Skip to main content
CytoJournal logoLink to CytoJournal
. 2025 Sep 19;22:84. doi: 10.25259/Cytojournal_70_2025

Ginsenoside Rb1 attenuates erythropoietin-exacerbated vascular calcification in chronic kidney disease through BMP2-dependent Smad1/5/9 inhibition

Xunjia Li 1,2,3,#, Zhixin Xu 4,#, Ying Li 1, Yan Luo 1, Jie Zhou 3, Deyu Zuo 2,3,5,, Weijian Xiong 1,*
PMCID: PMC12596813  PMID: 41216233

Abstract

Objective:

Patients with chronic kidney disease (CKD) exhibit increased vascular calcification (VC) risks, worsened by high-dose erythropoietin (EPO). While EPO treats anemia, its role in VC pathogenesis remains unclear. Ginsenoside Rb1 (Rb1), a Panax ginseng compound with anti-calcification properties, may counteract EPO-induced VC through the GATA binding protein 6 (GATA6)/bone morphogenetic protein 2 (BMP2)/Smad1/5/9 pathway. This article aims to explore whether Rb1 could counteract EPO-induced VC through the GATA6/BMP2/Smad1/5/9 pathway.

Material and Methods:

Adenine-induced CKD rats and b-glycerophosphate-treated vascular smooth muscle cells (VSMCs) received EPO ± Rb1. Calcification was assessed through von Kossa/alizarin red staining. Smooth muscle protein 22-a (SM22a)/a-Smooth muscle actin (a-SMA) expression was measured by immunofluorescence and real-time-quantitative polymerase chain reaction (RT-qPCR). GATA6/BMP2/Smad1/5/9 activation was analyzed using RT-qPCR/Western blot. Rb1-BMP2 interactions were tested through biotin pulldown, micro-thermophoresis, and Co-immunoprecipitation (Co-IP). GATA6 knockdown validated pathway roles.

Results:

High-dose EPO significantly worsened CKD-associated calcification and VSMC calcification (P < 0.01), suppressed SM22a and a-SMA expression levels, and activated the GATA6/BMP2/Smad1/5/9 pathway (P < 0.01). GATA6 knockdown reduced EPO-exacerbated calcification and modulated BMP2/Smad1/5/9 signaling (P < 0.01). Rb1 increased SM22a and a-SMA expression levels and inhibited Smad 1/5/9 phosphorylation (P < 0.01), without affecting GATA6 or BMP2 expression (P > 0.05). Molecular docking and Co-IP experiments revealed that Rb1 binds directly to BMP2, blocking its interaction with bone morphogenetic protein receptor and inhibiting Smad 1/5/9 phosphorylation (P < 0.01).

Conclusion:

Rb1 mitigates EPO-aggravated VC in CKD by disrupting BMP2/Smad1/5/9 signaling, positioning it as a promising molecular intervention strategy to reduce EPO-induced vascular toxicity.

Keywords: Bone morphogenetic protein 2/Smad1/5/9 signaling pathway, Chronic kidney disease, Erythropoietin, Ginsenoside Rb1, Vascular calcification

INTRODUCTION

Among all chronic diseases, chronic kidney disease (CKD) has the highest rate of increased disability and mortality, making it a global public health concern.[1] One of the main causes of increased cardiovascular morbidity in patients with CKD is vascular calcification (VC), a frequent condition that is closely linked to cardiovascular events.[2] VC, also known as intimal or intima-media calcification, is a clinical disease that is typified by aberrant calcium deposition within the vascular wall.[3] VC is caused by faulty calcium-phosphorus balance, aberrant breakdown of smooth muscle elastic membranes, phenotypic alteration of vascular smooth muscle cells (VSMCs), and compromised anti-calcification systems.[4-6] VC occurs in the smooth muscle layer of the big and medium arteries.[7] The pathology can be defined as accumulation of calcium salts in the arteries’ internal elastic layer, which increases vascular stiffness, systolic pressure, pulse pressure, and pulse rate.[8] As a result, most patients with CKD experience heart failure, diastolic dysfunction, and left ventricular hypertrophy. Thus, the prevention and mitigation of VC has an important role in reducing cardiovascular events and mortality in people with CKD.

The primary treatment for renal anemia is erythropoietin (EPO), an endogenous glycoprotein that controls erythropoiesis.[9] However, according to a number of CKD patient studies, high EPO dosages are linked to a high risk of death and cardiovascular issues in patients with CKD.[10] EPO can directly affect VSMC and affect cell survival, proliferation, and functional status.[11] EPO mimics the pathophysiology of VC in CKD by promoting osteoblast and chondrocyte maturation and improving the bone-healing process.[12,13] It increased alkaline phosphatase (ALP) activity in VSMC and transcription factors linked to bone formation, causing calcification in a dose-dependent manner. Therefore, the current cornerstone of treatment for CKD calcification is regulating disruptions in the metabolism of calcium and phosphorus. Furthermore, EPO causes calcium deposition in VSMC by upregulating the transcription factor GATA-binding protein 6 (GATA6), which attaches to the promoter of bone morphogenetic protein 2 (BMP2), a crucial protein in calcification.[14] In vivo, EPO worsens VC in CKD rats, in addition to causing VC in normal rats.[15] However, how EPO exactly improves VC in CKD which remains unknown.

Kidney diseases have long been prevented and treated with traditional Chinese medicine (TCM).[16,17] Chinese medications have a distinct advantage in the regulation of VC progression by blocking inflammatory reactions, altering signaling pathways linked to calcification, and controlling calcium-phosphorus equilibrium. Some herbal components have been found to have preventive effects against cardiovascular and renal disorders.[18-21] Ginsenosides are the main bioactive components of the plant ginseng. One of the most prevalent ginsenosides, ginsenoside Rb1 (Rb1) has anti-renal fibrosis, vascular endothelial cell protection, and VC inhibitory properties.[22,23] Rb1 can reduce the accumulation and death of calcium salt caused by the increase of phosphorus level in vascular endothelial cells by regulating the expression levels of androgen receptor and Gas6.[24] However, how Rb1 affects VSMC VC in patients with CKD, particularly in those whose condition worsened after using EPO, and the associated mechanisms are unknown.

This study explored the effects of EPO on the pathologic process of VC in CKD rats. The role of Rb1 in the exacerbation of CKD VC by EPO was analyzed, and the related molecular mechanisms were explored in vivo and in vitro. This study provides new insights into the role of Rb1 in VC in CKD.

MATERIAL AND METHODS

Rat calcification model establishment

Eight-week-old male Sprague-Dawley (SD) rats, weighing between 180 g and 220 g, were obtained from Ensiweier Biotechnology Co., Ltd. (Chongqing, China). All rats were confined under standardized conditions, with unrestricted access to food and water, and maintained on a 12 h light/dark cycle. The environmental conditions were regulated to a temperature of 23 ± 2°C and a humidity of 35–60%, with adaptive feeding for 7 days. Given that an adenine-induced diet can cause renal failure in rats, which is similar to the pathological process in humans, and the process is simple with reduced stress response in rats, an adenine diet was chosen to establish a rat model of CKD.[25] The control group was fed a standard diet, whereas the CKD group was fed a diet containing 0.75% adenine (Merck, A9126-25G, Shanghai, China) for 8 weeks to establish a model of calcification in CKD rats.[26]

Construction and packaging of adeno-associated virus (AAV)-GATA6 shRNA AAV vector

pAAV-EnCMV-MCS-U6-shRNA was used as the GATA6 knockdown vector. Two sequences (GATA6-F: 5' GATCCGTAGCGTGAGTGGCGGTGGCGGCTCGAG CCGCCACCGCCACTCACGCTATTTTTTG 3' ; GATA 6-R: 5' AATTCAAAAAATAGCGTGAGTGGCGGTGGCGGC TCGAGCCGCCACCGCCACTCACGCTACG 3') were inserted into the BamHI-HindIII restriction sites of the pAAV-EnCMV-MCS-U6-shRNA plasmid, generating AAVGATA6 shRNA. AAV-vector was used as a control. A three-plasmid AAV system was employed for viral packaging. 293T cells (CVCL_1926, CRL-11268, ATCC, Manassas, VA, USA) were cultured to 80–90% confluency before transfection. AAV-GATA6 shRNA and AAV-vector were transfected into 293T cells using a Max Transfection Reagent (24765-1, BioMedicine, Chongqing, China). After 72 h, cell pellets were collected and subjected to three freeze-thaw cycles (−80°C/37°C water bath) to release AAV particles (the serotype of AAV was AAV9).

