L-selectin Promotes Migration, Invasion and Inflammatory Response of Fibroblast-Like Synoviocytes in Rheumatoid Arthritis via NF-kB Signaling Pathway

Abstract

Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease characterized by chronic inflammation of the synovium and progressive joint damage. Fibroblast-like synoviocytes (FLSs) exhibit excessive proliferative and aggressive phenotypes and play a major role in the pathophysiology of RA. Previous studies have confirmed the pathologic role of L-selectin in cell adhesion and migration. In rheumatoid arthritis models, L-selectin regulates leukocyte homing, which leads to joint inflammation. Moreover, in L-selectin knockout mice, there is a reduction in joint inflammation. However, the associations of L-selectin with FLSs in RA remain unclear. This study aims to reveal the effect of L-selectin on RA-FLSs and to investigate the molecular mechanism of L-selectin in RA. Our findings indicated that L-selectin was significantly expressed in RA synovial tissues and RA-FLSs. L-selectin silencing reduced RA-FLSs migration and invasion and attenuated the secretion of pro-inflammatory cytokines TNF-α, IL-1β and IL-6 in vitro. Moreover, investigations into mechanisms revealed that L-selectin activated the nuclear factor kappa-B (NF-κB) signaling pathway while blocking this signaling pathway could compromise the effects of L-selectin. Finally, in vivo experiments with a collagen-induced arthritis rat model revealed that silencing L-selectin alleviated inflammatory infiltration of the synovium and cartilage destruction, and validated the NF-κB signaling pathways findings observed in vitro. In summary, we show that L-selectin enhances the migration and invasion of RA-FLSs through the activation of NF-κB signaling pathways, ultimately worsening the progression of RA.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-025-02242-3.

Introduction

Rheumatoid Arthritis (RA) is a chronic autoimmune disorder characterized mainly by symmetrical and multiple arthritis, which commonly involves the hands, wrists, knees, and ankles [1, 2]. As the disease progresses, it leads to joint pain, swelling, stiffness, cartilage destruction, bone erosion, and eventually physical disability [3, 4]. Despite various mechanisms of RA pathogenesis have been proposed, the pathogenesis of RA is not fully clear. Although numerous treatments have been developed to treat RA, there are still patients whose joint inflammation remains ineffective controlled [5]. Fibroblast-like synoviocytes (FLSs) are predominant cells in the synovial tissue, and their integrity can protect the function and structure of joint organization [6]. Once RA-FLSs are activated, they can acquire characteristics such as tumor-like migration and invasion abilities, abnormal proliferation, defective apoptosis, and the secretion of pro-inflammatory mediators [7, 8]. Growing evidence suggests that reducing the migration, invasion, and pro-inflammatory secretion of RA-FLSs could be an innovative therapeutic strategy for RA [9, 10].

Adhesion molecules are crucial in cellular interactions underlying both acute and chronic inflammatory responses, which are central to the pathophysiology of rheumatic diseases, such as RA [11–13]. Alterations in cell adhesive interactions have been observed in patients with RA [14, 15]. In RA, the ongoing inflammation causes higher levels of cell adhesion molecules like ICAM-1 (Intercellular Adhesion Molecule-1) and VCAM-1 (Vascular Cell Adhesion Molecule-1). These molecules don't just help inflammatory cells stick and move around, they also make joint inflammation and tissue damage worse [16, 17].

L-selectin (SELL), a member of the selectin family of adhesion molecules expressed on leukocytes, plays an essential role in lymphocyte homing and migration and neutrophil recruitment to sites of inflammation [18]. Growing evidence in the literature indicates that L-selectin is involved in regulating monocyte protrusion during transendothelial migration (TEM) [19]. The levels of L-selectin are significantly increased in patients with rheumatoid arthritis [20, 21]. Previous studies have shown that in a proteoglycan (PG)-induced mice model of rheumatoid arthritis, L-selectin regulates the homing of leukocytes to lymph nodes and their entry into inflammatory tissues, leading to joint inflammation. In L-selectin knockout mice, there is a reduction in leukocyte adhesion, neutrophil infiltration, and the severity of joint inflammation [22].

