Comparison of MALAT1 antisense oligonucleotide distribution following intracerebroventricular and lumbar intrathecal routes of administration

Abstract

Several antisense oligonucleotide (ASO) therapies are currently in clinical trials or approved for treatment of central nervous system (CNS) diseases. Achieving adequate distribution of systemically delivered ASOs in CNS tissues has been hindered by the blood-brain barrier (BBB). To overcome this, delivery of ASOs into cerebrospinal fluid (CSF) via intrathecal-lumbar (IT-L) injection has been utilized in the clinic. However, there is a gradient of distribution resulting in less drug in deep brain regions compared to cortical and spinal cord regions. An alternative direct-to-CSF route of administration, intracerebroventricular (ICV) administration, has been utilized to deliver other therapeutic modalities in the clinic. To our knowledge, a comprehensive comparison study of these two routes of delivery in large animals has not been done for ASOs. Therefore, we conducted a study to compare the ICV and IT-L route of delivery for the MALAT1 ASO in dogs. We delivered the ASO and assessed biodistribution and RNA knockdown (KD) across CNS regions. We found that ICV delivery resulted in substantial bilateral distribution of the ASO and KD. Further, we found that ICV delivery resulted in improved KD in deep brain regions, particularly the caudate, and similar KD in spinal cord regions compared to IT-L delivery.

Graphical abstract

Shafer and colleagues demonstrated that unilateral intracerebroventricular (ICV) delivery of an antisense oligonucleotide (ASO) resulted in bilateral distribution and RNA knockdown across regions of the central nervous system (CNS). When compared to intrathecal lumbar delivery, ICV delivery showed similar results, with the exception of enhanced delivery to deep brain regions.

Introduction

Historically, adequate delivery of systemically administered therapeutics to the central nervous system (CNS) has been hindered by the limited permeability of the blood-brain barrier (BBB), especially with respect to biologics. Therefore, direct administration into the cerebrospinal fluid (CSF) via the intrathecal lumbar (IT-L), intracerebroventricular (ICV), and less commonly the intracisternal magna (ICM), routes of administration have been developed to bypass the BBB and achieve effective distribution of therapeutics within the CNS.¹ The utility of the IT-L route of administration has been demonstrated clinically, with two antisense oligonucleotides (ASO), nusinersen for spinal muscular atrophy (SMA) and tofersen for SOD1-ALS amyotrophic lateral sclerosis (ALS) associated with a mutation in the superoxide dismutase 1 (SOD1) gene, each administered via the IT-L route, having been approved by FDA.^2,3 Encouraged by the clinical success of nusinersen, several ASOs delivered via the IT-L route are currently in development for neurological diseases.⁴

The ICV route of administration is a well-established delivery route into the CSF and builds on decades of familiar neurosurgical methods proven for shunt techniques, used across all age groups. ICV delivery initially gained utility in treating CNS infections, a variety of oncology indications, and pain.⁵ A more recent example is cerliponase alfa (BRINEURA), an enzyme delivered ICV, that received approval by FDA and several other countries for treatment of late infantile neuronal ceroid lipofuscinosis type 2 (CLN2) in 2017 for ages 3 and older.^6,7

While the IT-L route has demonstrated utility in diseases with spinal cord pathology, further assessment of its utility in diseases with pathology in deep brain regions is necessary.⁸ IT-L administration of an ASO to nonhuman primates that targets MALAT1 (metastasis associated lung adenocarcinoma transcript 1 which is a long, non-coding RNA that is expressed ubiquitously in mammalian cells) has demonstrated a deficiency in delivery to deep brain regions, such as the caudate and putamen.⁹ This ASO, as well as others that are utilized to reduce gene expression of particular RNAs, reduces MALAT1 RNA expression by triggering cleavage of the strand via RNase H1.¹⁰ Unilateral ICV delivery of tagged divalent-silencing RNAs (di-siRNA), another type of oligonucleotide therapeutic, in sheep and nonhuman primates showed uniform brain distribution and substantial target RNA KD across brain regions, including the deep brain.^11,12 In the sheep study report, the authors compared ICV and ICM delivery and noted mostly similar distribution and accumulation of the di-siRNA across brain regions for both routes, with greater deep brain accumulation with ICV administration.¹¹ Comparisons between ICV and IT-L delivery of ASOs have not been reported in any large animal models. Further, no CNS ASO distribution studies have been published in the canine model, an alternative large animal model to the nonhuman primate.

In this report, we conducted a study with objectives aimed to address three gaps in research presented previously: (1) compare the ICV and IT-L routes of administration for ASO delivery in a large animal species, (2) evaluate differences between ICV bolus and infusion dosing, and (3) evaluate the utility of canines as a large animal model for ASO development. To accomplish this, we administered the MALAT1 ASO via the ICV and IT-L routes in canines to study the biodistribution and MALAT1 RNA KD across brain and spinal regions as well as assessing ASO concentrations in multiple CSF compartments. We also sought to evaluate differences between dosing parameters (bolus, short infusion, long infusion) for ICV administration of the ASO. The MALAT1 ASO we used in this study is the standard 5-10-5 2’ -methoxyethyl (MOE)-gapmer design that is frequently used in preclinical and clinical research.^{9,13,14,15,16,17,18,19,20} Despite differences in target RNA region and backbone chemistries, MALAT1 serves as a reasonable surrogate to guide translational development of ASO therapies. As such, this study serves as a guide for IT-L to ICV translatability to human therapy development.