Animal grouping and treatment

Sixty SD rats were randomly assigned to five groups (n = 12 each) after successful establishment of the CKD model: Control group, CKD group, and CKD + EPO groups (1000, 1500, and 2000 U/kg/W). The EPO groups received intraperitoneal injections of EPO (592302, bioleg, San Diego, CA, USA) 3 times/week in accordance with their respective dosages. EPO treatments were administered at the same time as adenine. The control and CKD groups were given an equivalent volume of saline (S790534-500 mL, Macklin, Shanghai, China). Eight weeks later, the rats were anesthetized with 50 mg/kg of pentobarbital sodium (P3761, BSZH Scientific Inc., Beijing, China) through intraperitoneal injection and euthanized by cervical dislocation. Blood and abdominal aortic samples were harvested for analysis.

For the AAV-GATA6 shRNA-interfered CKD model, 48 SD rats were divided into four groups (n = 12 each): control group, CKD + EPO high-dose group (2000 U/kg/W), CKD + EPO + AAV-vector (AAV-vector) group, and CKD + EPO + AAVGATA6 shRNA (AAV-GATA6 shRNA) group. The rats were injected with the corresponding AAV through the tail vein (100 μL/rat; the serotype was AAV9, and the virus titer was 5.0 × 1011 μg/mL[27]) in accordance with their group assignment. The remaining two groups received an equivalent volume of saline. After 4 weeks, the rats were treated simultaneously with 0.75% adenine and EPO at high doses (2000 U/kg/W, 3 times/week). The control group was injected with an equal amount of saline daily. After 8 weeks, all rats were anesthetized to collect blood, 1 mL of phenobarbital sodium (≥150 mg/kg) was injected intravenously into rats for euthanasia. The signs of respiratory cessation, disappearance of heartbeat, and loss of corneal reflex were observed to confirm their death. Finally, the rats were dissected and the abdominal aortic tissues were collected for subsequent research.

For the Rb1-treated CKD model, 60 SD rats were divided into five groups (12 rats per group): control group, CKD + EPO high-dose group (2000 U/kg/W), and CKD + EPO + Rb1 groups (Rb1: 20, 40, and 60 mg/kg/day). The dosage of Rb1 was determined by referring to the existing research results.[28-30] In accordance with the grouping, the rats were treated simultaneously with 0.75% adenine and high-dose EPO (2000 U/kg/W, 3 times/week). After 8 weeks, the Rb1 group was injected intraperitoneally with Rb1 (BP4107, G-CLONE, Beijing, China) daily at the indicated doses. The control and CKD groups were injected with an equal amount of saline daily. After 8 weeks, all rats were anesthetized for blood collection and then 1 mL of phenobarbital sodium (≥ 150 mg/kg) was injected intravenously into rats for euthanasia. Finally, abdominal aortic tissue samples were collected for subsequent analysis.

The animal study was conducted following the ARRIVE guidelines. All animal experimental procedures complied with the ethical standards of and approved by the Ethical Committee on Welfare of Laboratory Animals, Chongqing Traditional Chinese Medicine Hospital (2024-DWSY-LXJ, ethical approval date: August 15, 2024).

Enzyme-linked immunosorbent assay

Whole blood samples were stored at 4°C overnight and then centrifuged at 2–8°C for 15 min at 3000 rpm (SLX-1024F, Servicebio, Beijing, China). Blood was then collected, and plasma concentrations of hemoglobin, creatinine, ALP, phosphorus, and calcium were quantified using an automated biochemical analyzer (Chemray 240, Rayto, Shenzhen, China) and corresponding kits (Nanjing Jianjian Bioengineering Institute, Nanjing, China).

Von Kossa staining

Abdominal aortic tissue sections were fixed with 4% paraformaldehyde (C104190-500 g, Aladdin, Shanghai, China), embedded with paraffin, dewaxed, and rehydrated. Then, von Kossa stain (G1043, Servicebio, Beijing, China) was applied to the sections, followed by UV irradiation for 1 h until color development was complete. Hematoxylin staining was performed for 3–5 min, and the sections were rinsed with distilled water and blued with a bluing reagent. The sections were dehydrated with different concentrations of ethanol, stained with eosin (Servicebio, G1043-3, Wuhan, China) for 5 min, dehydrated again, washed with xylene, mounted with resin (10004160, Sinopharm, Beijing, China), and viewed under a microscope (Nikon Eclipse E100, Nikon, Japan) to capture images. Von Kossa staining was evaluated on the basis of the average optical density of positive reactions using Image-Pro Plus (version 6.0) software (Media Cybernetics, Inc., Rockville, MD, USA).

Alizarin red staining

The calcium deposits in the aortic tissue and VSMCs were stained using Alizarin Red S solution (G1038, Servicebio, Beijing, China). The 4% paraformaldehyde-fixed aortic tissues and VSMCs were exposed to Alizarin Red S solution for 5–10 min, adjusting the staining time in accordance with the calcium content, and then washed again with distilled water. Calcium deposits were observed and imaged under a microscope (Nikon Eclipse E100, Nikon, Japan). They are shown as red areas.

Immunofluorescence

Abdominal aortic tissues were fixed in paraformaldehyde, followed by standard paraffin embedding and deparaffinization/rehydration as described for von Kossa staining. Antigen repair was performed by microwave irradiation in ethylenediaminetetraacetic acid. The tissue sections were then incubated with 5% normal goat serum (C0265, Beyotime, Shanghai, China) in PBS/0.1% Triton X-100 solution for 1 h at room temperature. They were incubated overnight at 4°C with SM22a rabbit mAb (1:200, A21209, ABclonal, Wuhan, China) or a-SMA rabbit mAb (1:200, A2235, RRID: AB_2862980, ABclonal, Wuhan, China). Afterward, the slices were incubated for 1.5 h with fluorescein (FITC)-labeled goat anti-rabbit immunoglobulin G (IgG, 1:200, GB22303, RRID: AB_2904189, Servicebio, Wuhan, China). After the sections were thoroughly washed with PBS, the nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (C1005, Beyotime, Shanghai, China) and visualized under a fluorescence microscope (MF53, Mshot, Guangzhou, China). Then, the images were imported into Image-Pro Plus (version 6.0) software (Media Cybernetics, Inc., Rockville, MD, USA). The threshold was adjusted, and appropriate regions of interest (ROIs) and thresholding algorithms were selected. Within the designated ROI, the “Measure” function was utilized to quantify the fluorescence signal intensity, and the “Mean gray value” was chosen as the quantitative indicator for the average fluorescence intensity.

Real-time quantitative polymerase chain reaction (RT-qPCR)

TRIzol reagent (CW0580S, ComWin, Beijing, China) was utilized for total RNA extraction of aortic tissues. RNA was reverse transcribed into cDNA using a Goldenstar RT6 cDNA Synthesis Kit (version 2, TSK302M, Tsingke, Beijing, China). Quantitative PCR was conducted using a real-time PCR system (IQ5, Bio-Rad, USA) with 2 × T5 Fast qPCR Mix (SYBR Green I, TSE202, Tsingke, Beijing, China) following the manufacturer’s instructions. GAPDH was used as an internal control. The relative mRNA expression was calculated by 2–ΔΔCt method. The detailed gene primer sequence information is displayed in Table 1.

Table 1:

Primer sequences used in RT-qPCR.

Primer Sequence
α-SMA-F ACCATCGGGAATGAACGCTT
α-SMA-R CTGTCAGCAATGCCTGGGTA
SM22α-F CCGTGACCAAGAACGATGGA
SM22α-R CAAAGCTGTCCGGGCTAAGA
BMP2-F GTCCCTCGGACAGAGCTTTT
BMP2-R CAACACTAGAAGACAGCGGGT
GAPDH-F CAATCCTGGGCGGTACAACT
GAPDH-R TACGGCCAAATCCGTTCACA

α-SMA: α-Smooth muscle actin, SM22α: Smooth muscle protein 22-α, BMP2: Bone morphogenetic protein 2, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, RT-qPCR: Real-time quantitative polymerase chain reaction, A: Adenine, C: Cytosine, G: Guanine, T: Thymine.

Co-immunoprecipitation (Co-IP) and Western blot (WB) analysis

RIPA lysis solution (P0013B, Beyotime, Shanghai, China) and protease and phosphatase inhibitors were used to lyse the harvested VSMCs for 15 min on ice. Afterward, the lysate was sonicated for 2 min at 10% power on ice. The supernatant was precleared by incubating it with protein A + G magnetic beads (Millipore) and IgG (CST) for 1 h at 4°C following centrifugation at 12,000 g for 20 min at 4°C. Next, the samples spent 1 min in a magnetic separator. On a rotating platform, the supernatant was incubated with the specified antibody for the entire night at 4°C. After protein A + G magnetic beads were added to the supernatants, they were allowed to sit at room temperature for 2 h. The immunocomplexes were washed 3 times with lysis buffer, boiled at 95°C for 10 min with 2× sodium dodecyl sulfate (SDS) sample buffer, and analyzed by WB.