Mechanistic investigations have elucidated that GdA interacts with L-selectin, inducing the production of IL-6 by monocytes/macrophages through the activation of the ERK signaling pathway [23]. Additionally, in the LPS-induced acute lung injury model, MAPK/AKT signaling transduction serves as the downstream mechanism through which L-selectin exerts its effects. When L-selectin is blocked, the expression level of p-AKT is reduced [24]. Small GTPases affect the gene expression of inflammatory cytokines through pro-inflammatory signaling pathways, such as nuclear factor kappa-B (NF-κB) signaling. These molecules regulate vascular inflammation through cell adhesion and migration during atherogenesis and are also regulated by extracellular stimuli, including L-selectin [25]. Furthermore, activation of L-selectin leads to Ca²⁺ influx via L-type voltage-operated Ca²⁺ channels (VOCC), which subsequently up-regulates Rho and Rac1 proteins in ASC-17D cells [26]. Moreover, L-selectin has been demonstrated to interact with actin-binding proteins, which may link L-selectin signaling to Rac1 pathways in Sertoli cells [27]. In addition, the cross-linking of L-selectin with sulphatides drives the activation of the NF-κB transcription factor in human neutrophils [28].

Although the importance of L-selectin in RA has been studied, existing research has primarily focused on the homing and migration of immune cells, such as lymphocytes and neutrophils. The association between L-selectin and fibroblast-like synoviocytes has not been thoroughly explored. Therefore, this study aims to clarify the significant role of L-selectin in RA-FLSs and collagen-induced arthritis (CIA) rats model. The findings of this study evaluate the potential of L-selectin inhibition as a treatment approach in RA.

Results

1. L-selectin is highly expressed in RA synovial tissue and RA-FLSs

   To clarify the role of L-selectin in the pathogenesis of RA. We analyzed the expression level of L-selectin in these synovial tissue samples from five microarray datasets (GSE1919, GSE89408, GSE55235, GSE55584 and GSE77298). The expression of L-selectin was upregulated in RA synovial tissue compared to normal synovial tissue or OA synovial tissue (Fig. S1A). Next, we validated the expression of L-selectin in synovial tissue using q-PCR, western blot, immunohistochemistry, and immunofluorescence. The results showed that L-selectin was highly expressed in RA synovial tissue compared to that in OA synovial tissue (Fig. 1A-D, S1B-D). Through immunofluorescence double staining, the outcome revealed a prominent upregulation of L-selectin expression in RA-FLSs (Vimentin positive) (Fig. 1D, S1D). Next, we assessed the expression of L-selectin in OA-FLSs and RA-FLSs. L-selectin protein expression was relatively higher in RA-FLSs compared to OA-FLSs (Fig. 1E, S1E).

2. Effects of L-selectin on cell migration, invasion and inflammatory response in RA-FLSs

   To further explore the biological function of L-selectin in RA-FLSs, we used overexpression plasmids and siRNA to either overexpress or suppress L-selectin expression. The efficiency of L-selectin overexpression or silencing was confirmed by western blot (Fig. 2A). We assessed cell migration using wound-healing assays and cell invasion using transwell invasion assays. Our results demonstrated faster closure and increased invasion in RA-FLSs with L-selectin overexpression. However, the knockdown of L-selectin suppressed migration and invasion in RA-FLSs (Fig. 2B, C, S2A, B). RA-FLSs can secrete TNF-α, IL-1β, and IL-6 in response to LPS stimulation, and these factors are implicated in the RA-FLSs-mediated inflammatory response [29]. To further assess the pro-inflammatory effects of L-selectin, we measured the levels of these factors in the supernatant of RA-FLSs treated with LPS and L-selectin overexpression or si-L-selectin. The expression of TNF-α, IL-1β, and IL-6 was increased by L-selectin overexpression, while si-L-selectin significantly reduced the secretion of TNF-α, IL-1β, and IL-6 in RA-FLSs (Fig. 2D). These results suggest that L-selectin promotes cell migration, invasion, and the release of inflammatory factors in RA-FLSs.

