TIPE2 Alleviates Sepsis-induced Lung Injury By Inhibiting PANoptosis in Murine Alveolar Macrophages

Abstract

Sepsis-induced acute lung injury (ALI) is a life-threatening condition with high mortality rates, and its underlying mechanisms remain poorly understood. This study investigates the role of TNF-α-induced protein 8-like 2 (TIPE2) in modulating PANoptosis, an integrated form of programmed cell death that includes apoptosis, necroptosis, and pyroptosis, in the context of sepsis-induced lung injury. We utilized a cecal ligation and puncture (CLP) mouse model to examine the effects of TIPE2 knockout and overexpression on lung injury, inflammation, and cell death pathways. Our findings demonstrate that TIPE2 knockout exacerbates lung injury by promoting the abnormal activation of PANoptosis-related proteins, leading to increased inflammation and tissue damage. In contrast, overexpression of TIPE2 in macrophages significantly reduces these effects by inhibiting the ZBP1-dependent PANoptosis pathway via TRIF signaling. These results highlight the crucial role of TIPE2 in maintaining the balance between cell survival and death during sepsis and suggest that targeting TIPE2 could be a novel therapeutic strategy for treating sepsis-related lung injury.

Introduction

Sepsis is a systemic inflammatory response syndrome triggered by infection, with severe outcomes including multiple organ dysfunction syndrome (MODS) and acute lung injury (ALI) [1]. ALI and acute respiratory distress syndrome (ARDS) caused by sepsis are common and fatal complications in intensive care units [2, 3]. Despite significant advancements in modern medicine regarding anti-infection and supportive therapies, the pathogenesis of sepsis-associated ALI remains incompletely understood, leading to limited treatment efficacy and persistently high mortality rates [4, 5]. In recent years, the role of cell death mechanisms in sepsis has garnered widespread attention [6, 7]. Traditionally, cell death was mainly categorized into apoptosis and necrosis, but increasing research has revealed that the forms of cell death are more complex and diverse. Among these, PANoptosis, a newly identified form of cell death, integrates features of apoptosis, pyroptosis, and necroptosis, playing a crucial role in inflammatory diseases [8]. The concept of PANoptosis aims to explain how cells coordinate multiple death pathways to clear pathogens and limit tissue damage during severe inflammatory responses [9, 10]. PANoptosis is closely associated with the development and progression of various diseases [11, 12]. For example, in cancer, cardiovascular diseases, neurodegenerative diseases, and infectious diseases, the occurrence of PANoptosis exacerbates the condition, leading to disease deterioration [11, 13]. Particularly in chronic diseases, persistent cell death and inflammatory responses result in chronic tissue and organ damage and functional failure [14, 15]. TNF-α-induced protein 8-like 2 (TIPE2) is a crucial immunoregulatory protein that plays a key role in various immune and inflammatory responses [16]. TIPE2 exhibits significant inhibitory effects on the functions of T cells, B cells, and macrophages, and is considered an essential factor for maintaining immune system homeostasis [17]. Studies have demonstrated that TIPE2 provides substantial protective effects in several pathological conditions, including inflammatory bowel disease, liver diseases, and autoimmune diseases [16, 18].

In this study, we investigate the role of TIPE2 in sepsis-induced acute lung injury, elucidating its mechanism in regulating PANoptosis in alveolar macrophages and evaluating its potential as a therapeutic target for sepsis-related lung injury. Through this research, we aim to offer a more comprehensive perspective on the interplay between sepsis and PANoptosis, providing new insights and approaches for clinical treatment.