For WB analysis, a small amount of aortic tissue was homogenized in RIPA lysis buffer (P0013B, Beyotime, Shanghai, China). Total protein was quantified by BCA method (Pierce, #23225). Equal amounts of proteins in each sample were separated by 12% SDS-polyacrylamide gel electrophoresis (G2083, Servicebio, Beijing, China), and then, the separated proteins were transferred onto the polyvinylidene difluoride (PVDF, 10600023, Cytiva, Shanghai, China) membrane. The membranes were incubated with GATA6 (rabbit monoclonal antibody, 1:1000, ab317012, Abcam, Shanghai, China), BMP2 (RRID: AB_2757044, rabbit polyclonal antibody, A0231, ABclonal, Wuhan, China; used for Co-IP: rabbit monoclonal antibody, 1:1000, ab284387, Abcam, Shanghai, China), BMPR (RRID: AB_10856745, rabbit polyclonal antibody, 1:1000, bs-1509R, Bioss, Beijing, China), Smad1/5/9 (RRID: AB_2834266, rabbit polyclonal antibody, 1:1000, AF0614, Affinity, Liyang, China), p-Smad1/5/9 (RRID: AB_2840375, rabbit polyclonal antibody, 1:1000, AF8313, Affinity, Liyang, China), and the endogenous reference GAPDH (RRID: AB_ 2862549, rabbit monoclonal antibody, A19056, ABclonal, Wuhan, China). The primary antibodies were incubated at 4°C overnight. After being washed, the PVDF film was incubated with goat anti-rabbit IgG horseradish peroxidase-coupled secondary antibody (RRID: AB_2769854, 1:2000, AS014, Abclonal, Wuhan, China) for 1 h at room temperature. An ECL kit (34580, Thermo, MA, USA) was used for detection, and the ECL exposure solution evenly covered the whole film. The reaction was placed into a gel imager (Universal Hood II, Bio-Rad, USA) after 1 min. Densitometric analysis was performed using ImageJ software to determine the relative protein expression, and the ratio of the gray value of the target band to the gray value of the internal reference (GAPDH) band was used as the relative expression of the target protein.

VSMC culture and treatment

The correct rat VSMC cell line (MZ-336123, MINGZHOUBIO, Ningbo, China), which has been authenticated by the manufacturer through STR profiling, was cultured in DMEM (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (AC03L055, Life iLab, Shanghai, China) and 1% penicillin/streptomycin (C0222, Beyotime, Shanghai, China), with medium changes every 2 days. Logarithmically grown cells were divided into five groups [(control group, EPO group, and EPO + Rb1 groups (20, 40, and 80 μM] for culture. In all groups except the control group, 250 U/mL of EPO (HY-P73040, MCE, USA) and 10 mmol/L of b-glycerophosphate (MB3195-1, MeilunBio, Dalian, China) were added to induce VSMC calcification. The Rb1 groups received 20, 40, and 80 μM of Rb1 (MB6856-1, MeilunBio, Dalian, China) accordingly. The dosage of Rb1 used for cell treatment was determined on the basis of the findings of previous studies and those of our own preliminary experiments.[29] The cells were incubated for 14 days at 37°C in a 5% CO2 incubator (BPH-9042, Yiheng, Shanghai, China) before collection. VSMCs were tested quarterly for mycoplasma contamination using PCR-based methods, and the results were negative.

Molecular docking

Molecular docking of Rb1 and BMP2 mimicry was performed on the basis of literature and previous studies.[31] Docking was performed using standard protocols. The crystal structure of the BMP2 protein was downloaded from the PDB database (protein number: 6OMN), and then, molecular docking of human BMP2 and Rb1 monomers was performed using Autodock4.2 (Scripps Research, La Jolla, California, USA) software and visualized by Discovery Studio 2021 Client software.

Biotin pulldown assay

Biotinylated Rb1 was mixed thoroughly with extracted total protein. This mixture was incubated with streptavidin-coated magnetic beads (HY-K0208, MCE, USA) to pull down the biotin-captured protein complexes, which were then analyzed by WB to identify Rb1-binding proteins.

Microscale thermophoresis (MST)

BMP2 was labeled using the RED-NHS Protein Labeling Kit (MO-L011, Monolith, Germany), following the protocol provided by the manufacturer and using the buffer provided to label the BMP2 protein with a molar ratio of dye to protein of 2–3:1. The mixtures were incubated in the dark at room temperature for 30 min to remove any unbound dye. Absorbance was measured at 280 and 650 nm using a nanophotometer (NanoDrop One/One C, Thermo, USA) to determine labeling efficiency (F/P). Rb1 was then mixed with labeled BMP2, and the mixture was analyzed using a Monolith NT.115 MST instrument (NanoTemper, Germany) to determine the thermophoretic coefficients at different drug concentrations. Data were fitted and dissociation constants (Kd) were determined using MO.affinity Analysis (version 2.3) software (NanoTemper Technologies, Germany).

Statistical analysis

Data were analyzed using GraphPad Prism (version 10.0). The results are expressed as mean ± standard deviation. One-way analysis of variance was employed, supplemented by Tukey’s multiple comparison post hoc analysis, to assess differences across various groups. Statistical significance was determined with P-value threshold of <0.05.

RESULTS

EPO-induced exacerbation of VC in CKD rats

In this study, whether EPO treatment aggravated VC in CKD rats was determined. A CKD model was established by feeding rats with food containing 0.75% adenine for 8 weeks, and the hemoglobin, serum creatinine, ALP, phosphorus, and calcium levels in the CKD rats after treatment with different doses of EPO were evaluated. The results showed that the plasma levels of serum creatinine, ALP, phosphorus, and calcium were significantly higher in the CKD rats than in the control group (P < 0.01), whereas the hemoglobin concentration was significantly lower (P < 0.01). The hemoglobin, serum creatinine, ALP, phosphorus, and calcium levels in the plasma of EPO-treated rats were significantly upregulated compared with those in the CKD group (P < 0.01) in a dose-dependent manner [Figure 1a-e]. Von Kossa staining and Alizarin Red staining were performed to further characterize the effect of EPO on VC in CKD rats and determine the calcium deposition in the abdominal aorta. As shown in Figure 1f-h, calcium deposition was observed in the abdominal aorta of CKD rats, and it significantly increased when treated with a high dose of EPO (2000 U/kg/W, P < 0.01). These results suggest that EPO induces VC in a dose-dependent manner in CKD rats.

Figure 1:

Figure 1:

Effects of different doses of EPO on aortic calcification in CKD rats. (a) Level of hemoglobin in the serum of rats in the control, CKD, and CKD + EPO (1000, 1500, and 2000 U/kg/W) groups (n = 6). (b) Level of creatinine in the serum of rats in each group (n = 6). (c) Level of ALP in the serum of rats. (d) Phosphorus levels in the serum of rats in each group (n = 6). (e) Calcium levels in the serum of rats in each group (n = 6). (f) Von Kossa and Alizarin Red staining in aortic tissues (scale = 50 μm, n = 3). (g and h) Statistical analysis of the average positive area of von Kossa staining and Alizarin Red staining. Data are expressed as mean ± standard deviation. P < 0.05, P < 0.01, and ns indicates no statistical significance. EPO: Erythropoietin, CKD: Chronic kidney disease, ALP: Alkaline phosphatase.

EPO-induced changes in abdominal aortic membrane properties in CKD model rats

The expression levels of contractile markers of VSMC, such as smooth muscle protein 22-a (SM22a) and a-Smooth muscle actin (a-SMA), were assessed to examine the effect of EPO on the phenotypic transformation of VSMC in the abdominal aortic membrane of CKD model rats. As shown in Figure 2a-d, the levels of SM22a and a-SMA were significantly lower in the CKD group than in the control group (P < 0.01). EPO downregulated the expression levels of SM22a and a-SMA in the abdominal aortic membrane of CKD rats in a dose-dependent manner. RT-qPCR analysis showed that the mRNA levels of SM22a (P < 0.05) and a-SMA (P < 0.01) in the CKD group were significantly reduced compared with those in the control group [Figure 2e and f]. Meanwhile, the mRNA levels of BMP2 significantly increased (P < 0.05), and this trend was further amplified after EPO intervention [Figure 2g]. These data suggest that EPO exacerbated calcification in the abdominal aorta of CKD model rats by further upregulating BMP2 and downregulating SM22a and a-SMA. A previous study showed that increased GATA6 expression in EPO-treated VMSC bound to BMP2 and enhanced its transcription, leading to the calcification of VMSC.[32] Therefore, the possible molecular mechanisms of EPO-induced calcification were explored. WB analysis revealed that the levels of BMP2 (P < 0.01), GATA6 (P < 0.01), and BMP2 downstream signaling proteins p-Smad1/5/9 (P < 0.01) in the abdominal aortic membranes of the CKD rats significantly increased compared with those of the control group. EPO treatment further increased the expression levels of GATA6, BMP2, and p-Smad1/5/9 in a dose-dependent manner [Figure 2h-k]. These findings suggest that EPO may exacerbate calcification in CKD through the GATA6/BMP2/Smad1/5/9 pathway.