3. L-selectin plays a crucial role in the activation of the NF-кB signaling pathway

   Existing studies indicate that the pathogenesis of RA is complex and involves multiple signaling pathways, with NF-κB being one of the key pathways [30, 31]. Previous study has also suggested a close relationship between L-selectin and the NF-κB signaling pathway [25]. To further investigate the regulatory mechanisms of L-selectin in RA, we performed RNA sequencing on both the NC group and the L-selectin knockdown group. KEGG analysis revealed significant changes in the NF-кB signaling pathway following L-selectin inhibition (Fig. S3). Subsequently, western blot was used to examine both the total and phosphorylated protein levels associated with the NF-κB signaling pathways. Compared to the LPS treatment group, increased expression of p-p65 and p-IκBα was observed in the L-selectin overexpression group, while reduced expression of p-p65 and p-IκBα was observed in the si-L-selectin group (Fig. 3A, B). Next, we used Phorbol 12-myristate 13-acetate (PMA, an NF-κB agonist) and BAY 11–7082 (an NF-κB inhibitor) to further explore whether L-selectin affects the activation of the NF-κB signaling pathway. The elevated levels of p-p65 and p-IκBα caused by L-selectin overexpression were significantly reduced by treatment with BAY 11–7082 (Fig. 3C). Conversely, the reduced levels of p-p65 and p-IκBα were observed after L-selectin knockdown, and they were partially restored by PMA (Fig. 3D). As is well known, a characteristic of NF-κB signaling pathway activation is the nuclear accumulation of NF-κB. Therefore, We extracted cytoplasmic and nuclear proteins to observe the changes in p65. Western blot analysis and immunofluorescence staining confirmed that L-selectin knockdown attenuated the nuclear accumulation of p65, with a concomitant increase in the cytoplasm (Fig. 3E, F). These findings collectively indicate that L-selectin may promote the nuclear translocation of NF-κB, thereby enhancing its activity and suggesting the involvement of the NF-κB signaling pathway.

4. Knockdown of L-selectin reduced arthritis severity in CIA rats through the NF-κB signaling pathway

   To further confirm the role of L-selectin in RA, we used the classic CIA rat model to conduct in vivo experiments. After intra-articular injection of L-selectin in vivo siRNA, the arthritis score and paw swelling were significantly ameliorated (Fig. 4A, B). Consistently, H&E staining and Safranin O/Fast Green staining showed that inhibition of L-selectin reduced the infiltration of inflammatory cells, cartilage damage, and bone erosion (Fig. 4C, D). Furthermore, the concentrations of the pro-inflammatory cytokines TNF-α, IL-1β and IL-6 were decreased in the serum of the group with L-selectin inhibition (Fig. 4E). Similarly, the protein levels of p-p65 and p-IκBα were also decreased in this group (Fig. 4F). We also found that the effect of L-selectin inhibition can be partially reversed after the application of the NF-κB agonist PMA (Fig. 4A-F). These data suggest that L-selectin may regulate RA progression through the NF-κB signaling pathway in vivo.

Fig.1.

L-selectin is highly expressed in RA synovial tissue and RA-FLSs. (A) q-PCR was used to measure L-selectin mRNA levels in synovial tissues from OA (n = 6) and RA patients (n = 6). (B) Western blot analysis was performed to measure L-selectin protein levels in synovial tissues from OA (n = 6) and RA patients (n = 6). (C) Immunohistochemistry of L-selectin was performed in synovial tissues from OA (n = 6) and RA patients (n = 6). Scale bar, 100 µM. (D) Immunofluorescence staining of L-selectin (red) and Vimentin (green) in synovial tissues from OA (n = 6) and RA patients (n = 6). Scale bar, 100 µM. (E) Western blot analysis was performed to detect L-selectin protein levels in OA-FLSs (n = 6) and RA-FLSs (n = 6). *p < 0.05 compared with OA group. Data are presented as the mean ± SD of at least three independent experiments

Fig.2.

Effects of L-selectin on cell migration, invasion and inflammatory response in RA-FLSs. (A) Western blot analysis was used to measure the efficiency of L-selectin overexpression or silencing in RA-FLSs. (B) Wound‑healing assays of RA-FLSs (n = 6). (C) Transwell invasion assays of RA-FLSs. (n = 6) (D) TNF-α, IL-1β and IL-6 levels in the supernatant of RA-FLSs were analyzed by ELISA (n = 6). *p < 0.05 compared with VE or NC group. Data are presented as the mean ± SD of at least three independent experiments

Fig.3.