Method

Animals

Male C57BL/6 aged 6–8 weeks (weighing 20–25 g) were enrolled in this study. WT mice were obtained from Hubei Province Center for Animal Experiments, and TIPE2-knockout mice on a C57BL/6 background were generated through the CRISPR-Cas9 system to delete TIPE2 exon 2 by Wuhan Xianran Biotechnology Co., Ltd. (Wuhan, China). gRNA sequence: gRNA1: CTTGTTGGAGGGCGAATGTGG; gRNA2: ACTGGGAAATGACACATCGGG. Littermate controls referred to TIPE2-knockout mice and WT mice were used for experimental analysis. The TIPE2 knockout mice were confirmed by Western blot analysis to ensure the absence of TIPE2 expression in the lung tissues (Fig. 3H). Mice were housed in rooms with controlled temperature, humidity, and 12-h light/12-h dark cycle, and food and water were provided ad libitum. All animals received human care in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Fig. 3.

TIPE2 deficiency promotes the activation of PANoptosis-related proteins. A Western blot analysis for the expression of apoptosis, necroptosis markers and ZBP1, TIPE2 in lung tissues from WT and TIPE2 KO mice, with and without CLP treatment. B Western blot analysis for the expression of pyroptosis markers in lung tissues. C-K Densitometric analysis of the Western blots showing relative protein expression normalized to GAPDH. The data are presented as mean ± SEM. n = 6/group, *P < 0.05, ***P < 0.001

Reagents

LPS (#L2630) was acquired from Sigma (St. Louis, MO, USA). TNF-α (#E-EL-M3063), IL-18 (#E-EL-M0730), IL-1β (#E-EL-M0037), IL-1 (#E-EL-M0038) ELISA kits were purchased from Elabscience (Wuhan, China). RIPA lysis buffer (#G2038), DAPI (#G1012), BCA protein assay kit (#G2026) were purchased from Servicebio (Wuhan, China). Primary antibodies: RIPK1 (#3493), RIPK3 (#10,188), MLKL (#37,705), P-MLKL (#37,333), Bcl2 (#15,071), Bax (#2772), NLRP3 (#15,101, CST), GSDMD (#39,754), C-caspase3 (#P42574), TIPE2 (#53,842) were purchased from CST (Danvers, MA, USA). GAPDH (#60,004–1-Ig) was obtained from Proteintech (Wuhan, China), and TRIF (#A13605) was purchased from Abcam Biotech (Cambridge, UK). ZBP1 (#AG-20B-0010), Caspase-8 (#AG-20 T-0138), ASC (#AG-25B-0006), Caspase-1 (#AG-20B-0042) were purchased from Adipogen (San Diego, CA, USA).

Surgical Procedure and Animal Treatment

All surgical procedures were performed after the intraperitoneal injection of pentobarbital sodium (50 mg/kg). The cecum was ligated with 4.0 silk and then punctured twice with a 21 G needle. Finally, the animals received 1 mL of 0.9% saline through subcutaneous resuscitation after cecal ligation and puncture (CLP). Rectal temperatures were maintained at 37 °C during surgery using an incandescent lamp. For each group,6 mice (n = 6) were used. Subsequently, the mice were sacrificed 24 h after surgery for the following studies.

Survival Curve Plotting

After CLP surgery, the mice in each group were observed every 24 h, and the number of deaths and survivors in each group was recorded. The survival rates of each group were calculated, and the survival curve for 7 days was plotted using GraphPad Prism 8.0. To compare the survival curves between groups, Log-rank test was used.

Lung Wet/Dry Weight Ratio

The lower lobe of the left lung was isolated, and residual blood was washed away with physiological saline. The lung tissue was blotted dry with filter paper, weighed, and recorded as the wet weight (W). The lung tissue was then placed in a 60 °C oven for 48 h until fully dried, and the dry weight (D) was recorded.