Results

ICV bolus dosing of the MALAT1 ASO achieved broad distribution and MALAT1 KD

To assess the distribution of the MALAT1 ASO in dogs when administered via the ICV route of delivery, we administered a range of bolus doses (5, 15, and 25 mg). Fourteen days later, the ASO levels and MALAT1 RNA KD were assessed. One animal in the 15 mg group was identified as a mis-dose. Histological assessment of the brain tissue showed evidence of the ICV catheter tip being placed in the corpus callosum/cingulate cortex above the lateral ventricle. The ASO IHC staining for this animal showed increased ASO stain in the parenchyma and/or limited to the immediate surroundings confirming the ASO was administered locally rather than in the lateral ventricle. This animal was removed from further analysis. Administration of the MALAT1 ASO via the ICV route was well tolerated, with the only ASO-related clinical observation being transient hindlimb weakness at 15 and 25 mg doses (data not shown). CSF was collected from the ipsilateral ventricle, contralateral ventricle, cisterna magna, and lumbar cistern to assess ASO concentration differences between CSF compartments. A dose-dependent increase in ASO concentration was observed in each CSF compartment, with the exception of the ipsilateral ventricle, which had the highest ASO concentration of all of the compartments (Figure 1A). It is possible that the levels in the ipsilateral ventricle, despite a flush of aCSF following ASO administration, may have been influenced by the method of CSF collection, since the samples were aspirated from the same catheter lumen through which the ASO was delivered. However, we anticipate that influence to be small. The concentrations of the ASO in the other CSF compartments (contralateral ventricle, cisterna magna, and lumbar cistern) were somewhat similar to each other within a dose level.

Figure 1.

ICV bolus dosing results in broad distribution of the MALAT1 ASO

ASO quantification in CSF compartment samples (A) and punches from brain (ipsilateral hemisphere) and spinal cord (B). Horizontal lines represent the group mean. Statistical tests: one-way ANOVA with Tukey’s multiple comparisons test, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. Representative images of ASO IHC in the frontal cortex, caudate, and thoracic spinal cord (C). Scale bars, 250 μm, 100 μm, and 500 μm, respectively. Sample size: n = 3–4 for 5 mg ICV bolus, n = 2–3 for 15 mg ICV bolus, n = 3–4 for 25 mg ICV bolus.

Distribution of the ASO into the tissue showed dose dependent increases across brain (ipsilateral hemisphere) and spinal cord regions (Figure 1B). For the 25 mg group, the highest levels were observed in the hippocampus (mean: 41.3 μg/g tissue), and the lowest levels were observed in the thoracic and lumbar spinal cord (25 mg group mean: 13.6 μg/g tissue and 13.6 μg/g tissue, respectively), which were the farthest away from the site of administration. Similar trends between groups and CNS regions were observed in the images from IHC staining for the ASO (Figure 1C).

The KD of MALAT1 RNA was assessed by qPCR in multiple brain (ipsilateral hemisphere) and spinal cord regions. Across cortical regions, dose-dependent KD was observed between the 5 mg and 15 mg groups, with nearly maximal KD of the MALAT1 RNA seen at 15 mg (93%–96% KD relative to vehicle levels) (Figure 2A). Also at the 25 mg dose, KD in the deep brain regions was near maximal in the caudate, hippocampus, and hypothalamus (Figure 2B). The thalamus showed 45% KD at the 25 mg dose, which was a less dramatic reduction in expression compared to other deep brain regions (76.5%–93.5% KD). KD in the spinal cord and hindbrain regions was also dose-dependent, demonstrating that ICV delivery is capable of knocking down MALAT1 in both deep regions while also reaching regions much further from the administration site (Figure 2C). This finding is consistent with another publication utilizing ICV delivery of an oligonucleotide therapeutic in nonhuman primates.¹² Together, these data demonstrate that a single bolus ICV dose of the MALAT1 ASO results in broad CNS distribution and target RNA KD. While these results demonstrate that the 15 mg dose level achieves nearly maximal KD across most CNS regions, the rest of the study utilized a 25 mg dose to match what has been used in past publications with this ASO in large animals.⁹

Figure 2.

ICV bolus dosing results in MALAT1 RNA KD across brain and spinal cord regions

RT-PCR analysis of MALAT1 expression is represented for cortical (A), deep brain (B), and spinal cord and hindbrain (C) regions from the ipsilateral hemisphere. Data are expressed as MALAT1 mRNA expression levels as a percentage of vehicle group, with the vehicle group set to 100%. The black and red dotted lines represent 100% and 50% expression levels, respectively. Horizontal lines indicate the group mean. Statistical tests: one-way ANOVA with Tukey’s multiple comparisons test, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. Sample size: n = 8 for vehicle, n = 4 for 5 mg ICV bolus, n = 3 for 15 mg ICV bolus, n = 4 for 25 mg ICV bolus.

Unilateral ICV bolus dosing of the MALAT1 ASO achieved bilateral tissue distribution and MALAT1 KD

To assess if unilateral ICV administration of the ASO resulted in bilateral tissue distribution and RNA KD of the ASO, we compared samples from the ipsilateral and contralateral hemisphere of animals administered 25 mg of the ASO. Levels of the ASO in the frontal cortex, hippocampus, caudate, and cerebellar cortex were similar between hemispheres, demonstrating that unilateral administration distributes the ASO into tissues of both hemispheres at similar levels (Figure 3A). Further, KD of the MALAT1 ASO showed a similar trend to the distribution data (Figure 3B). Together, these data demonstrate that unilateral ICV administration results in bilateral tissue distribution of the ASO as well as bilateral KD of the target RNA in brain regions. These results are consistent with published data from studies infusing either a di-siRNA or a therapeutic antibody in cynomolgus nonhuman primates where unilateral ICV delivery resulted in bilateral distribution in brain tissue.^12,21

Figure 3.