L-selectin plays a crucial role in the activation of the NF-кB signaling pathway. (A) The protein expression levels of p65, p-p65, IκBα, and p-IκBα were assessed via western blot after transfecting cells with an L-selectin overexpressing plasmid or a negative control vector, followed by stimulation with LPS. (B) The protein expression levels of p65, p-p65, IκBα, and p-IκBα were assessed via western blot after transfecting cells with an L-selectin siRNA or a negative control siRNA, followed by stimulation with LPS. (C) The protein expression levels of p65, p-p65, IκBα, and p-IκBα were assessed via western blot after transfecting cells with an L-selectin overexpressing plasmid and/or then stimulated by BAY 11–7082. (D) The protein expression levels of p65, p-p65, IκBα, and p-IκBα were assessed via western blot after transfecting cells with an L-selectin siRNA and/or then stimulated by PMA. (E) The cytoplasmic or nuclear protein expression levels of p65 were assessed via western blot after the knockdown of L-selectin. (F) Immunofluorescence staining of p65 nuclear translocation following silencing of L-selectin. Scale bar, 50 µM. *, # p < 0.05 * compare with Con group (A, B), VE group (C) or NC group (D), # compare with LPS + VE group (A), LPS + NC group (B), OE group (C) or siRNA group (D). Data are presented as the mean ± SD of at least three independent experiments.

Fig.4.

Knockdown of L-selectin reduced arthritis severity in CIA rats through the NF-κB signaling pathway. (A) The image of the rats' hind paws. (B) The paw thickness and arthritis index for different groups. (C) Representative images of H&E staining of ankle joint sections. Scale bar, 200 µM. (D) Representative images of Safranin O/Fast Green staining of ankle joint sections. Scale bar, 200 µM. (E) TNF-α, IL-1β, and IL-6 levels in the serum of the different groups were analyzed by ELISA. (F) The protein expression levels of L-selectin, p65, p-p65, IκBα, and p-IκBα were assessed via western blot. *p < 0.05 compared with CIA + siCtrl group. #p < 0.05 compared with CIA + si-L-selectin group. Data are presented as the mean ± SD of at least three independent experiments

Discussion

Rheumatoid arthritis (RA) is an autoimmune disease accompanied by persistent synovial inflammation and hyperplasia that ultimately leads to cartilage and bone destruction in the joints [32]. As the disease advances, it can lead to joint deformities and even cause various tissues and organs throughout the body [33]. The etiologies of RA are diverse and complex, and its high prevalence presents a significant challenge to public health [34]. Conventional treatments for RA include nonsteroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, disease-modifying antirheumatic drugs (DMARDs), and biologic agents [35]. However, more than 30% of patients do not respond to current therapies, regardless of the antirheumatic agent's mechanism of action, suggesting the existence of additional, unidentified pathways contributing to disease persistence [36, 37]. To date, effectively treating RA remains a significant challenge in both clinical practice and drug development. The inhibition of inflammatory reactions has become a key area of research for treating RA.

Fibroblast-like synoviocytes (FLSs), as major tissue-resident cells, are essential to synovial homeostasis, joint inflammation, and damage [38]. Activated RA fibroblast-like synoviocytes display an aggressive phenotype and significantly contribute to inflammation by secreting inflammatory cytokines, chemokines and matrix metalloproteinases (MMPs). In turn, the interaction between inflammation and chemokines drives RA progression by activating RA-FLSs [39, 40]. The pathological inflammatory response progressively accumulates, exacerbating joint dysfunction and damage. Meanwhile, increased invasiveness is a key characteristic of RA-FLSs. RA-FLSs migrate to the cartilage surface by means of cytoskeleton polymerization. They then activate chondrocytes and osteoclasts through the production of proteolytic enzymes, leading to bone destruction [6]. The invasive phenotype of RA-FLSs allows them to affect distant joints and involve multiple joints throughout the body, making them a distinctive and highly promising target for potential therapeutic interventions [41]. Therefore, our study aims to identify key factors that specifically target RA-FLSs-mediated inflammation, migration and invasion, potentially providing novel therapeutic targets for RA.