HE Staining

Mouse lung tissues were fixed in 4% paraformaldehyde for 4 h to overnight. After fixation, the tissues were dehydrated, embedded, and sectioned (thickness: 4–5 μm). Sections were deparaffinized in xylene, rehydrated through a graded ethanol series (100%, 95%, 80%, 70%), and finally rinsed in distilled water. Sections were then stained with hematoxylin for 5–10 min, followed by rinsing in running water until the background staining disappeared. The sections were differentiated in 1% hydrochloric acid-alcohol until the nuclei appeared blue, and then blued in running water or an alkaline solution. Afterward, the sections were stained with eosin for 1–3 min, rinsed in running water to remove excess stain, dehydrated through a graded ethanol series (70%, 80%, 95%, 100%), and cleared in xylene. Finally, the sections were mounted with a neutral balsam mounting medium, covered with a coverslip, and allowed to dry before being observed under a light microscope (Olympus, Japan).

Collection and Analysis of Bronchoalveolar Lavage Fluid (BALF)

Mice were euthanized by cervical dislocation, followed by the insertion of a 22G catheter into the trachea to access the lungs. Pre-cooled phosphate-buffered saline (PBS) was gently instilled into the lungs at a volume of 1–2 mL to avoid lung injury. The BALF was then gently aspirated and collected in sterile tubes. This lavage procedure was repeated three times for collection. The collected BALF was aliquoted into cryotubes and stored at −80 °C. The protein concentration in the BALF was measured using a BCA protein assay kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions. Levels of tumor necrosis factor-alpha (TNF-α), interleukin-18 (IL-18), interleukin-1 (IL-1), and interleukin-1 beta (IL-1β) in the BALF were measured using mouse cytokine ELISA kits (Elabscience, Wuhan, China).

Cell Culture and Treatment

The cell line used in this study was the mouse alveolar macrophage cell line MH-S, purchased from ATCC (CRL-2019).MH-S cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 37 °C in a 5% CO₂ incubator. When cells reached 70–80% confluence, the medium was removed, and the cells were gently washed with PBS. Trypsin–EDTA was added, and the cells were incubated at 37 °C for 1–3 min until they detached. The trypsin was neutralized with culture medium, and the cells were resuspended and replated at a 1:3 ratio in new culture flasks. To construct TIPE2-overexpressing MH-S cells, the cells were transfected with plasmids carrying TIPE2 overexpression vectors (TIPE2-OE) using Lipofectamine 3000, following the manufacturer’s instructions. After 48 h, the cells were treated with LPS. The mouse TIPE2 overexpression plasmid was obtained from MiaoLingBio (Wuhan, China), and the mouse TIPE2 sequence was sourced from the NCBI database (NM_027206.3). LPS was administered at a dose of 10 μg/mL to induce a sepsis model for 6 h.

ELISA

Cell culture supernatants were collected and centrifuged at 1000 rpm for 20 min at 4 °C to remove debris and cell fragments. The levels of IL-18, IL-1β, and TNF-α in the supernatants were measured using ELISA kits according to the manufacturer’s instructions.

Immunofluorescence

Cells were fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, and blocked with 5% BSA to prevent nonspecific binding. The cells were then incubated with a primary antibody overnight at 4 °C. After washing with PBS, the cells were incubated with a fluorescently labeled secondary antibody (1:400) for 1 h at room temperature in the dark. After further washing with PBS, the cells were mounted with antifade mounting medium and covered with a coverslip. Samples were observed under a fluorescence microscope.

Flow Cytometry Analysis

Cells were cultured in 6-well plates at a density of 1 × 10^6 cells per well. After LPS treatment, the cells were collected, washed with PBS, and resuspended in 1 × Binding Buffer, adjusting the cell concentration. Annexin V-FITC and propidium iodide (PI) were added to the cells, and the mixture was incubated at room temperature in the dark for 15–30 min. The samples were then analyzed using a flow cytometer, with Annexin V and PI fluorescence signals recorded to distinguish early apoptotic, late apoptotic, and necrotic cells.