Figure 2:

Figure 2:

Dose-dependent response of aortic calcification to EPO in CKD rats. (a and b) Immunofluorescence detection of the effect of EPO on the expression levels of SM22a and a-SMA in the abdominal aortic membrane tissue of CKD rats. (c and d) Statistical analysis of the average fluorescence intensity of SM22a and a-SMA. (e-g) RT-qPCR characterization of the effect of EPO on the mRNA levels of SM22a, a-SMA, and BMP2 in the abdominal aortic membrane tissues of CKD rats. (h) WB detection of the effect of EPO on the protein expression levels of GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9 in the abdominal aortic tunica media tissue of CKD rats. (i-k) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. Scale bar = 50 μm, n = 3. Data are shown as mean ± standard deviation. P < 0.05 and P < 0.01. EPO: Erythropoietin, CKD: Chronic kidney disease, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole, RT-qPCR: Real-time quantitative PCR, BMP2: Bone morphogenetic protein 2, GATA6: GATA-binding protein 6, WB: Western blot, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

EPO exacerbation of VC disease in CKD rats by promoting GATA6 expression

An AAV-GATA6 shRNA-interfered CKD model was constructed for determining the effects of GATA6 in EPO-mediated VC in CKD rats to further determine the role of the GATA6/BMP2/Smad1/5/9 signaling pathway in EPO-promoted VC calcification. Quantitative WB assay revealed that compared with the AAV-vector group, the AAV-GATA6 shRNA group showed a significant reduction in GATA6 protein expression in the aortic tissues of EPO-treated CKD rats (P < 0.01), indicating successful AAV-GATA6 shRNA AAV transduction [Figure 3a and b]. Notably, the BMP2, p-Smad1/5/9, and Smad1/5/9 protein levels in the AAV-GATA6 shRNA group were significantly downregulated compared with those in the AAV-vector group (P < 0.01, [Figure 3c and d]). RT-qPCR analysis revealed that the trend of BMP2 mRNA expression was consistent with that of the protein levels (P < 0.01, [Figure 3e]). Von Kossa staining (P < 0.05) and Alizarin Red staining (P < 0.01, [Figure 3f-i]) showed that the deletion of GATA6 significantly blocked the pro-calcification effect of EPO. Meanwhile, immunofluorescence detection and RT-qPCR analysis revealed that SM22a and a-SMA, which were affected by GATA6 deficiency, increased in the abdominal aortic tissues of CKD rats (P < 0.01, [Figure 3j-o]). This finding indicated that EPO can aggravate VC in CKD rats by activating the GATA6/BMP2/Smad1/5/9 signaling pathway.

Figure 3:

Figure 3:

GATA6 deficiency impeding EPO-mediated deterioration of VC in CKD rats. (a) WB detection of the protein expression levels of GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9 in the control, CKD + EPO, AAV-vector, and AAV-GATA6 shRNA groups. (b-d) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. (e) RT-qPCR analysis of the expression of BMP2 mRNA in the abdominal aortic tissues of CKD rats with EPO-mediated intervention by AAV-GATA6 shRNA. (f and g) Von Kossa and Alizarin Red staining of the abdominal aorta in the control, CKD + EPO, AAV-vector, and AAV-GATA6 shRNA groups. (h and i) Statistical analysis of the average positive area of von Kossa staining and Alizarin Red staining. (j) Immunofluorescence staining of SM22a. (k) Statistical analysis of the average fluorescence intensity of SM22a. (l) RT-qPCR measurements of SM22a mRNA in rat aortic tissues. (m) Immunofluorescence staining of a-SMA. (n) Statistical analysis of the average fluorescence intensity of a-SMA. (o) RT-qPCR measurements of a-SMA mRNA in rat aortic tissues. Scale = 50 μm, n = 3. Data are expressed as mean ± standard deviation. P < 0.05, P < 0.01, and ns indicates no statistical significance. GATA6: GATA-binding protein 6, EPO: Erythropoietin, VC: Vascular calcification, CKD: Chronic kidney disease, WB: Western blot, AAV: Adeno-associated virus, BMP2: Bone morphogenetic protein 2, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, RT-qPCR: Real-time quantitative polymerase chain reaction, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole.

Rb1 amelioration of EPO-exacerbated VC deterioration in a dose-dependent manner

The levels of hemoglobin, serum creatinine, ALP, phosphorus, and calcium after Rb1 treatment were examined to assess the effect of Rb1 on calcification in EPO + CKD rats. The results showed that Rb1 had no significant effect on the hemoglobin level of EPO + CKD rats (P > 0.05). Meanwhile, Rb1 significantly reduced the serum creatinine, ALP, phosphorus, and calcium levels compared with CKD + EPO (P < 0.01), and the reduction effect was enhanced with the increase in dosage [Figure 4a-e]. Von Kossa staining and Alizarin Red staining showed that Rb1 attenuated the calcification of abdominal aortic tissues in a dose-dependent manner in CKD + EPO rats (P < 0.01, [Figure 4f-i]. These data suggest that Rb1 ameliorated VC in the abdominal aortic tissues of CKD + EPO rats.

Figure 4:

Figure 4:

Rb1 attenuation of EPO-induced VC in CKD rats. (a) Level of hemoglobin in the serum of control, CKD + EPO, and CKD + EPO + Rb1 (20, 40, and 60 mg/kg/d) groups (n = 6). (b) Level of creatinine in the serum of rats in each group (n = 6). (c) Level of ALP in the serum of rats in each group (n = 6). (d) Phosphorus levels in the serum of rats in each group (n = 6). (e) Calcium levels in the serum of rats in each group (n = 6). (f) Von Kossa staining in different experimental groups (scale = 50 μm, n = 3). (g) Statistical analysis of the average positive area of von Kossa staining. (h) Alizarin Red staining in different experimental groups (scale = 50 μm, n = 3). (i) Statistical analysis of the average positive area of Alizarin red staining. Data are expressed as mean ± standard deviation. P < 0.05, P < 0.01, and ns indicates no statistical significance. Rb1: Ginsenoside Rb1, VC: Vascular calcification, EPO: Erythropoietin, CKD: Chronic kidney disease, ALP: Alkaline phosphatase.

Rb1 inhibition of EPO-mediated calcification and hindrance of Smad1/5/9 phosphorylation in the abdominal aorta of CKD rat model

Next, whether Rb1 could regulate that VSMC phenotypic transformation in vivo was determined. The immunization results showed that the levels of SM22a and a-SMA in the abdominal aortic tissues of the CKD + EPO + Rb1 group significantly increased compared with those of the CKD + EPO group (P < 0.01, [Figure 5a-d]). As shown in Figure 5e and f, Rb1 significantly upregulated the mRNA levels of SM22a and a-SMA in a dose-dependent manner (P < 0.01). However, Rb1 administration did not significantly affect the transcript levels of BMP2 in the abdominal aortic tissues of CKD + EPO rats (P > 0.05, [Figure 5g]). Notably, the expression levels of GATA6 and BMP2 proteins in the abdominal aortic tissues of the CKD + EPO rats were not affected by Rb1 (P > 0.05). However, Rb1 reduced the relative expression levels of p-Smad1/5/9 and Smad1/5/9 proteins in a dose-dependent manner (P < 0.01, [Figure 5h and i]). These results suggest that the inhibition of the Smad1/5/9 pathway by Rb1 may not act by blocking GATA6 and BMP2 expression.