ICV bolus dosing of the MALAT1 ASO results in bilateral distribution and MALAT1 RNA KD

ASO quantification in brain regions (A). RT-PCR analysis of MALAT1 expression is represented for brain regions for the ipsilateral and contralateral hemisphere (B). Data are expressed as MALAT1 mRNA expression levels as a percentage of vehicle group, with the vehicle group set to 100%. The black and red dotted lines represent 100% and 50% expression levels, respectively. Horizontal lines indicate the group mean. Statistical tests: Paired t tests. Sample size: n = 4.

ICV dosing parameters (bolus vs. infusion) did not result in different MALAT1 ASO distribution or MALAT1 KD

With intra-CSF delivery of therapeutics, there is a hypothesis that different durations of delivery (bolus vs. infusion) may result in different tissue distribution profiles.^21,22,23 To assess this, we administered 25 mg of the ASO via the ICV route as a bolus (over 2 min) or as an infusion (over 6 h or 40 h), while maintaining a constant dose volume. One animal in the 6-h infusion group was identified as a mis-dose. Histological assessment showed evidence of the ICV catheter tip being placed in the corpus callosum above the lateral ventricle. The ASO IHC staining for this animal showed increased ASO stain in the parenchyma and/or limited to the immediate surroundings confirming the ASO was administered locally rather than in the lateral ventricle. This animal was removed from further analysis. The 40-Hour infusion group was left out of statistical analyses due to the group being underpowered (n = 2). ASO levels in CSF compartments were similar between the different ICV dosing parameters (Figure 4A). The levels of the ASO in brain and spinal cord tissues were similar between each group (Figure 4B). However, there was a trend of higher ASO levels in the caudate for the 40-h infusion compared to bolus dosing. The same trend was also observed in the IHC staining for the ASO, further supporting the bioanalytical results (Figure 4C). However, this trend could not be assessed statistically due to the group being underpowered (n = 2).

Figure 4.

ICV dosing of the ASO as a bolus, 6-h infusion, or 40-h infusion do not differ in ASO distribution

ASO quantification in CSF compartment samples (A) and punches from brain and spinal cord (B). Horizontal lines represent the group mean. Statistical tests: unpaired t tests between 25 mg ICV Bolus and 25 mg 6 h infusion. The 40 h infusion group was left out of statistical analysis due to n = 2, data is included in the graph to show trends. Representative images of ASO IHC in the frontal cortex, caudate, and thoracic spinal cord (C). Scale bars, 250 μm, 100 μm, and 500 μm, respectively. Sample size: n = 3–4 for 25 mg ICV bolus, n = 2–3 for 25 mg 6 h infusion, n = 2 for 25 mg 40 h infusion.

MALAT1 RNA KD was fairly similar across cortical brain regions regardless of the ICV dosing duration (Figure 5A). All ASO-treated groups demonstrated nearly maximal KD of the target RNA, with the exception of the thalamus. Interestingly, in deep brain regions there were no differences in MALAT1 KD between groups, despite the trends seen with ASO levels in the caudate (Figure 5B). This may be due to the 25 mg dose being too high to see differences between the groups (i.e., maximal KD was achieved regardless of infusion duration). The spinal cord and hindbrain regions also did not reveal any KD differences between the dosing parameters (Figure 5C). Together, these data indicate that 25 mg ICV dosing via bolus or 6-h infusion do not show significant differences in distribution or MALAT1 KD. While there was a trend toward higher caudate distribution in the underpowered 40-h infusion group, MALAT1 KD was similar across the groups in the caudate.

Figure 5.

ICV dosing of the ASO as a bolus, 6-h infusion, or 40-h infusion do not differ in MALAT1 RNA KD across brain and spinal cord regions

RT-PCR analysis of MALAT1 expression is represented for cortical (A), deep brain (B), and spinal cord and hindbrain (C) regions. Data are expressed as MALAT1 mRNA expression levels as a percentage of vehicle group, with the vehicle group set to 100%. The black and red dotted lines represent 100% and 50% expression levels, respectively. Horizontal lines indicate the group mean. Statistical tests: one-way ANOVA with Tukey’s multiple comparisons test between vehicle, 25 mg ICV Bolus, and 25 mg 6 h infusion, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. The 40 h infusion group was left out of statistical analysis due to n = 2, data is included in the graph to show trends. Sample size: n = 8 for vehicle, n = 4 for 25 mg ICV bolus, n = 3 for 25 mg 6 h infusion, n = 2 for 25 mg 40 h infusion.

ICV administration of the MALAT1 ASO demonstrated a significant advantage over IT-L administration in delivery to deep brain regions

We next compared ICV bolus dosing to IT-L dosing of the ASO in canines. The IT-L animals were originally planned to be dosed by using an implanted IT-L catheter instead of a lumbar puncture (LP). However, when the ASO IHC staining was examined, it was noted that the catheterization was incorrectly placed in 3/4 animals as noted by prominent staining of the dura, indicating the placement of the catheter was into the epidural space (Example images in Figure S1). This resulted in an underpowered IT-L group, so the decision was made not to utilize any results from the IT-L group of this study. An attempt to repeat this part of the study at a different laboratory, using LP was more successful. Therefore, the data from this repeat study was used in the following graphs.

ASO levels in cortical brain and spinal cord regions did not show any statistically significant differences between the routes of administration, though there was a trend of higher ASO levels in the hippocampus and the caudate of the ICV group (Figure 6A). The ASO IHC data matched these trends (Figure 6B). ICV and IT-L delivery resulted in similar KD of MALAT1 RNA in cortical brain regions (Figure 7A). In the deep brain regions, where IT delivery has struggled to demonstrate significant RNA KD in other large animal models,^9,11 ICV delivery resulted in significantly enhanced KD in the caudate and showed a trend toward more KD in the thalamus that did not reach statistical significance (Figure 7B). Additionally, in the spinal cord and hindbrain regions, RNA KD was similar between the ICV and IT-L groups (Figures 7A–7C). The results in the spinal cord are surprising given the distances between the site of dosing and the lumbar cord for ICV and IT-L delivery; however, this may be due to the 25 mg dose being too high to see more nuanced differences. Together, these data indicate that ICV delivery results in similar ASO distribution and RNA KD when compared to IT-L delivery, with the exception of enhanced caudate and thalamus RNA KD in the ICV group.