Western Blot Analysis

Proteins were extracted from cells or tissue samples using a lysis buffer containing PMSF and phosphatase inhibitors. After lysis, the samples were centrifuged to remove debris, and the supernatant was collected. Protein concentration was measured using a BCA protein assay kit. Protein samples were separated by SDS-PAGE and transferred onto a PVDF membrane. The membrane was blocked to prevent nonspecific binding and then incubated with the primary antibody. After washing, the membrane was incubated with the secondary antibody, and target protein expression was detected using chemiluminescence. Band intensity was quantified using ImageJ software and reported as relative intensity compared to the control.

Statistical analysis

All data were expressed as mean ± standard error of the mean (SEM). MWM training experiments were analyzed using two-way ANOVA for repeated measures followed by Bonferroni correction for multiple testing. Multiple groups were analyzed by two-way ANOVA followed by Bonferroni post-tests. A P value of less than 0.05 was considered significant.

Result

TIPE2 Deficiency Exacerbates Lung Injury and Reduces Survival Rate in Septic Mice

To explore the role of the TIPE2 gene in acute lung injury induced by sepsis, we developed TIPE2 gene knockout mice and subjected both wild-type (WT) and TIPE2 knockout (TIPE2 KO) mice to cecal ligation and puncture (CLP) modeling. As illustrated in Fig. 1A, significant pathological changes were observed in the lung tissues of both WT and TIPE2 KO mice post-CLP treatment compared to the sham-operated group. The mice of WT + CLP group exhibited mild lung tissue damage, while the mice in TIPE2 KO + CLP group showed more severe lung tissue damage, particularly in terms of increased alveolar wall thickness and infiltration of inflammatory cells. Lung injury scores were further quantified to assess these observations (Fig. 1B). The data indicated that lung injury scores in TIPE2 KO mice subjected to CLP were significantly higher than those in WT mice which subjected to CLP (P < 0.001), demonstrating that the absence of TIPE2 exacerbates lung injury induced by CLP. Regarding survival rates, we assessed the survival of WT and TIPE2 KO mice post-CLP using Kaplan–Meier analysis (Fig. 1C). The results revealed that survival rates post-CLP were significantly reduced compared to the WT group (P < 0.05). Additionally, it was observed that the seven-day survival rate of mice in TIPE2 KO + CLP group were significantly lower compared to that of mice in WT + CLP group (P < 0.05).

Fig. 1.

TIPE2 deficiency exacerbates lung injury and reduces survival rate in septic mice. A Representative histological sections of lungs from wild-type (WT) and TIPE2 knockout (TIPE2 KO) mice, both untreated and subjected to cecal ligation and puncture (CLP). Stained with hematoxylin and eosin; scale bar, 50 μm. n = 6/group. B Lung injury scores quantified from histopathological analysis of lung sections from WT and TIPE2 KO mice post-CLP. Data are presented as mean ± SEM; n = 6/group, *P < 0.05, ***P < 0.001. C The survival rates of WT and TIPE2 KO mice over a 7-day period post-CLP. n = 10/group

Exacerbation of Pulmonary Edema and Inflammation in TIPE2 Ko Mice With Sepsis-induced Ali

Subsequently, we explored the impact of TIPE2 knockout on the inflammatory response in mice with sepsis-induced lung injury, analyzing changes in inflammatory biochemical markers in both serum and bronchoalveolar lavage fluid (BALF) (Fig. 2A). Compared to the WT group, TIPE2 KO mice exhibited more severe tissue damage associated with pulmonary edema following CLP modeling (Fig. 2B). Additionally, a significant increase in total protein concentration in the BALF with mice of TIPE2 KO + CLP group suggested increased permeability of the alveolar-capillary barrier. The levels of inflammatory cytokines, TNF-α, IL-1β, IL-1 and IL-18 in the serum of mice in TIPE2 KO + CLP group were significantly elevated (Fig. 2C-F), indicating an intensified inflammatory response.

Fig. 2.