Figure 5:

Figure 5:

Rb1 blockage of Smad1/5/9 pathway, leading to attenuation of EPO-induced calcification. (a) Immunofluorescence staining of SM22a. (b) Statistical analysis of the average fluorescence intensity of SM22a. (c) Immunofluorescence staining of a-SMA. (d) Statistical analysis of the average fluorescence intensity of a-SMA. (e-g) RT-qPCR detection of the mRNA levels of SM22a, a-SMA, and BMP2 in rat aortic tissues. (h) WB detection of the protein expression levels of GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9 in rat aortic tunica tissues. (i) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. Scale = 50 μm, n = 3. Data are expressed as mean ± standard deviation. P < 0.05, P < 0.01, and ns denotes no statistical significance. Rb1: Ginsenoside Rb1, EPO: Erythropoietin, CKD: Chronic kidney disease, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole, BMP2: Bone morphogenetic protein 2, RTqPCR: Real-time quantitative polymerase chain reaction, WB: Western blot GATA6: GATA-binding protein 6, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Rb1 inhibition of EPO-induced VSMC calcification in vitro

VSMCs were treated with 10 mM of b-glycerophosphate and 250 U/mL of EPO, followed by Rb1 (20, 40, or 80 μM), to assess whether Rb1 can mitigate the exacerbation of VC induced by EPO in vitro. As expected, the EPO-induced calcium deposition in VSMC in the Rb1-treated group was significantly attenuated compared with that in the EPO group (P < 0.01, [Figure 6a and b]) in an Rb1 dose-dependent manner. The results suggest that Rb1 alleviated VSMC calcification. Immunofluorescence labeling and RT-qPCR analysis showed that Rb1 significantly increased the expression levels of SM22a and a-SMA in VSMC in a dose-dependent manner, which is consistent with the results observed in vivo (P < 0.01, [Figure 6c-i]). The ALP activity of VSMC after Rb1 treatment was further examined. The ALP activity significantly decreased after Rb1 intervention (P < 0.01, [Figure 6j]). EPO treatment increased the expression levels of GATA6 and BMP2 in VSMC compared with control treatment (P < 0.01), but the inclusion of Rb1 did not significantly affect the expression levels of these proteins (P > 0.05, [Figure 6k-m]). However, the relative expression levels of p-Smad1/5/9 and Smad1/5/9 proteins significantly decreased with increasing Rb1 concentration compared with those in the EPO group (P < 0.01, [Figure 6n]). The results showed that Rb1 activated the Smad1/5/9 pathway and inhibited VSMC calcification.

Figure 6:

Figure 6:

Rb1 reduction in EPO-enhanced VSMC VC in vitro. (a) Alizarin Red staining of calcium deposits in VSMC (scale = 100 μm). (b) Statistical analysis of the average positive area of Alizarin Red staining. (c) Immunofluorescence staining of SM22a in VSMC (scale = 50 μm). d. Statistical analysis of the average fluorescence intensity of SM22a. (e) Immunofluorescence staining of a-SMA in VSMC (scale = 50 μm). (f) Statistical analysis of the average fluorescence intensity of a-SMA. (g-i) RT-qPCR detection of SM22a, a-SMA, and BMP2 mRNA expression levels in VSMC. (j) Detection of ALP activity in VSMC. (k) WB detection of the protein expression levels of GATA6, BMP2, Smad1/5/9 and p-Smad1/5/9 in VSMC. (l-n) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. n = 3. Data are expressed as mean ± standard deviation. P < 0.05, P < 0.01, and ns denotes no statistical significance. Rb1: Ginsenoside Rb1, EPO: Erythropoietin, VC: Vascular calcification, VSMC: Vascular smooth muscle cell, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole, BMP2: Bone morphogenetic protein 2, RT-qPCR: Real-time quantitative PCR, ALP: Alkaline phosphatase, WB: Western blot, GATA6: GATA-binding protein 6, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Rb1 inhibition of Smad1/5/9 signaling axis through targeted binding to BMP2

A previous study reported that BMP2 can activate the Smad signaling pathway by binding to its serine kinase receptors (Bone morphogenetic protein receptor [BMPR]-IA, BMPR-IB, and BMPR-II), which induced osteogenic phenotypic shifts in VSMC and promoted calcification.[33] Based on the above experimental results, Rb1 may affect the Smad pathway and VSMC calcification by regulating the binding of BMP2 and BMPR. The present study showed that Rb1 had robust hydrogen-bonding connections with BMP2 protein residues using network pharmacology and molecular docking techniques [Figure 7a]. Biotin traction assay showed that Rb1 could efficiently bind to BMP2 to form a stable protein complex [Figure 7b]. MST assay further confirmed the specific binding of Rb1 to BMP2. The results showed that Rb1 had a high binding affinity for BMP2 (Kd value = 413 μM, [Figure 7c]). Subsequently, the effect of Rb1 on the binding of BMP2 to BMPR in VSMC was investigated. Co-IP experiments showed that the binding of BMP2 to BMPR was significantly reduced in the Rb1-treated group [Figure 7d-f]. WB results showed that the expression levels of p-Smad1/5/9 and Smad1/5/9 in the EPO group significantly increased compared with those in the control group (P < 0.01). Rb1 treatment significantly reversed this result (P < 0.01, [Figure 7g and h]). These findings suggest that Rb1 may target binding to BMP2, preventing the binding of BMP2 to BMPR and thus hindering the activation of the downstream Smad signaling pathway.

Figure 7:

Figure 7:

Rb1 blockage of the binding of BMP2 to BMPR after targeting BMP2 for binding. (a) Molecular docking of Rb1 with BMP2 protein. (b) Biotin traction assay of the binding of Rb1 to BMP2. (c) MST assay of the binding of Rb1 to BMP2. (d) Co-IP quantification of BMP2 binding to BMPR in VSMC. (e and f) Gray value statistics of BMP2 and BMPR (IP/Input). (g) WB detection of the protein expression levels of Smad1/5/9 and p-Smad1/5/9 in VSMC. (h) Gray value statistics of Smad1/5/9 and p-Smad1/5/9. n = 3. Data are expressed as mean ± standard deviation. P < 0.05, P < 0.01, P < 0.001, and ns denotes no statistical significance. Rb1: Ginsenoside Rb1, EPO: Erythropoietin, BMP2: Bone morphogenetic protein 2, MST: Microscale Thermophoresis, Co-IP: Co-immunoprecipitation, BMPR: Bone morphogenetic protein receptor, VSMC: Vascular smooth muscle cell, WB: Western blot, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

DISCUSSION

The primary cause of death for people with end-stage renal disease and CKD is cardiovascular disease.[34,35] Here, the underlying processes involving the GATA6/BMP2/Smad signaling cascade were explored, and the results showed that EPO exacerbated VC associated with CKD in rats. In contrast to high-dose EPO treatment, which worsens calcium deposition and lowers the levels of smooth muscle contractile proteins, such as SM22a and a-SMA, the results indicated that a 0.75% adenine diet was successful in causing CKD. TCM has accumulated extensive clinical experience in the treatment of CKD.[36-38] Accumulating evidence suggests that naturally derived compounds attenuate renal injury through many potential molecular mechanisms.[39,40] The present study focused on the central role of the BMP2/GATA6/Smad signaling pathway in the process of VC. Through in-depth exploration of the regulatory effect of Rb1 on this pathway, its potential value in the modulation of the pathological mechanisms underlying VC was further elucidated, providing a theoretical basis for the development of molecular intervention strategies targeting this pathway.

VC’s high morbidity and mortality rate make it a serious hazard to human health.[41] Sufficient data show that VC does not only involve calcium deposition but also a diverse spectrum of pathobiological processes, with VSMC’s differentiation into osteoblast-like cells being a major factor. According to studies, VC can occur in patients with CKD even in their early stages, and once patients with CKD start dialysis, the prevalence quickly increases to above 50%.[42] Nowadays, many people take EPO to treat renal anemia. However, high-dose EPO is remarkably linked to cardiovascular problems and all-cause mortality in patients, and this association is unaffected by the hemoglobin levels of the patients.[43] Compared to control rats, we showed that EPO worsened VC, reduced the levels of smooth muscle contractile proteins (such as SM22a and a-SMA), and increased calcium deposition in CKD rats. This finding could help explain why high EPO dosages have negative clinical effects. The results are in line with those of He et al.,[15] who discovered that EPO increased vascular endothelial cell osteogenic markers, caused calcium deposition, and exacerbated VC in CKD rats.

Rb1 has been shown in numerous studies to have a preventive effect against renal and vascular disorders.[44-47] Rb1 slows the development of CKD early on by lowering creatine and inflammatory cytokine levels in patients with CKD.[48] Zhou et al. found that Rb1 improved calcium deposition and VSMC phenotype switching in CKD rats and rat VSMC and exerted anti-calcification effects.[29] In the arteries of rats with EPO-exacerbated CKD, Rb1 reduced calcium deposition, ALP activity, and calcium concentration while increasing the expression levels of SM22a and a-SMA proteins in a dose-dependent manner. Furthermore, Rb1’s protective function in calcium deposition was validated by primary rat VSMC findings. All of these findings strengthen the understanding of the protective properties of Rb1 in vascular disease.

