed an AAV viral vector targeting sh-Irgm1 and administered it intravenously into mice (Fig. 1E). First, we confirmed the knockdown efficiency of Irgm1 using qRT-PCR and Western blot (Fig. 1F-G). H&E staining revealed significant structural changes in the lungs of mice in the CLP and CLP + AAV-NC groups compared to the Sham group, including thickening of the alveolar septa, vascular congestion, and infiltration of inflammatory cells (Fig. 1H). Notably, these pathological changes were more pronounced in the CLP + AAV-shIrgm1 group than in the CLP + AAV-NC group. Consistently, the histological ALI score was significantly higher in the CLP + AAV-shIrgm1 group compared to the CLP + AAV-NC group. Pulmonary edema, a key feature of ALI, was assessed by measuring the W/D of lung tissue and the total protein concentration in BALF. Both the W/D ratio and the total protein concentration in BALF were significantly increased in the CLP group compared to the Sham group (Fig. 1I-J). Moreover, Irgm1 knockdown in CLP mice further elevated the W/D ratio and BALF protein concentration, suggesting that Irgm1 deficiency exacerbates pulmonary edema. Inflammation is another hallmark of ALI. To evaluate the extent of the inflammatory response, we measured the levels of IL-1β and TNF-α. Serum levels of IL-1β and TNF-α were significantly elevated in CLP-treated mice, and this increase was more pronounced in Irgm1 knockdown mice (Fig. 1K). These data suggest that Irgm1 plays a protective role in CLP-induced ALI, and its upregulation in ALI may serve as an endogenous protective feedback mechanism.

Irgm1 Knockdown Inhibited Autophagy in CLP‑induced ALI

Previous studies have suggested that modulating autophagy may be a key therapeutic target for preventing and treating CLP-induced ALI. Building upon this, we aimed to investigate whether Irgm1 exerts protective effects through the regulation of this process. First, we assessed a range of autophagy-related proteins. We found that, compared to the Sham group, the levels of LC3II and Beclin-1 were significantly elevated in the CLP group, while p62 levels were markedly reduced. However, Irgm1 knockout significantly inhibited the upregulation of LC3II/I and Beclin-1 induced by CLP, while enhancing the expression of p62 (Fig. 2A). These findings were further corroborated by LC3 immunofluorescence staining (Fig. 2B). Additionally, to further validate the role of Irgm1 in autophagy regulation, we examined the changes in autophagic vesicles using TEM. The analysis revealed a significant reduction in the number of autophagic vesicles in the CLP + AAV-shIrgm1 group compared to the CLP + AAV-NC group (Fig. 2C).

Fig. 2.

Irgm1 regulated AKT/mTOR signaling pathway and autophagy. A Protein expression levels of autophagy-related proteins were measured in the lung tissue by western blot(n = 3); B Immunofluorescence staining was used to detect the expression of LC3 in the lung tissues(n = 3). Scale bars: 50 um; C Representative high-magnification TEM images show autophagosomes and autolysosomes (black arrow) (n = 3). Scale bars: 2 um, 1 um. Data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗P < 0.001

Irgm1 Knockdown Aggravated Apoptosis in CLP‑induced ALI

TUNEL staining revealed a significant increase in the number of TUNEL-positive cells in the CLP group compared to the Sham group, with a further increase in apoptotic cells observed in the Irgm1 knockdown group (Fig. 3A). Western blot analysis corroborated these findings, showing that the upregulation of Cleaved-Caspase-9 and Bax expression post-CLP was further enhanced upon Irgm1 knockdown, while the decrease in Bcl2 expression was exacerbated (Fig. 3B). These results suggest that Irgm1 knockdown exacerbates cell apoptosis in CLP-induced ALI.

Fig. 3.

Irgm1 knockdown aggravated CLP-induced apoptosis in the lung. A Representative TUNEL staining images demonstrated the impact of Irgm1 knockdown on CLP-induced apoptosis(n = 3), Scale bars: 50 um; B Protein expression levels of apoptotic markers were measured in the lung tissue by western blot(n = 3); C Protein expression levels of AKT, p-AKT, mTOR, and p-mTOR were measured in the lung tissue by western blot(n = 3). Data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01

Irgm1 May Regulate Autophagy via the AKT/mTOR Signaling Pathway in CLP‑induced ALI

To elucidate the precise signaling pathway by which Irgm1-mediated autophagy operates in the lungs of CLP-induced ALI mice, Western blot analysis was performed to assess the protein expression levels of p-AKT, AKT, p-mTOR, and mTOR in lung tissues. The results demonstrated that phosphorylation of AKT and mTOR was significantly suppressed in the CLP group compared to the Sham group. However, in Irgm1-deficient mice, a marked activation of the AKT/mTOR signaling pathway was observed, suggesting that Irgm1 deficiency may exacerbate CLP-induced ALI by activating the AKT/mTOR pathway (Fig. 3C). To further investigate the protective mechanisms of Irgm1 in the lungs, subsequent in vitro experiments were conducted.