Exacerbation of pulmonary edema and inflammation in TIPE2 KO mice with sepsis-induced ALI. A Lung wet/dry weight ratio in WT and TIPE2 KO mice, with and without CLP. B Bronchoalveolar lavage fluid (BALF) protein concentrations in WT and TIPE2 KO mice subjected to CLP. C-F ELISA assays were performed to measure the levels of TNF-α, IL-1β, and IL-6 in the BALF. The data are presented as mean ± SEM. n = 6/group, *P < 0.05, ***P < 0.001

TIPE2 Deficiency Promotes the Activation of PANoptosis-related Proteins

We further investigated the role of TIPE2 in various forms of programmed cell death. Our analysis showed that after CLP, the expressions of necroptosis-related proteins were significantly upregulated in the lung tissues of TIPE2 KO mice. Specifically, the expression level of RIPK1 was significantly higher in the TIPE2 KO + CLP group compared to the WT + CLP group (Fig. 3C). Importantly, the phosphorylated form of MLKL (P-MLKL), a critical step in executing necroptosis, was significantly elevated in the mice of TIPE2 KO + CLP group (Fig. 3E). Our results also show that ZBP1 expression was significantly upregulated in TIPE2 KO mice (Fig. 3D). After CLP, the expression of the anti-apoptotic protein BCL2 was significantly reduced, while the expression of the pro-apoptotic protein BAX was significantly increased (Fig. 3F, G). Additionally, the increased levels of cleaved Caspase-3 (C-Caspase 3) further indicate that the apoptotic pathway is aberrantly activated in the absence of TIPE2 (Fig. 3K). This dysregulation likely contributes to enhanced apoptosis and increased tissue damage in the lung tissue of TIPE2 KO mice after CLP treatment. Furthermore, another form of inflammation-related programmed cell death, pyroptosis, was also significantly enhanced in mice of TIPE2 KO + CLP group. The levels of the cleaved product of Gasdermin D (GSDMD-N) and cleaved Caspase-1 (C-Caspase 1) were markedly elevated in the lung tissues of TIPE2 KO mice after CLP treatment (Fig. 3I-J).

TIPE2 Overexpression Reduces Inflammatory Response and Cell Death in Alveolar Macrophages of Mice

To further explore the role of TIPE2 in regulating inflammation and cell death, we overexpressed TIPE2 in MH-S and evaluated the subsequent changes in inflammatory cytokine levels, cell death, and inflammasome activation. The successful overexpression of TIPE2 was confirmed by Western blot analysis, which showed a significant increase in TIPE2 protein levels in the TIPE2 OE group compared to the mock-transfected control group (Fig. 4A-B). GAPDH was used as the loading control. Overexpression of TIPE2 in macrophages resulted in a significant decrease in the production of key inflammatory cytokines, including IL-1β, IL-18, and TNF-α, following LPS stimulation (Fig. 4C-E). This suggests that TIPE2 plays a critical role in modulating the inflammatory response in macrophages, potentially protecting against excessive inflammation. Flow cytometry analysis showed that TIPE2 overexpression led to a marked reduction in cell death, as indicated by lower levels of Annexin V and PI staining in the TIPE2 OE group compared to the mock group after LPS treatment (Fig. 4F-G). This indicates that TIPE2 overexpression helps to mitigate cell death, likely through its regulatory effects on inflammatory pathways. Immunofluorescence staining revealed that NLRP3 inflammasome activation, indicated by the presence of NLRP3, was significantly reduced in TIPE2-overexpressing macrophages after LPS stimulation compared to the mock group (Fig. 4H). This further supports the role of TIPE2 in inhibiting inflammatory pathways that lead to pyroptosis, a form of programmed cell death.

Fig. 4.