GATA6 is a zinc-finger transcription factor that has been linked to several developmental processes.[49,50] It is widely distributed in the cardiovascular system and crucial for early embryonic development.[51] Prior research employing transcriptome sequencing revealed that GATA6 and BMP2 were markedly increased in EPO-treated vascular endothelial cells, despite the paucity of studies investigating the function of GATA6 in these cells. BMP2 and GATA6 expression levels increased in vitro when VSMC calcium salt deposition was stimulated.[52] According to additional research, GATA6 binds to the BMP2 promoter area and increases BMP2 transcription, which, in turn, encourages VSMC calcification.[32] GATA6 may be involved in other signaling pathways (such as Wnt/b-catenin),[53] and cross-regulation exists between the Wnt/b-catenin and BMP signaling pathways, which may indirectly affect the expression of BMP2.[54] Zhao et al. observed that the expression of GATA6 was significantly reduced in VSMCs under high glucose conditions, and overexpression of GATA6 significantly inhibited osteoblastic differentiation of VSMC.[50] BMP2 expression and EPO-enhanced VC were markedly decreased by GATA6 interference.[52] Anemia was reduced in animals with adenine-induced CKD when Smad1/5/9 signaling was inhibited.[55] The aortas of EPO-exacerbated CKD rats had considerably higher levels of GATA6, BMP2, and p-Smad1/5/9 than the blank group, whereas Rb1 therapy had no discernible effect on GATA6 and BMP2 expression. Comparable outcomes were found in calcified VSMC, implying that Rb1 may not have a therapeutic effect on EPO-exacerbated CKD VC by altering GATA6 or BMP2 expression.

Numerous illnesses are significantly affected by the Smad signaling pathway.[56,57] Members of the Smad family of proteins, Smad1/5/9, are essential for various cellular functions such as programmed cell death, cell growth, maturation, and motility.[58,59] They are acknowledged as important modulators of calcification and bone formation, particularly when the VSMC phenotype changes to resemble osteoblasts.[60,61] The present study showed that Rb1 lowered Smad1/5/9’s phosphorylation level. The activation of the Smad signaling pathway is the result of a series of intracellular events that are known to occur when BMP2 binds to its receptors (BMPR-IA, BMPR-IB, and BMPR-II). This activation drives a phenotypic shift in vascular endothelial cells to an osteoblast-like phenotype, which promotes the calcification process.[62] The present study further revealed that Rb1 binds to BMP2 with a fairly high affinity, and the binding of BMP2 and BMPR was significantly reduced by the addition of Rb1. The finding suggests that Rb1 may hinder the interaction between BMP2 and BMPR by binding to BMP2, thereby reducing the activation of the downstream Smad1/5/9 signaling pathway and ultimately ameliorating CKD calcification aggravated by high-dose EPO.

Although this study provides valuable insights, it has some limitations. First, although adenine induction is a generally accepted model of CKD, adenine-induced CKD rats lost weight more rapidly and with less VC range than clinical patients with CKD due to the relatively long and limited modeling time of the tube-feeding method, hence requiring further exploration in future studies. Second, various experiments involving interference with GATA6 and the use of Rb1 were performed, but how GATA6 regulates BMP2 expression was not investigated in depth. Future studies should explore the specific structural domains targeted for binding by Rb1 and BMP2. However, these limitations do not diminish the strength of the conclusions drawn in this study, because the findings clearly demonstrated the association between EPO and VC, especially in the context of CKD. Moreover, this study systematically explored the corresponding molecular mechanisms underlying the role of Rb1 in CKD calcification exacerbated by EPO. This new finding fills a gap in current research.

SUMMARY

This study revealed the crucial roles of GATA6 and BMP2 in CKD calcification induced by high-dose EPO and delved into the molecular intervention strategy of Rb1 in modulating the pathological mechanism of EPO-induced calcification in CKD rats. The results showed that Rb1 effectively inhibits the Smad1/5/9 signaling pathway by interacting with BMP2, thereby ameliorating EPO-induced VC associated with CKD. This finding not only deepens the understanding of the central role of the BMP2/GATA6/Smad pathway in the pathological mechanism of calcification but also provides new insights for subsequent research on the molecular diagnosis and pathological mechanism modulation of EPO-induced CKD.

AVAILABILITY OF DATA AND MATERIALS

Data and materials supporting the findings of this study are available from the corresponding author on request.

ABBREVIATIONS

AAV: Adeno-associated virus

ALP: Alkaline phosphatase

ANOVA: One-way analysis of variance

BMP2: Bone morphogenetic protein 2

BMPR: Bone morphogenetic protein receptor

CKD: Chronic kidney disease

Co-IP: Co-immunoprecipitation

DAPI: 4’,6-Diamidino-2-phenylindole.

EDTA: Ethylenediaminetetraacetic acid

EPO: Erythropoietin

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

GATA6: GATA-binding protein 6

MST: Microscale thermophoresis

Rb1: Ginsenoside Rb1

RT-qPCR: Real-time quantitative PCR

SM22α: Smooth muscle protein 22-α

TCM: Traditional Chinese medicine

VC: Vascular calcification

VSMCs: Vascular smooth muscle cells

WB: Western blot

α-SMA: α-Smooth muscle actin

AUTHOR CONTRIBUTIONS

XJL, WJX, and DYZ: Conceptualization; XJL, JZ, and DYZ: Data curation; ZXX and JZ: Methodology; YLi, YLuo, and JZ: Validation; XJL, ZXX, and JZ: Visualization; and XJL and DYZ: Funding acquisition. All authors participated in the drafting and critical revision of the manuscript. All authors read and approved of the final manuscript. All authors meet ICMJE author qualifications.

ACKNOWLEDGMENTS

Not applicable.

Funding Statement

FUNDING: This work was supported by Chongqing Natural Science Foundation (General Project) (NO. CSTB2024NSCQMSX0320) and China Postdoctoral Science Foundation (NO. 2024MD754010).

Footnotes

How to cite this article: Li X, Xu Z, Li Y, Luo Y, Zhou J, Zuo D, et al. Ginsenoside Rb1 attenuates erythropoietin-exacerbated vascular calcification in chronic kidney disease through BMP2-dependent Smad1/5/9 inhibition. CytoJournal. 2025;22:84. doi: 10.25259/Cytojournal_70_2025

HTML of this article is available FREE at: https://dx.doi.org/10.25259/Cytojournal_70_2025

ETHICAL APPROVAL AND CONSENT TO PARTICIPATE

The animal study was conducted following the ARRIVE guidelines. All animal experimental procedures were complied with the ethical standards of and approved by the Ethical Committee on Welfare of Laboratory Animals, Chongqing Traditional Chinese Medicine Hospital (2024-DWSY-LXJ, Ethical approval date: August 15, 2024).

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

EDITORIAL/PEER REVIEW

To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.