IRGM Overexpression Enhanced Autophagy in LPS-induced ALI

To further confirm that IRGM alleviates sepsis-induced ALI by regulating the activity of lung epithelial cells, we first established a sepsis-ALI cell model by treating A549 cells with LPS. IRGM was then overexpressed in A549 cells, and the overexpression efficiency was validated using qRT-PCR and Western blot analysis (Fig. 4A-B). Next, cell proliferation was evaluated using the CCK-8 assay and EdU staining. The results demonstrated that LPS treatment significantly suppressed the viability of A549 cells, while IRGM overexpression partially restored cell activity (Fig. 4C-D). To investigate the underlying mechanisms, we further examined the effects of IRGM on autophagy and apoptosis. LPS treatment markedly increased the expression levels of LC3 II/I and Beclin-1, while decreasing p62 levels. Importantly, IRGM overexpression further enhanced the LPS-induced upregulation of LC3 II/I and Beclin-1 while significantly reducing p62 expression (Fig. 4E). Moreover, autophagic flux was monitored using an mRFP-GFP-LC3 adenoviral reporter system. The results revealed that LPS stimulation significantly increased autophagic flux, which was further promoted by IRGM overexpression (Fig. 4F).

Fig. 4.

IRGM overexpression enhanced autophagy in LPS-induced ALI. A-B qRT-PCR and western blot analysis were performed to detect the mRNA and protein expression levels of IRGM in A549 cells. C-D CCK-8 and EdU staining were used to analyze the growth activity of A549 cells; E Protein expression levels of autophagy-related proteins were measured in A549 cells by western blot; F Figure F displays representative confocal images of admCherry-GFP-LC3 cells. The GFP and mRFP fluorescent signals were used to detect autophagosomes (yellow dots) and autolysosomes (red dots). Scale bars: 10 um. Each experiment is repeated three times, and the data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗P < 0.001, ^∗∗∗∗P < 0.0001

IRGM Overexpression Inhibited LPS-Induced Apoptosis in A549 Cells

To elucidate the effect of IRGM on apoptosis, we evaluated the expression levels of key apoptosis-related proteins using Western blot analysis. The results showed that in LPS-treated A549 cells, IRGM overexpression significantly suppressed the upregulation of pro-apoptotic proteins Bax and Cleaved-Caspase-9 while markedly enhancing the expression of the anti-apoptotic protein Bcl-2 (Fig. 5A). To further validate the role of IRGM in apoptosis, we quantified the apoptotic rate using flow cytometry. Consistent with the Western blot results, LPS treatment significantly increased the apoptotic rate, whereas IRGM overexpression reduced LPS-induced apoptosis (Fig. 5B). Collectively, these findings demonstrate the protective role of IRGM in regulating LPS-induced apoptosis. Furthermore, IRGM overexpression amplified the inhibitory effects of LPS on the AKT/mTOR signaling pathway (Fig. 5C), suggesting that the protective effect of IRGM may be mediated through modulation of this pathway.

Fig. 5.

IRGM Overexpression Inhibited LPS-Induced Apoptosis in A549 Cells. A Protein expression levels of apoptotic markers were measured in A549 cells by western blot; B Apoptosis rate was detected using flow cytometry; C Protein expression levels of AKT/mTOR pathways were measured in A549 cells by western blot. Each experiment is repeated three times, and the data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗∗P < 0.0001

IRGM Enhanced Autophagy via the AKT/mTOR Signaling Pathway in LPS-induced A549 Cells

To investigate the role of the AKT/mTOR signaling pathway in IRGM-mediated protection against ALI, we conducted experiments using the AKT activator SC79. The results showed that SC79 significantly enhanced the expression levels of p-AKT and p-mTOR by activating the AKT/mTOR signaling pathway (Fig. 6A). Moreover, SC79 partially reversed the increase in A549 cell viability induced by IRGM overexpression (Fig. 6B-C) and attenuated the pro-autophagic effect of IRGM. Western blot analysis revealed that, compared to the LPS + LV-IRGM group, SC79 significantly downregulated the expression of LC3 II/I and Beclin-1, while upregulating the expression of p62 (Fig. 6D). Consistent with these findings, mRFP-GFP-LC3 fluorescence analysis further confirmed that SC79 reduced the increase in autophagic flux induced by IRGM overexpression (Fig. 6E). Additionally, Western blot analyses demonstrated that SC79 reversed the inhibition of LPS-induced cell apoptosis by IRGM overexpression (Fig. 7A). These results suggest that activation of the AKT/mTOR pathway impairs the protective effects of IRGM against LPS-induced ALI.