TIPE2 overexpression reduces inflammatory response and cell death in alveolar macrophages of mice. A B Western blot analysis confirming TIPE2 overexpression (TIPE2 OE) compared to the mock-transfected group (A) and quantification (B). C-E ELISA quantification of IL-1β, IL-18, and TNF-α levels in the supernatant of macrophages from mock and TIPE2 OE groups after LPS stimulation. Data are presented as mean ± SEM. n = 6/group, *P < 0.05, ***P < 0.001. F-G Flow cytometry analysis of cell death (Annexin V/PI staining) in macrophages, showing reduced cell death in the TIPE2 OE group compared to the mock group after LPS stimulation and the quantification of Annexin V + /PI + cells. Data are presented as mean ± SEM; n = 6/group, *P < 0.05, **P < 0.01, ***P < 0.001. H Immunofluorescence staining for NLRP3 in macrophages, showing reduced NLRP3 expression and inflammasome activation in the TIPE2 OE group compared to the mock group after LPS stimulation. Nuclei are stained with DAPI (blue). Scale bar, 20 μm

TIPE2 Overexpression Inhibits the Expression of PANoptosis-related Proteins Induced By LPS

To investigate the regulatory role of TIPE2 in PANoptosis, we analyzed the expression levels of key proteins associated with necroptosis, apoptosis, and pyroptosis in macrophages stimulated with LPS. Using Western blot analysis, we examined the activation of these cell death pathways under TIPE2 overexpression conditions. The Western blot results revealed that in the Mock group, LPS treatment led to a significant increase in the expression level of RIPK1, with a particularly notable rise in phosphorylated MLKL (P-MLKL) (Fig. 5A and C, D). However, in the TIPE2 OE + LPS group, the expression levels of these necroptosis markers were significantly reduced compared with the cells of Mock + LPS group. However, the Mock group showed increased expression of the pro-apoptotic protein BAX and decreased expression of the anti-apoptotic protein BCL2 after LPS stimulation (Fig. 5E, F). Additionally, the levels of cleaved Caspase-3 were significantly higher in the Mock + LPS group compared with the cells of Mock group, suggesting activation of the apoptotic pathway. In contrast, in macrophages of TIPE2 OE + LPS group, BAX expression was suppressed and BCL2 expression was relatively increased, along with cleaved Caspase-3 levels were significantly reduced compared with the cells of Mock + LPS group, indicating that TIPE2 overexpression attenuates LPS-induced apoptosis (Fig. 5G). The levels of GSDMD-N were significantly elevated in the Mock group after LPS stimulation, indicating activation of pyroptosis. In the TIPE2 OE + LPS group, the levels of GSDMD-N were significantly decreased, and the expression of the Caspase-1 cleavage product P20 was also reduced compared with the cells of Mock + LPS group, which suggests TIPE2 overexpression effectively inhibits LPS-induced pyroptosis (Fig. 5B and J-K).

Fig. 5.

TIPE2 overexpression inhibits LPS-induced programmed cell death pathways. A Western blot analysis showing the expression levels of necroptosis-related proteins (RIPK1, MLKL, P-MLKL), apoptosis-related proteins (BCL2, BAX, cleaved Caspase-3) and TIPE2 in MH-S. B Western blot analysis of pyroptosis-related proteins (GSDMD, GSDMD-N) and the inflammasome component PRO-Caspase-1 and its cleavage product P20. (C-K) Densitometric analysis of Western blots showing the relative protein expression normalized to GAPDH. Data are presented as mean ± SEM; n = 6/group, *P < 0.05, ***P < 0.001