The expression and function of adhesion molecules are closely regulated through intracellular signaling induced by cytokine or chemokine stimulation, which are likely involved in the initiation and propagation of autoimmune diseases [42, 43]. Adhesion molecules regulate lymphoid cell homing to tissues and inflammatory sites, leukocyte circulation, and transendothelial migration. Also, they transduce extracellular signals into intracellular pathways, contributing to cell activation and cytokine production [42, 44]. L-selectin, a member of the lectin cell adhesion molecule family, is expressed in most leukocytes and has a pivotal role in cell migration [45–47]. L-selectin is crucial for the initial attachment of leukocytes to the endothelium and to other leukocytes. During an inflammatory process, L-selectin facilitates lymphocyte trafficking to lymph nodes and directs lymphocytes and neutrophils to sites of inflammation. Consequently, inflammatory processes can be directly affected if L-selectin is blocked [48]. RA-FLSs express immune-modulating cytokines, adhesion molecules, and matrix remodeling enzymes, which contribute to both initiating and perpetuating destructive joint inflammation [49]. In addition to its function as an adhesion molecule, many previous studies have already shown that L-selectin can regulate cell signal transduction. In T lymphocytes, L-selectin triggers a signaling cascade through the tyrosine kinase p56lck to the small G-proteins Ras and Rac, and subsequently to MAP-kinases [50, 51]. Additionally, L-selectin activates another signaling cascade via src-like tyrosine kinases and Rac proteins to JNK in Jurkat T lymphocytes [52]. Next, Brenner's team also confirmed that stimulating lymphocytes via L-selectin contributes to the activation of neutral sphingomyelinase and the release of ceramide [53]. Moreover, L-selectin stimulation induces the translocation of the transcription factor nuclear factor of activated T cells (NFAT) [54]. L-selectin activates Ca²⁺ influx via L-type VOCC, which subsequently upregulates Rho and Rac1 proteins in ASC-17D cells [26]. Furthermore, sulphatide crosslinking of L-selectin induces transcriptional expression of TNF-a and IL-8, as well as the activation of NF-κB [28, 55]. All these results implicate the importance of L-selectin as a signaling molecule. Activation of signal transduction pathways occurs after L-selectin stimulation, which seems to prepare the system for the next phases of the inflammatory response.

The previous study indicates that the expression of L-selectin is elevated in the serum of patients with RA [20, 21, 56]. 6-sulfo sLex glycans serve as major ligands for L-selectin, and their interaction can affect the migration of lymphocytes to lymph nodes and initiate immune responses [57–59]. SF1, a novel anti-glycan antibody against 6-sulfo sLex, significantly alleviates the clinical and histopathological progression of CIA mice and reduces the expression of inflammatory cytokines by blocking this process [60]. In the proteoglycan (PG)-induced mouse rheumatoid arthritis model, the incidence and severity of arthritis were reduced in L-selectin mutant mice compared with wild-type mice. Meanwhile, the mice lacking L-selectin have more marked resistance to severe arthritis [22]. Conventional antirheumatic therapy may modify synovial inflammation by altering leukocyte adhesion. For example, colchicine has been shown to reduce the expression of L-selectin, E-selectin, and ICAM-1 in immunocompetent cells [61]. In addition, antibodies against L-selectin can partially inhibit lymphocyte binding to the endothelium of synovial sections in rheumatoid arthritis [62]. These results suggest that L-selectin plays a critical role in the development of joint inflammatory disease. However, the effects of L-selectin on RA-FLSs and RA are not yet clear. Understanding the molecular and biological characteristics of L-selectin in RA-FLSs may help in understanding RA and preventing its progression.

Through analysis of GEO public databases (GSE1919, GSE89408, GSE55235, GSE55584 and GSE77298), we found that L-selectin is upregulated in the synovial tissue of RA. To validate this, we conducted subsequent experimental verification. Our study revealed that L-selectin was highly expressed in RA synovium tissues and RA-FLSs. To better explore the function of L-selectin in RA-FLSs, we performed L-selectin overexpression and knockdown experiments. The data showed that knockdown of L-selectin significantly inhibited cell migration and invasion and reduced the release of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6 in RA-FLSs. NF-κB signaling pathway plays a crucial role in essential cellular processes, such as cell survival, inflammation, and immune responses [63–65]. NF-κB signaling pathway can trigger the production of various inflammatory factors and regulate cytokine expression during RA development, thereby contributing to synovial hyperplasia by promoting the proliferation, migration and invasion of RA-FLSs [66–68]. Targeting the NF-κB pathway to inhibit the proliferation and invasion of synovial cells is also employed in the treatment of RA [69]. Previous studies have shown that L-selectin is closely linked with the activation of the NF-κB signaling pathway. To investigate the relationship between L-selectin and the NF-κB signaling pathway, we examined the levels of NF-κB-related proteins and their phosphorylated forms using western blot. We observed that L-selectin can inhibit the expression of p-p65 and p-IκBα, and these effects can be reversed by NF-κB agonists or antagonists. Moreover, the knockdown of L-selectin attenuated the nuclear translocation of p65. Finally, in vivo experiments revealed that disrupting L-selectin can suppress the inflammatory process, cartilage erosion and NF-κB signaling pathway in collagen-induced arthritis (CIA) rats, and this inhibitory effect can be partially reversed by the NF-κB agonist PMA. These findings are consistent with the results obtained in RA-FLSs.

