Skip to main content
Renal Failure logoLink to Renal Failure
. 2025 Nov 6;47(1):2579211. doi: 10.1080/0886022X.2025.2579211

The synergistic renoprotective effects of valproate sodium and metformin in a diabetic nephropathy mouse model: attenuation of pro-inflammatory markers and enhancement of Sirt1 and Bcl-2 expression

Parisa Saberi-Hasanabadi a,b, Hossein Ghalhenoi c, Roghayeh Jahani a, Sepideh Saberi d, Seyed Mohammad Reza Sayedi Moqadam a, Fereshteh Talebpour Amiri e, Ramin Ataee f,g,
PMCID: PMC12599348  PMID: 41199599

Abstract

Diabetic nephropathy is a serious and common complication among patients with both type 1 and type 2 diabetes, and it significantly reduces the patient’s quality of life. This study aimed to assess the reno preventive effects of valproate sodium (VPS) and metformin (MET) on alloxan-induced diabetic nephropathy and to elucidate their mechanisms of action, ‘type 1 diabetic mice’ (25–30 g) were established using a single dose of alloxan (‘120 mgkg-1’). and the diabetic mice were treated with three doses of VPS (10, 20, and 40 mg/kg) and MET (200 mg/kg) for a period of 28 days. Specific tests were performed to evaluate inflammatory gene expression (TNF-α, IL-6, and NF-κB) and histopathological changes and apoptotic factors (Bax/Bcl2, Caspase3). Our results have shown, VPS and MET led to significant decreases in blood glucose levels, thereby reflecting the improvement of impaired kidney function and decreasing elevated renal mRNA levels of inflammatory genes (TNF-α, IL-6, and NF-κB) in diabetic mice. A significant increase in the expression of be ‘Sirt1 and Bcl-2’ and decrease in (TNF-α, IL-6, and NF-κB) was observed in the kidneys of diabetic mice receiving MET/VPS Moreover, MET/VPS successfully prevented diabetes induced ‘histopathological deleterious changes’ in the kidneys of mice so it can concluded that MET and VPS alone or in combination can prevent alloxan-induced diabetic nephropathy through attenuating inflammatory markers and probably with suppression of apoptosis.

Keywords: Diabetes, valproate sodium, metformin, alloxan, diabetic nephropathy, anti-inflammatory

1. Introduction

Diabetic nephropathy is a serious and common complication among patients with both type 1 and type 2 diabetes, and it significantly reduces the patient’s quality of life. A continuous increase in edema and blood pressure and decreased glomerular filtration rate are the most indicative symptoms of this disease [1]. Diabetic nephropathy leads to expansion of mesangial cells, mesangial hypercellulitis, and changes in the thickness of the glomerular basement membrane. Prevention of the activated renin-angiotensin-aldosterone system in diabetic kidneys plays a vital role in the treatment of diabetic nephropathy [2]. ACE (angiotensin converting enzyme) inhibitors, as first-line treatments, are effective in reducing nephropathy progression in diabetic patients and delaying cardiovascular and renal morbidity and mortality. Recent studies have also demonstrated the importance of epigenetic processes such as histone acetylation, and the role of histone deacetylases and histone acetyltransferases in the development of this silent epidemic [3,4]. To stem the tide of this potentially catastrophic long-term complication, researchers have explored various opportunities to use drug combinations, including histone deacetylase (HDACs) inhibitors, angiotensin-converting enzyme inhibitors, and AMP-activated protein kinase (AMPK)/mammalian target of rapamycin (mTOR) (AMPK/mTOR) signaling axis regulators. Histone deacetylases are types of enzymes that balance the acetylation activity of histone acetyltransferase by adjusting the acetylated/non-acetylated status of histone on chromatin remodeling and play an important role in regulating transcription [5–7]. Several studies have separately investigated the effects of VPS (Valperoate Sodium) and MET(Metformin) on diabetic renal failure and kidney injury [8–10].

Valproate sodium has anti-inflammatory and antioxidant activities and reduces the damage to organs involved in various pathological conditions through the contribution of HDACs in the pathogenesis of diabetic renal injury and fibrosis [9]. Advani et al. (2011) monitored the long-term effects of vorinostat, a histone deacetylase inhibitor, on renal injury in experimental diabetes patients [11].