Figure 6.

ICV dosing of the ASO results in similar tissue distribution as IT-L delivery to the spinal cord and hindbrain regions

ASO quantification in punches from brain (ipsilateral hemisphere for ICV animals and left hemisphere for IT animals) and spinal cord (A). Horizontal lines represent the group mean. Statistical tests: Unpaired t tests. Representative images of ASO IHC in the frontal cortex, caudate, and thoracic spinal cord (B). Scale bars, 250 μm, 100 μm, and 500 μm, respectively. Sample size: n = 4 for 25 mg ICV bolus, n = 3 for 25 mg IT bolus.

Figure 7.

ICV dosing of the ASO results in enhanced MALAT1 RNA KD in the caudate compared to IT-L delivery

RT-PCR analysis of MALAT1 expression is represented for cortical (A), deep brain (B), and spinal cord and hindbrain (C) regions (ipsilateral hemisphere for ICV animals and left hemisphere for IT animals). Data are expressed as MALAT1 mRNA expression levels as a percentage of vehicle group, with the vehicle group set to 100%. The black and red dotted lines represent 100% and 50% expression levels, respectively. Horizontal lines indicate the group mean. Statistical tests: one-way ANOVA with Tukey’s multiple comparisons test, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. Sample size: n = 8 for vehicle, n = 4 for 25 mg ICV bolus, n = 3 for 25 mg IT bolus.

Discussion

The results of this study demonstrate that unilateral ICV bolus dosing of the MALAT1 ASO results in broad bilateral distribution and MALAT1 RNA KD in brain regions, and ICV dosing duration (bolus vs. infusion) does not show significant differences in biodistribution or KD at the 25 mg dose. Importantly, we demonstrated that ICV delivery results in improved ASO distribution and target RNA KD in the deep brain regions compared to IT-L delivery, particularly the caudate and thalamus, while also achieving exposure to the cortical and spinal cord regions. This result contributes to the expanding dataset that demonstrates the advantages of ICV delivery compared to IT-L delivery when targeting deep brain structures.^11,24

While clinical neurology practice has commonly used LP to collect CSF for diagnostic purposes, the more recent clinical acceptance of the LP as a route of intra-CSF administration has opened up a transformative era for CNS therapy development. This acceptance has led to approval of at least two lifesaving ASO therapies for SMA and ALS (with SOD1 mutations), with several more in development for CNS diseases.⁴ While LP or IT-L injections (via an implanted port and catheter) make sense for diseases that primarily involve the spinal cord, we submit that it is insufficient for diseases that primarily involve deep brain pathology, such as Huntington’s disease, or widespread brain pathology. Instead, the ICV route of administration has both anatomical and CSF fluid dynamic advantages for distributing CNS drug concentrations to deeper and broader brain targets.²⁵

In this study, administration of the MALAT1 ASO via both the IT-L and ICV route was well tolerated, with transient hindlimb weakness being the only ASO-related observation after IT-L administration or ICV administration (15 mg and 25 mg bolus administration). The same dose administered over a 6-h, or 40-h infusion showed a trend of greater ASO levels in the caudate compared to bolus dosing that did not reach significance. Furthermore, the transient clinical observations noted after IT-L and ICV bolus administration in this study were not observed in the 6- or 40-h ICV infusions of the ASO (data not shown). While this finding is limited by the small group size in the 40-h infusion group, it is surmised that the improvement in transient clinical signs observed with the 6-h infusion would not be diminished by the longer infusion.

A common assumption of ICV administration is that unilateral delivery does not deliver adequate levels of the therapeutic to the contralateral hemisphere. However, past reports utilizing unilateral ICV delivery in large preclinical models have demonstrated that antibody and di-siRNA therapeutics do distribute bilaterally.^11,12,21 The results from this study support those findings for ASOs, where we found that unilateral ICV administration of the MALAT1 ASO resulted in bilateral distribution 14 days post-dose, despite a lower ASO CSF concentration in the contralateral ventricle at the time of necropsy. These data are especially important when considering the potential clinical utility of ICV delivery; CNS disorders generally impact both hemispheres and adequate concentrations of therapeutics will need to be observed bilaterally.

Some ICV therapies are delivered as an infusion, continuously or over a few hours.^26,27,28,29 Therefore, we attempted to determine if bolus dosing or infusions (6 or 40 h) of the same dose and volume of ASO would result in biodistribution or KD differences. Tissue distribution was similar across the three dosing durations, however there was a trend of higher ASO levels in the caudate with a 40-h infusion (limited in sample size to n = 2). Despite this, there were no differences seen in KD in the caudate, though it could be that the dose was too high to see differences in KD between the groups. Whether or not these findings apply to ASOs with other targets will need to be studied further. From a clinical perspective, patients and caregivers are likely more amenable to a bolus injection vs. a 6-h infusion, despite the precedent that patients on BRINEURA tolerate infusions over four and a half hours in length. These results provide the rationale for a bolus or short infusion through an ICV port to achieve bilateral deep brain exposure, suggesting a protracted infusion may provide no benefit.

There are many limitations to our study. While we initially had run the ICV and IT-L arms of the study at one facility at roughly the same time, the distribution data from nearly every IT-L catheter animal indicated that the catheters were misplaced or migrated out of the intrathecal space. Due to this technical issue, the IT-L arm of the study was re-run at another facility via LP. While we tried to keep the experimental protocols as similar as possible, facility differences could impact the results of the study. One protocol difference was that the ICV animals underwent transcardial perfusion after euthanasia and the IT-L animals were exsanguinated without perfusion. At 14 days post-dose, nearly all of the ASO should be absent from the blood.³⁰ So, any blood contamination in the IT-L animals should not significantly interfere with the bioanalytical results. Additionally, the perfusion procedure would not be expected to accelerate ASO clearance out of CNS tissues peri-mortem.