References

  • 1.Kalantar-Zadeh K, Jafar TH, Nitsch D, Nitsch D, Neuen BL, Perkovic V. Chronic kidney disease. Lancet. 2021;398:786–802. doi: 10.1016/S0140-6736(21)00519-5. [DOI] [PubMed] [Google Scholar]
  • 2.Zhao H, Liu H, Liu Y, Jin J, He Q, Lin B. The role of extracellular vesicles in vascular calcification in chronic kidney disease. Front Med (Lausanne) 2022;9:997554. doi: 10.3389/fmed.2022.997554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Leopold JA. Vascular calcification: Mechanisms of vascular smooth muscle cell calcification. Trends Cardiovasc Med. 2015;25:267–74. doi: 10.1016/j.tcm.2014.10.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ho CY, Shanahan CM. Medial arterial calcification: An overlooked player in peripheral arterial disease. Arterioscler Thromb Vasc Biol. 2016;36:1475–82. doi: 10.1161/ATVBAHA.116.306717. [DOI] [PubMed] [Google Scholar]
  • 5.Zhang YX, Tang RN, Wang LT, Liu BC. Role of crosstalk between endothelial cells and smooth muscle cells in vascular calcification in chronic kidney disease. Cell Prolif. 2021;54:e12980. doi: 10.1111/cpr.12980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yu F, Duan Y, Liu C, Huang H, Xiao X, He Z. Extracellular vesicles in atherosclerosis and vascular calcification: The versatile non-coding RNAs from endothelial cells and vascular smooth muscle cells. Front Med (Lausanne) 2023;10:1193660. doi: 10.3389/fmed.2023.1193660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Patel JJ, Bourne LE, Davies BK, Arnett TR, MacRae VE, Wheeler-Jones CP, et al. Differing calcification processes in cultured vascular smooth muscle cells and osteoblasts. Exp Cell Res. 2019;380:100–13. doi: 10.1016/j.yexcr.2019.04.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Shanahan CM, Crouthamel MH, Kapustin A, Giachelli CM. Arterial calcification in chronic kidney disease: Key roles for calcium and phosphate. Circ Res. 2011;109:697–711. doi: 10.1161/CIRCRESAHA.110.234914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yi X, Yan W, Guo T, Liu N, Wang Z, Shang J, et al. Erythropoietin mitigates diabetic nephropathy by restoring PINK1/parkin-mediated mitophagy. Front Pharmacol. 2022;13:883057. doi: 10.3389/fphar.2022.883057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Inrig JK, Barnhart HX, Reddan D, Patel UD, Sapp S, Califf RM, et al. Effect of hemoglobin target on progression of kidney disease: A secondary analysis of the CHOIR (Correction of Hemoglobin and Outcomes in Renal Insufficiency) trial. Am J Kidney Dis. 2012;60:390–401. doi: 10.1053/j.ajkd.2012.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Berns JS. Should all patients with chronic kidney disease receive an EPO-type drug? Cleve Clin J Med. 2006;73:298–300. doi: 10.3949/ccjm.73.3.298. [DOI] [PubMed] [Google Scholar]
  • 12.Patel JJ, Modes JE, Flanagan CL, Krebsbach PH, Edwards SP, Hollister SJ. Dual delivery of EPO and BMP2 from a Novel Modular poly-ɛ-caprolactone construct to increase the bone formation in prefabricated bone flaps. Tissue Eng Part C Methods. 2015;21:889–97. doi: 10.1089/ten.tec.2014.0643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wan L, Zhang F, He Q, Tsang WP, Lu L, Li Q, et al. EPO promotes bone repair through enhanced cartilaginous callus formation and angiogenesis. PLoS One. 2014;9:e102010. doi: 10.1371/journal.pone.0102010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhou R, Miao S, Xu J, Sun L, Chen Y. Circular RNA circ_0000020 promotes osteogenic differentiation to reduce osteoporosis via sponging microRNA miR-142-5p to up-regulate Bone Morphogenetic Protein BMP2. Bioengineered. 2021;12:3824–36. doi: 10.1080/21655979.2021.1949514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.He J, Zhong X, Zhao L, Gan H. JAK2/STAT3/BMP-2 axis and NF-kB pathway are involved in erythropoietin-induced calcification in rat vascular smooth muscle cells. Clin Exp Nephrol. 2019;23:501–12. doi: 10.1007/s10157-018-1666-z. [DOI] [PubMed] [Google Scholar]
  • 16.Guo ZY, Wu X, Zhang SJ, Yang JH, Miao H, Zhao YY. Poria cocos: Traditional uses, triterpenoid components and their renoprotective pharmacology. Acta Pharmacol Sin. 2024;46:836–851. doi: 10.1038/s41401-024-01404-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dong X, Zhang J, Li W, Li Y, Jia L, Liu Z, et al. Yi-Shen-Hua-Shi regulates intestinal microbiota dysbiosis and protects against proteinuria in patients with chronic kidney disease: A randomized controlled study. Pharm Biol. 2024;62:356–66. doi: 10.1080/13880209.2024.2345080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kuang BC, Wang ZH, Hou SH, Zhang J, Wang MQ, Zhang JS, et al. Methyl eugenol protects the kidney from oxidative damage in mice by blocking the Nrf2 nuclear export signal through activation of the AMPK/GSK3beta axis. Acta Pharmacol Sin. 2023;44:367–80. doi: 10.1038/s41401-022-00942-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sun MY, Ye HJ, Zheng C, Jin ZJ, Yuan Y, Weng HB. Astragalin ameliorates renal injury in diabetic mice by modulating mitochondrial quality control via AMPK-dependent PGC1a pathway. Acta Pharmacol Sin. 2023;44:1676–86. doi: 10.1038/s41401-023-01064-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang F, Liu C, Ren L, Li Y, Yang H, Yu Y, et al. Sanziguben polysaccharides improve diabetic nephropathy in mice by regulating gut microbiota to inhibit the TLR4/NF-kB/NLRP3 signalling pathway. Pharm Biol. 2023;61:427–36. doi: 10.1080/13880209.2023.2174145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zou TF, Liu ZG, Cao PC, Zheng SH, Guo WT, Wang TX, et al. Fisetin treatment alleviates kidney injury in mice with diabetes-exacerbated atherosclerosis through inhibiting CD36/fibrosis pathway. Acta Pharmacol Sin. 2023;44:2065–74. doi: 10.1038/s41401-023-01106-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shi G, Liu D, Zhou B, Liu Y, Hao B, Yu S, et al. Ginsenoside Rb1 alleviates oxidative low-density lipoprotein-induced vascular endothelium senescence via the SIRT1/Beclin-1/autophagy axis. J Cardiovasc Pharmacol. 2020;75:155–67. doi: 10.1097/FJC.0000000000000775. [DOI] [PubMed] [Google Scholar]
  • 23.Fan C, Ma Q, Xu M, Qiao Y, Zhang Y, Li P. Ginsenoside Rb1 attenuates high glucose-induced oxidative injury via the NAD-PARP-SIRT axis in rat retinal capillary endothelial cells. Int J Mol Sci. 2019;20:4936. doi: 10.3390/ijms20194936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nanao-Hamai M, Son BK, Komuro A, Asari Y, Hashizume T, Takayama KI, et al. Ginsenoside Rb1 inhibits vascular calcification as a selective androgen receptor modulator. Eur J Pharmacol. 2019;859:172546. doi: 10.1016/j.ejphar.2019.172546. [DOI] [PubMed] [Google Scholar]
  • 25.Mishima E, Fukuda S, Shima H, Hirayama A, Akiyama Y, Takeuchi Y, et al. Alteration of the intestinal environment by lubiprostone is associated with amelioration of adenine-induced CKD. J Am Soc Nephrol. 2015;26:1787–94. doi: 10.1681/ASN.2014060530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zuo D, Luo M, Liu C, Yang A, Shen Y, Xu J, et al. HAO2 protects from proximal tubular cells injured in rats with chronic kidney disease by promoting fatty acid metabolic processes. Biochim Biophys Acta Mol Basis Dis. 2024;1870:167342. doi: 10.1016/j.bbadis.2024.167342. [DOI] [PubMed] [Google Scholar]
  • 27.Li J, Lu K, Zhang X, Wang T, Li Q, Yu X, et al. SIRT3-mediated mitochondrial autophagy in refeeding syndrome-related myocardial injury in sepsis rats. Ann Transl Med. 2022;10:211. doi: 10.21037/atm-22-222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang M, Wang R, Sun H, Sun G, Sun X. Ginsenoside Rb1 ameliorates cardiotoxicity triggered by aconitine via inhibiting calcium overload and pyroptosis. Phytomedicine. 2021;83:153468. doi: 10.1016/j.phymed.2021.153468. [DOI] [PubMed] [Google Scholar]
  • 29.Zhou P, Zhang X, Guo M, Guo R, Wang L, Zhang Z, et al. Ginsenoside Rb1 ameliorates CKD-associated vascular calcification by inhibiting the Wnt/b-catenin pathway. J Cell Mol Med. 2019;23:7088–98. doi: 10.1111/jcmm.14611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Li J, Li R, Li N, Zheng F, Dai Y, Ge Y, et al. Mechanism of antidiabetic and synergistic effects of ginseng polysaccharide and ginsenoside Rb1 on diabetic rat model. J Pharm Biomed Anal. 2018;158:451–60. doi: 10.1016/j.biopha.2018.05.056. [DOI] [PubMed] [Google Scholar]
  • 31.Wu Y, Liu Y, Xu Y, Zheng A, Du J, Cao L, et al. Bioactive natural compounds as potential medications for osteogenic effects in a molecular docking approach. Front Pharmacol. 2022;13:955983. doi: 10.3389/fphar.2022.955983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Li X, Jiang X, He F, Xia Y, Chen X, Du X, et al. Effect of erythropoietin on calcification of vascular smooth muscle cells and its molecular regulatory mechanism. J Cardiovasc Transl Res. 2021;14:525–37. doi: 10.1007/s12265-020-10081-w. [DOI] [PubMed] [Google Scholar]