Fig. 6.

Activated AKT/mTOR signaling partially reversed the enhancement of IRGM overexpression on autophagy in LPS-induced ALI. A Protein expression levels of AKT/mTOR pathways were measured in A549 cells by western blot; B-C CCK-8 and EdU staining were used to analyze the growth activity of A549 cells; D Protein expression levels of autophagy-related proteins were measured in A549 cells by western blot; E Figure E displays representative confocal images of admCherry-GFP-LC3 cells. The GFP and mRFP fluorescent signals were used to detect autophagosomes (yellow dots) and autolysosomes (red dots). Scale bars: 10 um. Each experiment is repeated three times, and the data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗P < 0.001, ^∗∗∗∗P < 0.0001

Fig. 7.

IRGM alleviated LPS-induced apoptosis by enhancing autophagy through the AKT/mTOR signaling pathway. A Protein expression levels of apoptotic markers were measured in A549 cells by western blot; B Protein expression levels of autophagy-related proteins were measured in A549 cells by western blot; C Protein expression levels of apoptotic markers were measured in A549 cells by western blot. Each experiment is repeated three times, and the data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗P < 0.001, ^∗∗∗∗P < 0.0001

To further investigate the role of the AKT/mTOR signaling pathway in the regulation of autophagy and apoptosis by IRGM, we treated LPS-stimulated, LV-IRGM-transfected A549 cells with SC79 and the autophagy inhibitor 3-methyladenine (3-MA). Interestingly, 3-MA exhibited effects similar to SC79, suggesting that IRGM overexpression may enhance autophagy through the AKT/mTOR signaling pathway to suppress apoptosis in A549 cells (Fig. 7B-C).

IRGM Interacted with TRIM21 to Inhibite the AKT/mTOR Signaling Pathway

To further investigate the molecular mechanism by which IRGM regulates the AKT/mTOR signaling pathway, we first performed immunoprecipitation (IP) on lysates from A549 cells overexpressing IRGM, followed by mass spectrometry analysis to identify potential interacting proteins (Fig. 8A). The results revealed that at least 81 proteins may interact with IRGM (Fig. 8B). We selected TRIM21 for further study based on recent evidence suggesting that TRIM21 modulates the AKT signaling pathway. Co-immunoprecipitation (Co-IP) experiments confirmed that both IRGM and TRIM21 were detected in the proteins immunoprecipitated with IRGM and TRIM21 antibodies, but not in the corresponding IgG control (Fig. 8C). Additionally, immunofluorescence analysis demonstrated that the cellular localization of IRGM overlapped with that of TRIM21 in A549 cells (Fig. 8D). Finally, molecular docking analysis (http://hdock.phys.hust.edu.cn/) validated the interaction between IRGM and TRIM21, revealing a strong binding affinity between the two proteins (Fig. 8E). We further investigated whether the expression of TRIM21 is regulated by IRGM. Western blot analysis revealed that overexpression of IRGM significantly upregulated TRIM21 expression（Fig. 8F）. Additionally, we observed that silencing TRIM21 in A549 cells reversed the enhanced autophagy induced by IRGM overexpression (Fig. 9C). Further analysis showed that TRIM21 knockdown significantly diminished the protective effects of IRGM overexpression on LPS-induced increases in Bax and cleaved caspase-9 levels, as well as the reduction in Bcl-2 expression (Fig. 9D). Finally, our results indicated that knockdown of TRIM21 in IRGM-overexpressing A549 cells led to the activation of the AKT/mTOR pathway (Fig. 9E). Collectively, these data support our hypothesis that IRGM interacts with TRIM21 to inhibit the AKT/mTOR signaling pathway, thereby regulating autophagy.

Fig. 8.

Mutual binding between IRGM and TRIM21 in A549 cells. A Schematic diagram of the IP-MS; B The extracted protein was precipitated with anti-IRGM antibody and separated by SDS-PAGE followed by silver staining; C The interaction between IRGM and TRIM21 was validated by IP; D The co-localization of IRGM and TRIM21 was demonstrated by immunofluorescence on A549 cells. Scale bars: 20 um; E The protein–ligand of the docking simulation between IRGM (green) and TRIM21 (blue); F The regulatory relationship was confirmed by western blotting(n = 3)

Fig. 9.