The most significant limitation to our study was that the 25 mg dose was too high to observe regional differences in MALAT1 RNA KD between the ICV and IT-L groups. For example, there were trends toward higher ASO concentrations in the caudate with longer ICV infusion times that did not correlate with differences in RNA KD. This is likely due to the 25 mg dose level eliciting maximal RNA KD in this tissue, so any additional ASO that is delivered to the caudate would not show further KD. The 25 mg dose was selected based on a previous study that administered this ASO via the IT-L route in nonhuman primates.⁹ When scaled by total CSF volume (12 mL in dogs³¹ and 150 mL in humans³²), the 15 and 25 mg dose levels translates to human doses of roughly 188 and 313 mg, respectively. For comparison, tofersen is administered at a dose level of 100 mg in adult humans.³ In our study, at both the 15 and 25 mg ICV dose levels, many brain regions showed nearly maximal KD. A 10 mg dose level would likely have been a more translationally relevant dose level and may have fallen within the linear range of the dose-response curve to allow for better comparison across parameters. However, future studies should conduct a dose-response analysis at more translationally relevant dose levels with ICV and IT-L delivery and utilize a dose level that is in the linear range of the dose-response curve to better assess differences in target gene KD. Additionally, it is possible that with ICV delivery, lower doses of the ASO may achieve a targeted percentage of RNA KD and should be studied in future work.

Our study only evaluated a single administration of the ASO, and distribution/KD was only assessed at one time point post-dose. It is unknown if there are differences in distribution and RNA KD between the two routes of administration beyond the 14-day post-dose time point. Future studies could explore ASO pharmacokinetics and pharmacodynamics over a wider range of time points. However, after intra-CSF administration, ASOs rapidly distribute into CNS tissues within the 24 h post-dose and CSF levels rapidly decrease with distribution to the CNS parenchyma and CSF turnover.^30,33 After the distribution phase, ASOs typically have a long terminal half-life in CNS tissues. Given the slow clearance from CNS tissues, it would be expected that differences in ASO distribution between IT-L and ICV dosing within a CNS region would be consistent at longer time points, as clearance rate from the tissues for a particular ASO should be the same regardless of the route of delivery. Additionally, ASOs in the clinic are not administered as single doses, a more clinically relevant study design with multiple doses could be done with a therapeutic ASO in a future study. Ferguson et al., 2021 demonstrated an improvement in the relative deep brain accumulation of the di-siRNA after repetitive dosing that was achieved without a concurrent increase in cortex and spinal cord concentration. While we did not evaluate multiple time points or repeat dosing in our study, we anticipate a similar response to what was seen in that publication given the similarities in much of the data from the two studies. Future studies could also be focused on directly comparing CNS distribution of CSF delivered ASOs with differing backbone chemistries.

To our knowledge, this is the first direct comparison of ICV and IT-L routes of administration of an ASO that evaluates distribution and RNA KD in a canine model. This study demonstrates the feasibility of ICV administration of an oligonucleotide in canines, thus serving as a guide to future experiments and clinical development of oligonucleotide therapies to enhance deep brain tissue distribution beyond what can be accomplished with IT-L delivery. Many ASOs in development use nonhuman primates as their large animal species; however, the cost and wait times are difficult to work around. As long as the ASO sequence is cross-reactive with canine sequences, we believe these results demonstrate the canine is a feasible alternative to the use of nonhuman primates for direct-to-CSF delivery “on target” tolerability studies. Further, ICV delivery is a widely used approach in rodent models to provide proof of concept in CNS therapy development, including for ASOs, due to the difficulty of IT-L administration in these species.³⁴ Species selection considerations for direct-to-CNS preclinical studies and CNS parameter comparisons between humans and preclinical species have been reviewed previously.^31,35 Canines and nonhuman primates have very similar brain mass and total CSF volume.³¹ In general, canines have similar ventricular system anatomy to that of nonhuman primates and humans, though there are key differences. Canines have an additional CSF-filled cavity between the third and fourth ventricle, lack a foramen of Magendie, and have a patent central canal in adulthood.³⁶ The current understanding of canine CSF flow dynamics shows that it is similar to humans; however, it has been found that peak flow velocities at the mesencephalic aqueduct, foramen magnum, and cervical spine were slower in beagles compared to humans.³⁷ A common argument against the use of canines is their quadrupedal posture compared to the semi-bipedal posture of nonhuman primates and bipedal posture of humans.^31,35 While this is true, nonhuman primates and dogs are much more active than most humans and humans spend much of their lifespan sleeping lying down. We hypothesize that body posture during and immediately after bolus administration of a drug would likely have more of an effect on distribution than their day-to-day body positioning. IT-L and ICV dosing in preclinical species is typically done with the animal lying down. In humans, IT-L dosing via LP is typically done lying down in lateral recumbency and ICV dosing via an Ommaya reservoir has been done lying down or sitting. The clinical translatability of findings from ICV dosing in canines (e.g., disease model in dachshunds) and nonhuman primates has been demonstrated for cerliponase alfa (BRINEURA), where the two species produced similar CSF pharmacokinetic values and approximated the 300 mg dose in humans, which is now used commercially.^38,39 In the past, opportunities to translate the ICV route of delivery from animal studies to human therapies were lacking. With one approved ICV therapy, BRINEURA for Batten’s disease, and others currently or previously in development,^27,28,29 that translational opportunity is now being realized.