  • 33.Dong GC, Ma TY, Li CH, Chi CY, Su CM, Huang CL, et al. A study of Drynaria fortunei in modulation of BMP-2 signalling by bone tissue engineering. Turk J Med Sci. 2020;50:1444–53. doi: 10.3906/sag-2001-148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chen Q, Wei G, Wang Y, Li X, Zhao Q, Zhu L, et al. Efficacy and safety of nonsteroidal mineralocorticoid receptor antagonists for renal and cardiovascular outcomes in patients with chronic kidney disease: A meta-analysis of randomized clinical trials. Front Pharmacol. 2024;15:1338044. doi: 10.3389/fphar.2024.1338044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Del Vecchio L, Balafa O, Dounousi E, Ekart R, Fernandez BF, Mark PB, et al. COVID-19 and cardiovascular disease in patients with chronic kidney disease. Nephrol Dial Transplant. 2024;39:177–89. doi: 10.1093/ndt/gfad170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wang YN, Zhang ZH, Liu HJ, Guo ZY, Zou L, Zhang YM, et al. Integrative phosphatidylcholine metabolism through phospholipase A2 in rats with chronic kidney disease. Acta Pharmacol Sin. 2023;44:393–405. doi: 10.1038/s41401-022-00947-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wang B, Yang LN, Yang LT, Liang Y, Guo F, Fu P, et al. Fisetin ameliorates fibrotic kidney disease in mice via inhibiting ACSL4-mediated tubular ferroptosis. Acta Pharmacol Sin. 2024;45:150–65. doi: 10.1038/s41401-023-01156-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Shen S, Zhong H, Zhou X, Li G, Zhang C, Zhu Y, et al. Advances in traditional chinese medicine research in diabetic kidney disease treatment. Pharm Biol. 2024;62:222–32. doi: 10.1080/13880209.2024.2314705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Shao YF, Tang BB, Ding YH, Fang CY, Hong L, Shao CX, et al. Kaempferide ameliorates cisplatin-induced nephrotoxicity via inhibiting oxidative stress and inducing autophagy. Acta Pharmacol Sin. 2023;44:1442–54. doi: 10.1038/s41401-023-01051-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Miao H, Liu F, Wang YN, Zhuang S, Guo Y, Vaziri ND. Targeting Lactobacillus johnsonii to reverse chronic kidney disease. Sig Transduct Target Ther. 2024;9:195. doi: 10.1038/s41392-024-01913-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bover J, Evenepoel P, Ureña-Torres P, Vervloet MG, Brandenburg V, Mazzaferro S, et al. Pro: Cardiovascular calcifications are clinically relevant. Nephrol Dial Transplant. 2015;30:345–51. doi: 10.1093/ndt/gfv020. [DOI] [PubMed] [Google Scholar]
  • 42.Sigrist MK, Taal MW, Bungay P, McIntyre CW. Progressive vascular calcification over 2 years is associated with arterial stiffening and increased mortality in patients with stages 4 and 5 chronic kidney disease. Clin J Am Soc Nephrol. 2007;2:1241–8. doi: 10.2215/CJN.02190507. [DOI] [PubMed] [Google Scholar]
  • 43.Koulouridis I, Alfayez M, Trikalinos TA, Balk EM, Jaber BL. Dose of erythropoiesis-stimulating agents and adverse outcomes in CKD: A metaregression analysis. Am J Kidney Dis. 2013;61:44–56. doi: 10.1053/j.ajkd.2012.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sun Q, Meng Q T, Jiang Y, Liu HM, Lei SQ, Su WT, et al. Protective effect of ginsenoside Rb1 against intestinal ischemia-reperfusion induced acute renal injury in mice. PLoS One. 2013;8:e80859. doi: 10.1371/journal.pone.0080859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.El-Sheikh AK, Kamel MY. Ginsenoside-Rb1 ameliorates lithium-induced nephrotoxicity and neurotoxicity: Differential regulation of COX-2/PGE(2) pathway. Biomed Pharmacother. 2016;84:1873–84. doi: 10.1016/j.biopha.2016.10.106. [DOI] [PubMed] [Google Scholar]
  • 46.Wang RX, He RL, Jiao HX, Dai M, Mu YP, Hu Y, et al. Ginsenoside Rb1 attenuates agonist-induced contractile response via inhibition of store-operated calcium entry in pulmonary arteries of normal and pulmonary hypertensive rats. Cell Physiol Biochem. 2015;35:1467–81. doi: 10.1159/000373966. [DOI] [PubMed] [Google Scholar]
  • 47.Fan J, Liu D, He C, Li X, He F. Inhibiting adhesion events by Panax notoginseng saponins and Ginsenoside Rb1 protecting arteries via activation of Nrf2 and suppression of p38-VCAM-1 signal pathway. J Ethnopharmacol. 2016;192:423–30. doi: 10.1016/j.jep.2016.09.022. [DOI] [PubMed] [Google Scholar]
  • 48.Xu X, Lu Q, Wu J, Li Y, Sun J. Impact of extended ginsenoside Rb1 on early chronic kidney disease: A randomized, placebo-controlled study. Inflammopharmacology. 2017;25:33–40. doi: 10.1007/s10787-016-0296-x. [DOI] [PubMed] [Google Scholar]
  • 49.Yue X, Luo Y, Wang J, Huang D. Monogenic diabetes with GATA6 mutations: Characterization of a novel family and a comprehensive analysis of the GATA6 clinical and genetics traits. Mol Biotechnol. 2024;66:467–74. doi: 10.1007/s12033-023-00761-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhao Z, Li A, Zeng R, Zeng Z, Ou L, Cao J, et al. A CEBPB/miR-32-5p/GATA6 axis promotes vascular calcification in type 2 diabetes. Int J Biochem Cell Biol. 2024;173:106613. doi: 10.1016/j.biocel.2024.106613. [DOI] [PubMed] [Google Scholar]
  • 51.Sam J, Torregroza I, Evans T. Gata6 functions in zebrafish endoderm to regulate late differentiating arterial pole cardiogenesis. Development. 2024;151:dev202895. doi: 10.1242/dev.202895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Li X, Liu C, Li Y, Xiong W, Zuo D. Inflammation promotes erythropoietin induced vascular calcification by activating p38 pathway. Bioengineered. 2022;13:5277–91. doi: 10.1080/21655979.2022.2038430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Li A, Gu L, Mu J, Li Y, Wang X, Jiang J, et al. GATA6 triggers fibroblast activation and tracheal fibrosis through the Wnt/b-catenin pathway. Cell Signal. 2023;105:110593. doi: 10.1016/j.cellsig.2023.110593. [DOI] [PubMed] [Google Scholar]
  • 54.Silvério KG, Davidson KC, James RG, Adams AM, Foster BL, Nociti FH, Jr, et al. Wnt/b-catenin pathway regulates bone morphogenetic protein (BMP2)-mediated differentiation of dental follicle cells. J Periodontal Res. 2012;47:309–19. doi: 10.1111/j.1600-0765.2011.01433.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Wang CY, Melgar-Bermudez E, Welch D, Dagbay KB, Bhattacharya S, Lema E, et al. A recombinant antibody against ALK2 promotes tissue iron redistribution and contributes to anemia resolution in a mouse model of anemia of inflammation. Am J Hematol. 2025;100:797–812. doi: 10.1002/ajh.27578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Teixeira AF, Wang Y, Iaria J, Ten Dijke P, Zhu HJ. Simultaneously targeting extracellular vesicle trafficking and TGF-b receptor kinase activity blocks signaling hyperactivation and metastasis. Signal Transduct Target Ther. 2023;8:456. doi: 10.1038/s41392-023-01711-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Su Q, Wang JJ, Ren JY, Wu Q, Chen K, Tu KH, et al. Parkin deficiency promotes liver cancer metastasis by TMEFF1 transcription activation via TGF-b/Smad2/3 pathway. Acta Pharmacol Sin. 2024;45:1520–9. doi: 10.1038/s41401-024-01254-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Deng Z, Fan T, Xiao C, Tian H, Zheng Y, Li C, et al. TGF-b signaling in health, disease, and therapeutics. Signal Transduct Target Ther. 2024;9:61. doi: 10.1038/s41392-024-01764-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Andre P, Joshi SR, Briscoe SD, Alexander MJ, Li G, Kumar R. Therapeutic approaches for treating pulmonary arterial hypertension by correcting imbalanced TGF-b superfamily signaling. Front Med (Lausanne) 2021;8:814222. doi: 10.3389/fmed.2021.814222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Huang J, Pu Y, Zhang H, Xie L, He L, Zhang CL, et al. KLF2 mediates the suppressive effect of laminar flow on vascular calcification by inhibiting endothelial BMP/SMAD1/5 signaling. Circ Res. 2021;129:e87–100. doi: 10.1161/CIRCRESAHA.120.318690. [DOI] [PubMed] [Google Scholar]
  • 61.Kee HJ, Cho SN, Kim GR, Choi SY, Ryu Y, Kim IK, et al. Gallic acid inhibits vascular calcification through the blockade of BMP2-Smad1/5/8 signaling pathway. Vascul Pharmacol. 2014;63:71–8. doi: 10.1016/j.vph.2014.08.005. [DOI] [PubMed] [Google Scholar]
  • 62.Ni H, Liu C, Chen Y, Lu Y, Ji Y, Xiang M, et al. MGP regulates perivascular adipose-derived stem cells differentiation toward smooth muscle cells via BMP2/SMAD pathway enhancing neointimal formation. Cell Transplant. 2022;31:09636897221075747. doi: 10.1177/09636897221075747. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data and materials supporting the findings of this study are available from the corresponding author on request.


Articles from CytoJournal are provided here courtesy of Cytopathology Foundation, Inc.

RESOURCES