In summary, our study showed that the knockdown of L-selectin inhibits migration, invasion, and secretion of pro-inflammatory cytokines in RA-FLSs. Its functional role is partly mediated through the NF-κB signaling pathway. Meanwhile, in vivo experiments demonstrated that inhibiting L-selectin mitigated joint symptoms and the inflammatory response in CIA rats. These results could offer valuable insights for developing targeted therapies for RA.

Materials and Methods

Ethics Statement

The experiment was approved by the Ethics Committee of the Department of the Affiliated Hospital of Nantong University and was conducted in accordance with the Declaration of Helsinki. All the patients signed the agreement prior to the study. Additionally, the animal experiments were approved by the Animal Ethics Committee of Nantong University and were conducted in accordance with the guidelines for animal care established by the United States' National Institutes of Health.

Human Synovial Tissue

Human synovial tissue was collected from osteoarthritis (OA) (n = 6) and RA patients (n = 6) who underwent total knee arthroplasty in the Orthopedic Department of the Affiliated Hospital of Nantong University. Patients were diagnosed according to 1986 revised ACR classification criteria for OA and 2010 ACR/EULAR classification criteria for RA.

Data Download and Processing

Five microarray datasets (GSE1919, GSE89408, GSE55235, GSE55584 and GSE77298) were retrieved from the GEO database (https://www.ncbi.nlm.nih.gov/geo), and detailed information about these datasets is provided in Supplementary Information Table 1. The corresponding probe expression matrix files (∗ series_matrix.txt) were downloaded and subsequently normalized and log2 transformed. We then matched each probe expression matrix with its respective platform annotation file and retained only the well-annotated probes.

Cell Isolation and Culture

The isolation and culture of RA-FLSs were performed as described previously [70]. Tissue samples were finely minced and digested in type II collagenase (1 mg/ml, Sigma-Aldrich, USA) in Dulbecco's modified Eagle's medium (DMEM, Gibco, USA) while gently shaking for 3 h in a 37 °C, 5% CO2 incubator (Thermo, USA). Then, the cells were centrifuged, collected, and suspended in DMEM containing 10% FBS (Gibco, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin, and incubated in a 5% CO2 incubator at 37 °C. Cells between passages 3 and 6 were used for further study. The RA-FLSs in vitro model was constructed using lipopolysaccharide (LPS, 1 µg/mL, Sigma-Aldrich, USA).

Western Blot Analysis

The total protein of the synovial tissues and RA-FLSs was extracted using radioimmunoprecipitation assay (RIPA) buffer with 1% protease and phosphatase inhibitor cocktail (NCM, China). The proteins were applied to SDS-PAGE gels and subsequently transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked with 5% skim milk on a shaker for 2 h at room temperature, then incubated overnight at 4 °C with a primary antibody as follows: L-selectin (58225S, Cell Signaling, USA), GAPDH (60,004–1-Ig, Proteintech, China), p65 (10,745–1-AP, Proteintech, China), p-p65 (82,335–1-RR, Proteintech, China), IκBα (10,268–1-AP, Proteintech, China) and p-IκBα (82,349–1-RR, Proteintech, China). After that, the membrane was washed with Tris-buffered saline with Tween-20 (TBST) three times, followed by incubation with secondary antibodies for 1 h at room temperature. After the secondary antibody incubation, the membrane was washed three times with TBST and was visualized using the enhanced chemiluminescent kit (NCM, China) on a Bio-Rad imaging system. The quantitative analysis of target bands was performed using ImageJ software.