The ICV route necessitates device implantation to deliver therapies continuously or repeatedly into the CSF. The initial device developed for this purpose was the Ommaya reservoir (or the smaller Rickham reservoir), which was made of thin collapsible silicone. Despite its use for delivery of enzyme replacement therapy (BRINEURA), the Ommaya and Rickham reservoirs remain unchanged from their original 1950s designs. The thin silicone dome of the Ommaya provides limited durability and increases the risk of infection due to its inability to seal or “self-hold” after multiple needle insertions, which then allows for leakage into the subcutaneous space. To address these issues, Cerebral Therapeutics developed the ICVRx, a durable dual-lumen cranial port and ICV catheter, which is intended for long-term implantation and to allow for aspiration of CSF out of the lateral ventricle using a dedicated aspiration lumen for biomarker or drug concentration analysis, separate from the administration lumen. Additionally, the ICVRx is designed to allow for optionality as it can be used for bolus injections using a subcutaneous access port or continuous administration using implanted infusion pumps, as was used in a clinical trial intended to treat subjects with focal seizures of temporal lobe onset (NCT04153175). To enable a clear path for IND enabling work in large animal species, a smaller, single lumen version of the device, the K9ICVRx, was also developed and used in this study. The ICVRx has been proven effective in clinical trials and represents a transformative advancement in CNS drug delivery.

The present study successfully demonstrates the advantages of the ICV route of administration, compared to IT-L delivery, when targeting deep brain regions. This study also supports a translatable path to human clinical trials by using a proprietary ICV cranial port and catheter intended for human use but modified for the canine or primate sized brain. Additional studies examining biodistribution differences between these routes of administration are needed for other therapy modalities, such as enzymes, therapeutic antibodies, and small molecules.

Materials and methods

Ethics statement

The beagle dog was chosen as the test system because of its established usefulness and acceptance as a model for toxicological and pharmacological studies in a large animal species. All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals. The protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of Northern Biomedical Research (NBR) and BioTox Sciences (BTS) in San Diego. The IACUC protocol number for the study conducted at BTS was 22-013.

ASO

The ASO used for this study, ION-626112, was designed to reduce the MALAT1 RNA expression in multiple preclinical species and is cross-reactive to canine MALAT1.⁹ The ASO is a 20 base long chemically modified DNA molecule of the sequence GCCAGGCTGGTTATGACTCA. The 5 bases on both the 5′ and 3′ ends have 2′ methoxyethyl (MOE) sugar modifications and the backbones are mixtures of phosphorothioate and phosphodiester linkages. On the day of dosing, 5, 15, and 25 mg/mL formulations were diluted gravimetrically with appropriate amounts of preservative free artificial CSF (aCSF) to 2.5, 7.5, and 12.5 mg/mL solutions and sterile filtered through a 0.22 μm sterile filter. The vehicle control article administered in this study was aCSF. We administered a range of ASO doses (5, 15, and 25 mg) for ICV bolus administration. For ICV infusions and IT-L delivery, we administered 25 mg of ASO. The highest dose (25 mg) and the duration between dosing and tissue harvest were selected based on the highest dose of this ASO previously administered in primates via the IT-L route.⁹ The dose of MALAT1 ASO used in this canine study is comparable to the dose used in NHPs.⁹

ICV administration of the ASO in beagle dogs

Animals used for ICV dosing (16–18 months of age) were purchased from Envigo Global Services, Inc. The animals were pair or group housed and acclimated at Northern Biomedical Research, an AAALAC-accredited facility, in compliance with the Guide for Care and Use of Laboratory Animals. Animals used for ICV dosing underwent pre-surgery magnetic resonance imaging (MRI) performed on a 3 tesla (T) Philips MRI to determine the lateral ventricle target coordinates for catheter placement. All animals had the catheter implanted in the left lateral ventricle, with the exception of one animal that had the catheter implanted in the right ventricle based on differences in ventricular anatomy. Animals were implanted with the ICV delivery system using stereotaxic methods. Animals were pre-treated with maropitant citrate (1 mg/kg SQ [subcutaenous]), alfaxalone (2.5 mg/kg IM [intramuscular]), dexmedetomidine (0.005 mg/kg IM), and hydromorphone (0.1 mg/kg IM). Once sedated, animals were maintained on isoflurane to effect via inhalation in O₂ and administered cefazolin (25 mg/kg IV [intravenous]), cefovecin extended release (8 mg/kg SQ), dexamethasone (0.5 mg/kg IV), and buprenorphine SR (0.12 mg/kg SQ). During surgery, the animals received 15 mL/kg/h IV 0.9% sodium chloride fluids. An incision was made over the calvarium using the pre-determined stereotaxic coordinates and a 14 mm craniotomy was drilled. The K9ICVRx cranial port was placed over the burr hole and the ICV catheter was inserted through the center of the cranial port into the lateral ventricle using a stereotaxic manipulator. The ICV catheter was secured into the port and the presence or absence of CSF flow from the catheter was noted. Fluoroscopy was performed using Iohexol 180 to further confirm the placement of the catheter tip within the lateral ventricle. An ultra-high molecular weight polyethylene (UHMWPE) cap was placed over the center of the cranial port. An incision was made to place a subcutaneous access port (Low Profile Titanium Port, AVA Biomedical) near the scapula. A primed catheter was attached to the ICV cranial port and connected to the Cath-in-Cath sheath catheter (AVA Biomedical) using a titanium catheter connector. The incisions were closed with suture and tissue adhesive was applied to the incision. Animals received atipamezole (5 mg/mL IM at an equivalent volume to the dexmedetomidine dose as needed) and meloxicam (0.2 mg/kg PO (by mouth) on postoperative day 2 and 0.1 mg/kg PO on postoperative day 3 and 4) post-surgery and underwent at least 10 days of post-surgical recovery. All animals recovered well within the post-surgical recovery period.