TIPE2 Regulates ZBP1-dependent PANoptosis Pathway via TRIF

To elucidate the role of TIPE2 in regulating complex cell death mechanisms, we explored its effect on the ZBP1-dependent PANoptosis pathway mediated through TRIF under LPS stimulation. Using Western blot and immunofluorescence analyses, we examined how TIPE2 overexpression influences the activation of key proteins within this pathway. As shown in Fig. 6A, LPS stimulation in the Mock group led to a significant increase in the expression levels of ZBP1, TRIF, along with a notable rise in the Caspase-8 cleavage product P18 (Fig. 6B, C). These findings indicate that ZBP1 activation, through TRIF, promotes the simultaneous triggering of apoptosis, necroptosis, and pyroptosis pathways, characteristic of PANoptosis. In contrast, in the TIPE2 overexpression group, the expression and activation of these proteins were markedly suppressed, suggesting that TIPE2 inhibits the ZBP1-dependent PANoptosis pathway by modulating TRIF signaling, thereby reducing LPS-induced cell death. Immunofluorescence analysis revealed that in the Mock group, LPS stimulation led to significant colocalization of ASC, Caspase-8 and RIPK3 (Fig. 6D). This colocalization suggests the physical interaction of components from apoptosis, necroptosis, and pyroptosis pathways under the influence of ZBP1 and TRIF. However, in cells overexpressing TIPE2, this colocalization was significantly reduced, which indicates that TIPE2 overexpression disrupts the formation of ZBP1-dependent PANoptotic complexes.

Fig. 6.

TIPE2 regulates ZBP1-dependent PANoptosis pathway via TRIF. A Western blot analysis showing the expression levels of TRIF, ZBP1, CASPASE-8, and its cleavage product P18 in MH-S. B, C Densitometric analysis of Western blots showing the relative protein expression normalized to GAPDH. B C-CASPASE-8/ CASPASE-8 ratio. C ZBP1/GAPDH.Data are presented as mean ± SEM; n = 6/group, *P < 0.05, **P < 0.01, ***P < 0.001. D Immunofluorescence staining of ASC (red), CASPASE-8 (green), and RIPK3 (purple) in MH-S, demonstrating the colocalization of these proteins in PANoptosis complexes. Nuclei are stained with DAPI (blue). Scale bar, 20 μm

Disscussion

The pathological and physiological processes of septic organ injury are complex. Currently, it is believed that multiple pathological factors, including uncontrolled inflammation, immune dysregulation, oxidative stress, autophagy disturbance, mitochondrial dysfunction, and metabolic reprogramming, contribute to the occurrence and progression of the disease [19]. Among these, the most prominent and critical pathological processes in sepsis are the dysregulation of the host defense response to infection, excessive systemic inflammatory response, and the disruption of homeostasis and immune suppression caused by immune regulatory imbalance during the course of sepsis. Among the affected organs, the lungs are the first and most vulnerable target in sepsis. Clinically, the mortality rate caused by ALI/acute respiratory distress syndrome (ARDS) due to sepsis remains high, making it one of the leading causes of death in critically ill patients [20, 21]. Therefore, a deeper exploration of the molecular biological mechanisms underlying septic lung injury is of significant theoretical and clinical value.