Immunohistochemistry Staining

The synovial tissue paraffin sections were baked in an oven at 60 °C for 1 h, and then immersed in xylene I and II solutions for each 15 min. Subsequently, the sections were subjected to rehydrated by gradient alcohol. After that, the sections were treated with endogenous peroxidase inhibitor for 10 min to eliminate the endogenous peroxidase and then blocked with 3% BSA for 1 h at room temperature. The sections were then incubated with primary antibodies overnight at 4 °C and subsequently treated with secondary antibodies (PV-9000, ZSGB, China) at 37 °C for 20 min. After this, the sections were incubated with diaminobenzidine (DAB) staining solution at room temperature and observed under the microscope for an appropriate amount of time. Hematoxylin staining solution was used to counterstain the nuclei. Afterward, the sections were dehydrated in a graded series of ethanol, cleared with xylene, mounted with neutral gum, and observed under Leica light microscope.

Immunofluorescence Staining

First, the sections were subjected to dewaxing and rehydration, following the same steps as in the previous IHC procedures. Subsequently, the sections were subjected to immunostaining permeabilization buffer with Triton X-100 (P0096, Beyotime, China) for 10 min, followed by incubation with 5% BSA for 1 h at room temperature. Next, the sections were incubated with appropriately diluted primary antibodies overnight at 4 °C. On the following day, the sections were incubated with Coralite-conjugated secondary antibodies for 1 h, and then counterstained with DAPI for 5 min in the dark at room temperature. Fluorescence signals were visualized with Leica inverted fluorescence microscopy.

Quantitative Real-Time PCR (q-PCR)

The total mRNA was isolated according to the instruction of the RNA-Quick Purification Kit (RN001, Yishan, China). The extracted total mRNA was reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR (R323, Vazyme, China). The q-PCR was conducted on LightCycler96 (Roche, Switzerland) with 2 × Universal Blue SYBR Green qPCR Master Mix (G3326-01, Servicebio, China). The PCR program used a two-step method, as follows: an initial step at 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. RNA quantification was normalized to GAPDH by the 2^−ΔΔCT method. The primers used are as follows: L-selectin (F:CCTCTTCATTCCAGTGGCAGTC; R:TATGGGTCATTCATACTTCTCTTGG) and GAPDH (F: CAGGAGGCATTGCTGATGAT; R: GAAGGCTGGGGCTCATTT).

Cell Transfection

Overexpression plasmid (pEnCMV-L-selectin (human)−3 × FLAG-SV40-Neo) and small interfering RNA (siRNA) targeting L-selectin were purchased from GenePharma (Shanghai, China). The sequences are as follows: si-L-selectin#1 sense: 5′- GCUCAGAAGGAACUGAGUUAATT-3′; antisense: 5′-UUAACUCAGUUCCUUCUGAGCTT-3′; si-L-selectin#2 sense: 5′-GAAGUAUGAAUGACCCAUAUUTT-3′; antisense: 5′-AAUAUGGGUCAUUCAUACUUCTT-3′; si-L-selectin#3 sense: 5′-CCAUGGAGAAUGUGUAGAAAUTT-3′; antisense: 5′-AUUUCUACACAUUCUCCAUGGTT-3′. The cells were seeded into a 6-well plate at a density of 70% and transiently transfected using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer's instructions. The cells were harvested 48 h later for further experimentation.

Wound Healing Assays

RA-FLSs were seeded in a six-well plate. After the cells reached 60%–70% confluence, they were treated with siRNA or overexpression plasmid for 24 h, followed by treatment with LPS for an additional 24 h. Then, the cells were scratched with a 200-μl pipette tip to create a straight line on the confluent cell monolayer, and they were cultured in basal medium without serum. Wound closure was photographed at 0 and 24 h using Leica inverted microscope.

Transwell Invasion Assays

RA-FLSs were treated with siRNA or an overexpression plasmid and LPS, then digested and adjusted to a cell density of 1 × 10^{^5}. Subsequently, 200 μl of cell suspension (without FBS) was slowly added to the upper transwell chamber pre-coated with Matrigel (BD Biosciences, USA), while the lower compartment was filled with 500 μl of DMEM containing 10% FBS. Then, the cells were incubated at 37 °C for 24 h, fixed, stained, and photographed using Leica inverted microscope. The upper surface of the insert was cleaned with cotton swabs to remove non-invading cells.