ICV animals who received a single bolus dose of either aCSF or the MALAT1 ASO received a dose volume of 2 mL over approximately 2 min followed by a 0.5 mL aCSF flush administered at about the same rate through the port/catheter system. ICV animals who received either a 6-h or 40-h infusion received a dose volume of 2 mL followed by a 0.5 mL aCSF flush using a 20-gauge Cath-in-Cath Kit (AVA Biomedical) and a 3D mini infusion pump (SAI Infusion Technologies) carried in a jacket worn by the animals. Two ICV bolus dosed animals required sedation during dosing due to aggression; these animals were provided hydromorphone (0.05 mg/kg IV) and dexmedetomidine (0.025 mg/kg) during or prior to dosing and after dosing was complete, and they received atipamezole (0.25 mg/kg IM) to reverse sedation. Throughout the study, animals were observed cage side twice daily to monitor for clinical signs. Fourteen days after dosing, the animals were euthanized and perfused with 0.001% sodium nitrite in saline via transcardial whole body perfusion. The brain and spinal cord were harvested from each animal. The brain was cooled on ice and placed in a canine brain matrix, where it was sliced into 4 mm thick brain slices. Alternating slices were either fixed in 10% formalin or were frozen. Portions from the cervical, thoracic, and lumbar spinal cord were divided and either fixed in 10% formalin or were frozen.

IT-L administration of the ASO in beagle dogs

The in-life portion of the study was performed at BTS in San Diego. Male beagle dogs from Inotiv were randomly divided into experimental groups. For the IT-L catheterization, a skin incision was made over the L7/S1 intervertebral space, and a 27-gauge x 4-inch-long Wiley intrathecal catheter was inserted through the muscle into the intrathecal space between the L7 and S1 vertebrae. Proper placement of the catheter was confirmed by observation of CSF flowing into the hub of the catheter. The catheter was attached to a MINLOA titanium port using silicone tubing. The port was then sutured to the muscle and the incision sutured closed in layers.

For all IT-L dosing, animals were administered Propofol at 6–9 mg/kg, animals were intubated, and anesthesia maintained using isoflurane gas anesthesia. The animals were treated prophylactically with buprenorphine (0.01–0.02 mg/kg, SQ) before dosing, and ketoprofen (2 mg/kg, IM) was administered for 3 days after dosing and enrofloxacin (5 mg/kg, IM) for 7 days after dosing. Animals were administered 25 mg MALAT1 ASO.

For the IT-L catheterized animals, a needle attached to a stop cock and two syringes was inserted into the subcutaneous port and the ASO was administered in a dose volume of 1 mL over about 1 min followed by a 0.5 mL flush of aCSF. For the LP animals, a 25-gauge x 3-inch long Pencan pencil point spinal needle was inserted between the L7 and S1 vertebrae. Proper placement of the needle was confirmed by observation of CSF in the hub of the needle. A 3-way stopcock with two syringes containing the ASO and aCSF was attached to the hub of the Pencan needle, 1 mL of the ASO (25 mg dose) was infused over approximately 1 min, and the needle was flushed with 0.5 mL aCSF.

Fourteen days after dosing, the animals were anesthetized with propofol and euthanized with euthasol solution (100 mg/kg pentobarbital). The animals were then exsanguinated by bilateral laceration of the femoral arteries. The brain and spinal cord were harvested from each animal. The brain was cooled on ice and placed in a canine brain matrix, where it was sliced into 4 mm thick brain slices. Alternating slices were either fixed in 10% formalin or were frozen. Portions from the cervical, thoracic, and lumbar spinal cord were divided and either fixed in 10% formalin or was frozen.

CSF collection

CSF was collected from the ICV animals under anesthesia immediately prior to euthanasia from the lateral ventricles, cisterna magna, and lumbar cistern. To collect CSF from the ipsilateral lateral ventricle, the cap was removed from the K9ICVRx and a blunt needle was inserted into the ICV catheter to collect the sample. Collection of CSF from the contralateral lateral ventricle was done via a small diameter craniotomy where a spinal needle was inserted into the lateral ventricle to aspirate CSF. Cisterna magna and lumbar cistern CSF were collected by a cisterna magna tap and lumbar tap, respectively.

Tissue processing

Frozen and fixed tissue samples were transported on dry ice to Ionis Pharmaceuticals, Inc. for further processing and analysis. At Ionis Pharmaceuticals, the frozen spinal cord samples from the cervical, thoracic, and lumbar regions were further sliced in cross section with a razor blade to provide samples for RT-qPCR (quantitative real-time PCR) (∼1 mm thick slice) and bioanalysis (∼1 cm thick slice). The frozen brain slices were sampled with biopsy punches guided by an online canine brain atlas (https://vanat.ahc.umn.edu/brainAtlas/) to provide samples for qRT-PCR (2 mm diameter) and bioanalysis (4 mm diameter). The frozen RT-qPCR samples were placed into 2 mL 96-well plates with 1 mm diameter ceramic beads and stored frozen until further processing. The frozen bioanalysis samples were placed into 48-well plates and stored frozen until further processing.

Histological and immunohistological staining

The formalin fixed tissues were trimmed and processed using a large animal brain protocol on a Sakura Tissue Tek tissue processor after embedding slides were cut at 4 μm, air dried overnight, and dried at 60°C for 1 h. Slides were stained with Rabbit polyclonal ASO (Ionis) antibody on a Ventana Ultra staining system. ASO slides were treated enzymatically with trypsin (Sigma, T8003). The slides were then blocked with endogenous biotin blocking kit (Ventana, 760-050) and normal goat serum (Jackson Immuno Labs, 005-000-121). The primary antibody was diluted with discovery antibody diluent (Ventana, 760-108) and incubated for 1 h at 37°C. The antibodies were detected with biotin labeled goat anti rabbit secondary antibody (Jackson Immuno Labs, 111-005-003). The secondary antibody was labeled with DAB map kit (Ventana, 760-124). The rabbit polymer was labeled with Ventana ChromoMap DAB kit (Ventana, 760-159). Images were scanned on a Hamamatsu S360 scanner at 20X resolution. Image interpretation was qualitative due to the DAB labeling enzyme reaction not necessarily being linear.