Existing research indicates that TIPE2, as an immune negative regulator, inhibits apoptosis and necroptosis, thereby alleviating inflammatory responses [22, 23]. Our study suggests that TIPE2 gene plays a critical role in regulating the response of mice to sepsis, TIPE2 deficiency not only affects apoptosis and necroptosis but also promotes pyroptosis, further aggravating inflammation and lung injury in mice and decreased survival rates. In the in vitro experiments we found that TIPE2 overexpression in macrophages effectively reduces the inflammatory response and prevents cell death after LPS stimulation. This is consistent with our previous in vivo experimental results [22]. Kuriakose and Kanneganti pointed out that PANoptosis is a key mechanism in the pathogenesis of infectious diseases, where the coordinated activation of multiple cell death pathways not only serves as a defense mechanism against pathogens but, when dysregulated, can lead to tissue damage [24]. In our study, we detected that the expressions of necroptosis-related proteins were significantly upregulated in the lung tissues of TIPE2 KO mice after CLP treatment compared with WT mice. However, in the TIPE2 overexpression group of in vitro experiments, the expression levels of these necroptosis markers were significantly reduced after LPS stimulation, indicating that TIPE2 effectively inhibits the activation of necroptosis pathways. The results indicate that TIPE2 normally acts as a negative regulator of the necroptosis pathway, and its absence enhances necroptotic cell death, thereby exacerbating lung injury. The study by Yasmine Messaoud-Nacer et al. found that diABZI, by activating the STING signaling pathway, can induce PANoptosis, leading to acute lung injury and ARDS, highlighting the significant role of PANoptosis in the pathological process of ARDS [25]. In the TIPE2 KO mice, the balance between pro-apoptotic and anti-apoptotic signals was significantly altered. We further indicate that the apoptotic pathway is aberrantly activated in the absence of TIPE2. This dysregulation likely contributes to enhanced apoptosis and increased tissue damage in the lung tissue of TIPE2 KO mice after CLP treatment. Furthermore, another form of inflammation-related programmed cell death, pyroptosis, was also significantly enhanced in TIPE2 KO mice. PANoptosis is an integrated form of cell death that involves the concurrent activation of multiple programmed cell death (PCD) pathways, including apoptosis, necroptosis, and pyroptosis, which can be initiated by ZBP1 [26]. In our study, we also observed elevated colocalization of caspase-8, ASC, and RIPK3, components of PANoptosis, in alveolar macrophages after LPS stimulation, supporting the critical role of PANoptosis in inflammation with sepsis model. Additionally, we further detected the expression of ZBP1 in different group both in vivo and vitro test, our results showed that ZBP1 expression was significantly upregulated in TIPE2 KO mice, further supporting its central role in regulating programmed cell death pathways. However, in alveolar macrophages, TIPE2 overexpression could inhibit the increased expression of ZBP1 after LPS stimulation. In this study, we found that the deficiency of TIPE2 exacerbates sepsis-induced ALI by promoting the abnormal activation of PANoptosis-related proteins, thereby intensifying inflammation and tissue damage. In contrast, overexpression of TIPE2 in macrophages significantly reduced these effects and provided protective effects against the complex interplay of apoptosis, necroptosis, and pyroptosis, by inhibiting the activation of ZBP1, TRIF and their associated signaling pathways. Therefore, we hold that TIPE2 acts as a negative regulator of PANoptosis, and the absence of TIPE2 leads to abnormal activation of PANoptotic proteins. ZBP1 promotes pyroptosis, necroptosis, and apoptosis by modulating the activity of key proteins involved in these pathways, thus contributing to enhanced inflammation and tissue damage in the lungs of TIPE2 KO mice. Dysregulation of these pathways in TIPE2 KO mice may be responsible for the exacerbated inflammation and increased tissue damage in sepsis-induced ALI.

Our research highlights the crucial role of TIPE2 in maintaining the balance between cell survival and death during the inflammatory response in sepsis. However, several limitations exist in the present study. Although we validated through Western blot experiments that TIPE2 regulates PANoptosis by inhibiting the expression of ZBP1, thereby affecting the expression of key proteins in the downstream TRIF pathway involved in programmed cell death, we did not specifically explore the interaction between TIPE2 and ZBP1. This interaction will be further elucidated in our subsequent research.

In summary, this study provides potential evidence that TIPE2 alleviates sepsis-induced lung injury by inhibiting the occurrence of PANoptosis in alveolar macrophages. This understanding identifies TIPE2 as a key regulatory factor that can mitigate the harmful effects of PANoptosis in the lungs, suggesting that targeting TIPE2 may become an effective therapeutic strategy for sepsis and other inflammatory diseases.

Author Contributions

SXM and XJW conceived and designed the study. YXW and JXQ performed experiments and data analysis. ZHL and QK performed bioinformatics analysis. MY and YXW interpreted data and wrote manuscript drafts and revisions. QW and XC administrated experiments. MY and XJW supervised the project. All authors agree on the manuscript’s content and approve the submission.

Funding

This article was supported by National Natural Science Foundation of China, 82371370, 82372156.

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Competing Interest

The authors declare no competing interests.