Cytosolic and Nuclear Protein Extraction

The extraction of cytosolic and nuclear proteins was performed according to the instructions of the Nuclear and Cytoplasmic Protein Extraction Kit (P0027, Beyotime, China). As a brief summary, cells were vortexed vigorously after adding cytoplasmic extraction buffer A (including PMSF, Phenylmethanesulfonyl fluoride) for 5 s, followed by incubation on ice for 10 min. Subsequently, cytoplasmic extraction buffer B was added, and the mixture was vortexed vigorously for 5 s, followed by incubation on ice for 1 min. The supernatant was used as the cytosolic proteins after centrifugation at 12,000 g for 5 min at 4 °C. The pellets were added to nuclear extraction buffer (including PMSF), vortexed vigorously for 15 s and incubated on ice for one minute. After vortexing multiple times for a total of 30 min, the cell lysates were centrifuged at 12,000 g for 10 s at 4 °C. The supernatant was used as the nuclear proteins.

Enzyme-Linked Immunosorbent Assay (ELISA)

RA-FLSs supernatants and rat serum were harvested for ELISA assay. Human or rat TNF-α, IL-6, and IL-1β levels were measured using ELISA kits according to the manufacturer's protocol.

Rat Collagen-Induced Arthritis (CIA) Model Establishment and Treatment

Six-week-old male Wistar rats were purchased from the Experimental Animal Center of Nantong University. The in vivo siRNA targeting L-selectin was purchased from Riobio (Guangzhou, China). Rats were randomized into the following groups: normal group (Con, n = 6), CIA + negative control group (CIA + siCtrl, n = 6), CIA + si-L-selectin group (CIA + si-L-selectin, n = 6) and CIA + si-L-selectin + PMA group (CIA + si-L-selectin + PMA, n = 6). Incomplete Freund’s adjuvant (Cat#7002, Chondrex, USA) and bovine type II collagen (Cat#20,022, Chondrex, USA) were combined in a 1:1 ratio. In the CIA model, 200 µL of the mixture was injected intradermally into the base of the rat’s tail. 100 µL of the mixture was administered similarly for booster immunization after 7 days. 28 days after the first immunization, rats in the CIA + si-L-selectin group and CIA + si-L-selectin + PMA group were administered 5 nmol of si-L-selectin (30 µL volume) via intra-articular injection into their knee and ankle joints once a week for 3 weeks, as previously described [71]. Meanwhile, the CIA + si-L-selectin + PMA group also received additional injections of PMA (1 µg) once a week for 3 weeks. The severity of arthritis was continuously monitored 21 days after the first immunization by assessing the arthritis index (AI) as previously described. This index is based on limb swelling, with each limb being scored up to 4 points, and a total possible score of 16 for each rat. The thickness of the paw and the AI were measured every 7 days for 21 days after the first immunization. All rats were sacrificed 7 weeks after the first immunization.

Pathological Staining

The hind ankle joints were fixed with 4% paraformaldehyde for 24 h and decalcified using Ethylene Diamine Tetraacetic Acid (EDTA) decalcification solution (G1105, Service, China) for 30 days. Hematoxylin–eosin (H&E) staining and Safranin O/Fast Green staining were used to evaluate synovial inflammation infiltration and cartilage damage.

Statistical Analysis

All statistical analyses were carried out using GraphPad Prism 9.0. Results are expressed as the mean ± SD of at least three independent experiments. Statistical analyses between the two groups were performed using Student’s t-test. Statistical significance was defined as P < 0.05.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contributions

All authors contributed to the study conception and design. Conducted research, data collection and analysis: Weijie Wu, Yunyi Nan and Zhen Cheng. The first draft of the manuscript: Weijie Wu, Gang Pan and Youhua Wang. Funding acquisition: Youhua Wang. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (Grants No.82072395) and the Natural Science Foundation of Jiangsu Province (Grants No.BK20241842).

Data Availability

Data will be made available on request.

Declarations

The authors thank the patients for participating in this study. All humans and animals were carried out in accordance with relevant guidelines and regulations.

Ethics Approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of the Department of the Affiliated Hospital of Nantong University.

Consent to Participate

Informed consent was obtained from all individual participants included in the study.

Competing Interests

The authors declare no competing interests.