PCR analysis

The RT-qPCR analysis was performed at Ionis Pharmaceuticals. For this, 1.0 mL of TRIzol reagent (Invitrogen) was added to each well of the 96-well plates containing the RT-qPCR samples, and the samples were agitated on a plate shaker (Verder Scientific) for at least 30 s or until the samples were homogenized by the beads. Then 0.2 mL of chloroform was added to the homogenates and the plates were shaken again. The solution was incubated for 5 min and centrifuged at 3000 × g to cause phase separation, after which 0.35 mL of the aqueous phase of the separation was collected into a new plate and an equal volume of 70% ethanol added. This solution was mixed and transferred to an RNeasy 96-well plate (Qiagen) and the RNA extraction was performed according to the manufacturer’s instructions. The RNA was eluted from the plate with 0.12 mL of water. The primer/probe sets used are presented in Table 1.

Table 1.

Primer sequences

Gene	Forward primer	Reverse primer	Probe
MALAT1	TGCAGTTCGTGGTGAAGATAG	CAAATCGTTAGGGCTCCTTCT	AGCCAGTGCTGTTTGGTGAAGGAA
Gapdh	GTCATCATCTCTGCTCCTTCTG	GCTGACAATCTTGAGGGAGTT	TGATGGGCGTGAACCATGAGAAGT

The PCR reaction was performed in 384-well plate format using a QuantStudio instrument. The reactions consisted of 10 μL of AgPath-ID reagent (Thermo Fisher Scientific), 400 nL of RNA and 50 nL of the primer probe sets. The concentrations of the MALAT1 and GAPDH RNA in the unknown samples were determined by interpolation on a standard curve for each of the RNA species. The MALAT1 RNA concentrations were normalized using the GAPDH mRNA concentrations from the same sample and the MALAT1 RNA expression in each sample was expressed as a percentage of the mean vehicle control value.

ASO quantification

Bioanalysis of the concentrations of ASO in the tissue samples was performed at Ionis Pharmaceuticals. Frozen tissue samples were weighed into individual wells of a 2 mL, 96-well plate containing approximately 0.25 cm³ matrix green homogenization beads. Homogenization buffer (20 mM Tris pH 8, 20 mM EDTA, 0.1M NaCl, 0.5% NP40) was added and the samples were homogenized using the Mini-Beadbeater System (Thomas Scientific, Swedesboro, NJ). Samples were subsequently treated with ammonium hydroxide and extracted by liquid-liquid extraction (LLE) using phenol:chloroform:isoamyl alcohol (25:24:1), followed by a solid phase extraction (SPE) using a 96-well Strata-X packed plate (Phenomonex Inc., CA) and a final pass through using a protein precipitation plate (Phenomonex Inc., CA). Eluates were dried down under a nitrogen flow at 50°C before reconstituting with 100 μL water containing 100 μM EDTA. Samples were analyzed by ion-pairing (IP) LC-MS/MS with an Agilent 6460 LCMS/MS system (Agilent, Wilmington, DE, USA), using an ACQUITY UPLC OST C18 column (Waters, Milford, MA, USA) heated to 55°C with a flow rate of 0.3 mL/min. The binary IP solvent system, consisting of aqueous mobile phase A (400 mM 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) and 15 mM triethylamine (TEA) and mobile phase B (MeOH) was used to create a gradient from 10% to 40% MeOH over 6 min to elute the analyte. Mass measurements were made on-line using the multiple reaction monitoring (MRM) scan mode, specifically measuring the precursor of m/z 793.7 and product ion of m/z 94.8 for analyte ION-626112, and m/z 662.9 and 94.8 for the internal standard ION-440762. Ionization source parameters were −1500 V spray voltage, 25 psi nebulizer gas flow, 12 L/min sheath gas flow rate at 350°C, 5 L/min drying gas flow rate at 350°C, and a capillary voltage of −3750 V. Spectral output was analyzed using the Agilent Mass Hunter software. Concentrations of ION-626112 were quantified from its calibration curve, which had a quantitation range of 0.0072 μg/g (0.001 μM) to 179 μg/g (25 μM).

Data analysis

Statistical analyses were performed using GraphPad-Prism. p values of less than 0.05 were considered statistically significant. Statistical analysis methods are described in the figure legends.

Data and code availability

Data supporting the results in this manuscript are available upon reasonable request from the corresponding author.

Acknowledgments

This research was funded by Cerebral Therapeutics and Ionis Pharmaceuticals. The authors would like to acknowledge Northern Biomedical Research, BTS, and the other team members at Cerebral Therapeutics and Ionis Pharmaceuticals that were involved in the studies.

Author contributions

Conceptualization, formal analysis, writing – original draft: M.M.B.; conceptualization, formal analysis, project administration, writing – original draft: C.M.; formal analysis, writing – original draft: K.P.; conceptualization, project administration, writing – review & editing: R.L.Z.; investigation, methodology: E.A.; investigation and writing – review: J.D. and S.K.K.; Conceptualization, writing – original draft, supervision: L.L.S.

Declaration of interests

M.M.B., K.P., R.L.Z., and L.L.S. are paid employees of Cerebral Therapeutics. C.M., J.D., and S.K.K. are paid employees of Ionis Pharmaceuticals. E.A. is a paid consultant of Cerebral Therapeutics.