IRGM interacts with TRIM21 to inhibit the AKT/mTOR signaling pathway. A-B qRT-PCR and western blot analysis were performed to detect the mRNA and protein expression levels of TRIM21 in A549 cells; C Protein expression levels of autophagy-related proteins were measured in A549 cells by western blot; D Protein expression levels of apoptotic markers were measured in A549 cells by western blot; E Protein expression levels of AKT/mTOR pathways were measured in A549 cells by western blot. Each experiment is repeated three times, and the data are presented as mean ± SD values, ^∗P < 0.05,^∗∗P < 0.01, ^∗∗∗P < 0.001, ^∗∗∗∗P < 0.0001

Discussion

ALI is a severe pulmonary condition with no specific therapeutic options currently available. Therefore, understanding its underlying pathogenesis is crucial for the development of effective treatment strategies. This study elucidates the protective role of IRGM/Irgm1 in sepsis-induced ALI and its potential mechanisms.

Under normal physiological conditions, the expression level of IRGM/Irgm1 is low, but it is significantly upregulated in response to infection or inflammatory stimuli [27]. In this study, we first observed a significant increase in the expression of Irgm1 in ALI mice. Furthermore, the knockout of Irgm1 in CLP-induced ALI mice notably reduced the autophagy levels in lung tissues and exacerbated the symptoms of sepsis-induced ALI. In vitro experiments further confirmed that overexpression of IRGM in A549 cells significantly enhanced autophagy levels and mitigated LPS-induced cell damage. Immunoresponsive GTPase M (IRGM) and its murine homolog Irgm1 are members of a GTPase family regulated by interferons [28], which have been implicated in various inflammatory and autoimmune diseases, including tuberculosis and ankylosing spondylitis [29]. IRGM/Irgm1 plays a critical role in autophagy regulation [19, 30]. Studies have shown that in the permanent middle cerebral artery occlusion (pMCAO) mouse model, Irgm1 promotes neuronal autophagy and inhibits apoptosis, thereby reducing the infarction area, offering a novel therapeutic strategy for ischemic stroke [31]. Additionally, recent research has found that silencing IRGM expression using small interfering RNA can directly or indirectly reduce cellular autophagy levels [32]. These findings are consistent with our results.

Autophagy is a critical biological process that involves the self-degradation and recycling of cellular components, playing an essential role in maintaining cellular homeostasis and normal immune defense [33]. Disruption of autophagic function is considered one of the potential toxic mechanisms in sepsis. Studies have shown that the absence of Atg7 promotes inflammasome activation by increasing IL-1β production [34]. In T cells, inhibition of autophagy accelerates cell apoptosis and increases mortality in sepsis models [35]. Recent studies have reported that exposure to stress factors such as hypoxia, inflammation, and ischemia-reperfusion enhances autophagy in pulmonary diseases. Growing evidence supports the protective role of autophagy in acute lung injury [36]. Qu et al. [15] demonstrated that treatment with the autophagy inhibitor 3-MA significantly exacerbates the inflammatory response in lung tissues and worsens endotoxin-induced acute ALI. In this study, we observed a significant increase in autophagy levels in the lung tissues of ALI mice, while Irgm1 knockout mice exhibited markedly reduced autophagy levels, accompanied by more severe lung damage. This was validated by the levels of inflammatory factors, the extent of apoptosis, H&E staining results, and changes in the wet/dry weight ratio. Further cellular experiments showed that overexpression of IRGM enhances autophagy, inhibits apoptosis, and significantly mitigates LPS-induced cell damage. These findings suggest that the protective effect of IRGM/Irgm1 in sepsis-induced ALI may be mediated through the promotion of autophagy. The relationship between autophagy and apoptosis is complex and context-dependent. In certain conditions, autophagy protects cells from undergoing apoptosis [37], while under specific circumstances, it may promote apoptosis [38]. Wang et al. demonstrated that autophagy mitigates zearalenone (ZEA)-induced cytotoxicity and prevents apoptosis in rat Leydig cells [39]. Similarly, Wu et al. reported that autophagy plays a crucial role in protecting human cells from T-2 toxin-induced apoptosis by alleviating the associated toxic effects [40]. In this study, we found that overexpression of IRGM significantly enhanced LPS-induced autophagy and inhibited apoptosis, an effect that was reversed by the autophagy inhibitor 3-MA. These findings suggest that the protective effects of IRGM may be mediated through the promotion of autophagy, thereby mitigating LPS-induced apoptosis.

The AKT/mTOR pathway is involved in various physiological functions, including cell proliferation, differentiation, autophagy, and apoptosis [41]. Studies have shown that under normal conditions, high expression levels of mTOR in cells inhibit autophagy, whereas in conditions of nutrient deprivation or hypoxia, the AKT/mTOR signaling pathway is suppressed, and autophagy is activated [42]. The expression levels of phosphorylated AKT and mTOR proteins, namely p-AKT and p-mTOR, serve as key indicators of AKT/mTOR pathway activation. Zhang et al. [43] found that octreotide promotes autophagy and alleviates LPS-induced ALI by inhibiting the phosphorylation of AKT and mTOR. Additionally, Fan et al. [44] reported that Peitu Yifei Granules enhance lung tissue autophagy and delay the progression of idiopathic pulmonary fibrosis (IPF) by inhibiting the AKT/mTOR signaling pathway. Based on this evidence, we further explored the protective role of IRGM/Irgm1 and its molecular mechanism in sepsis-induced ALI. Our findings demonstrate that in the CLP-induced ALI mouse model, knockout of Irgm1 significantly upregulated the expression of p-AKT and p-mTOR in lung tissues, suppressed autophagy, and aggravated lung injury. Further cell experiments showed that overexpression of IRGM significantly inhibited the activation of the AKT/mTOR signaling pathway, thereby enhancing autophagy levels and alleviating LPS-induced cell apoptosis. To further validate the mechanism by which IRGM exerts its protective effects through modulation of this pathway, we used the AKT activator SC79 in in vitro experiments. The results revealed that SC79 significantly reversed the protective effect of IRGM on ALI, as evidenced by a marked decrease in cell viability, a significant increase in apoptosis, and a notable reduction in autophagy levels. These findings suggest that IRGM/Irgm1 may alleviate sepsis-induced ALI by inhibiting the AKT/mTOR signaling pathway and enhancing LPS-induced autophagy. This discovery provides important insights into the protective mechanisms of IRGM/Irgm1 and offers a potential new therapeutic target for sepsis-induced ALI.

To further elucidate the mechanism of IRGM gene function, we performed mass spectrometry analysis and identified that its activity relies on interaction with TRIM21. TRIM21, a member of the TRIM family, is expressed in both the cytoplasm and nucleus, with the gene encoding this protein located on chromosome 11 [45]. Recent studies have highlighted the critical role of TRIM21 in autophagy regulation [46, 47], as well as its close association with the regulation of the AKT signaling pathway [22]. Wang et al. [48] found that TRIM21 promotes autophagosome formation and inhibits cervical cancer cell proliferation by suppressing the activation of the AKT/mTOR pathway. Building on these findings, we further investigated whether TRIM21 alleviates sepsis-induced ALI by enhancing autophagy. Our data demonstrate that IRGM interacts with TRIM21, and overexpression of IRGM leads to an upregulation of TRIM21 protein levels. Western blot analysis revealed that TRIM21 knockdown inhibited autophagy and increased cell apoptosis, accompanied by activation of the AKT/mTOR signaling pathway. These results suggest that IRGM enhances autophagy and improves sepsis-induced ALI by upregulating TRIM21 and suppressing the AKT/mTOR signaling pathway.

In summary, our study demonstrates that IRGM upregulates TRIM21 to inhibit the AKT/mTOR signaling pathway, thereby promoting autophagy and alleviating sepsis-induced ALI. These findings provide new insights into the pathogenesis of sepsis-associated ALI and offer potential therapeutic strategies for the clinical management of ALI.

Author Contributions

NG and YX designed and supervised the study. NG conducted the study and write the manuscript. YX raised animals, operated and collected samples. NG and YX performed experiments. NNH and LZ performed data clean up and data analyses. LZ and JL revised the manuscript and polished the language. All authors reviewed and agreed to the final version of the manuscript.

Funding

This study was funded by the Gansu Provincial Science and Technology Program (Project Number: 24JRRA939).

Data Availability

The underlying data that supports the findings of this study will be made available upon reasonable request to the corresponding author. This is done in the spirit of open science and allows others in the field to verify our results and use the data for further explorations.

Declarations

Ethics Approval and Consent to Participate

The research project received approval from the Ethics Review Committee of the First Hospital of Lanzhou University (Approval number: LDYYLL2024-400).

Consent for Publication

Not applicable.

Competing Interests

The authors declare no competing interests.