Metformin is widely used in the medical treatment of patients with diabetes. In addition to its ant diabetic effects, recent studies have indicated the protective effects of metformin against nephropathy and reduction of renal apoptosis in vitro and in vivo. Furthermore, metformin reduces albuminuria in diabetic mice as well as in patients with type 2 diabetes. Evidence has shown that these effects are mediated through modulation of oxidative stress gene expression by the AMPK/mTOR signaling axis [12,13]. Eisenreich and Leppert (2017) reviewed the latest findings on the protective renal effects of metformin in diabetic nephropathy [14]. Alhaider et al. (2011) evaluated the effect of metformin on biochemical changes associated with STZ-induced hyperglycemia in rat kidney tissues. Their results showed that treatment of diabetic nephropathy rats with metformin normalized all biochemical changes and energy status in the kidney tissues. At the transcriptional level, metformin treatment significantly restored diabetic nephropathy-induced oxidative stress mRNA levels, particularly GSTα, NQO1, and CAT genes, and inhibited TNF-α and IL-6 pro-inflammatory genes [13].

The mechanisms of action and the roles of oxidative stress, expression of inflammatory genes, and apoptosis and their possible links as result as treatment with MET and VPS have not been fully elucidated and require further investigation. Therefore, in the present study, a synergistic reno protective effect of VPS and MET against diabetic nephropathy was clearly demonstrated through the use of alloxan-induced diabetic nephropathy in mice to demonstrate the importance of inflammatory pathways in diabetic nephropathy and renal damage and the modulatory effects of these two medicinal compounds on the expression of some oxidative stress genes and pro-inflammatory mediators involved in the pathogenesis of diabetic nephropathy, Especially, role of VS as of HDACs inhibitor in combination with metformin in attenuating diabetes nephropathy has been a goal of this study.

2. Materials and methods

2.1. Chemicals

Alloxan was purchased from Sigma-Aldrich (St. Louis, MO, USA). Metformin and valproate sodium were purchased from (Ramopharmin Pharmaceutical Co., Tehran, Iran). Glucose measurements were performed using a OneTouch Select Analyzer (Roche Diagnostics GmbH, Mannheim, Germany). All other chemicals were purchased from standard commercial suppliers. The chemicals used for conducting this research were of premium analytical quality, prepared fresh prior to use.

2.2. Animal treatments

Experiments were performed on 6–8 weeks male C57BL/6 mice (n = 70) weighting 23–25 g. The animals were randomly divided into seven groups of ten animals each. The number of mice and doses of the compounds used in this study were chosen in accordance with previous studies [4,9,10].

  • Group I (GI): Control group (normal saline).

  • Group II (GII): Alloxan (120 mg/kg/day) (diabetic group).

  • Group III (GIII): Alloxan + VPS (10 mg/kg/day).

  • Group IV (GIV): Alloxan + VPS (20 mg/kg/day).

  • Group V (GV): Alloxan + VPS (40 mg/kg/day).

  • Group VI (GVI): Alloxan + MET (200 mg/kg/day).

  • Group VII (GVII): Alloxane + MET (200 mg/kg/day) + VPS (40 mg/kg/day).

The mice were maintained in an air-conditioned animal house at 23–24 °C with natural alternating light and dark cycles. Food and water were provided throughout the experiment period ad libitum. Animal experimentation protocols were conducted in accordance with the recommendations of the Mazandaran University of Medical Sciences Animal Ethical Committee (Code: IR.MAZUMS.4. REC.1397.1396). At the time of sacrifice (day 28), the mice were anesthetized with ketamine and xylazine (40 mg/kg, i. p.), and their kidneys were separated by laparotomy. First, the removed tissues were washed using cold mannitol buffer (including 0.255 M mannitol, 74 mM sucrose, and 0.2 mM EDTA). The excised tissues were homogenized using an electric homogenizer. The homogenized tissue was transferred to microtubes and centrifuged at 2000xg for 10 min in a refrigerated centrifuge at 4 °C. After centrifugation, the supernatant solution was slowly transferred to other microtubes and the bottom sediment containing broken cells and nuclei was discarded. The supernatant was centrifuged again at 12000xg for 10 min. After 4 weeks of treatment, immediately before sacrifice, blood samples (1 mL) were collected from the tail vein in flasks coated with 2 µL EDTA (0.5 M) to prevent clotting. Under these conditions, plasma can be properly separated from the blood by centrifugation (3000 ×g for 15 min) for biochemical measurements [9].

2.3. Diabetes model and treatment methods

Alloxan (120 mg/kg body weight dissolved in citrate buffer (pH 4.5)) was injected in single administration intraperitoneally into the animals to induce diabetes which after 72 h of alloxane injection when the mice drink water with glucose 10%, FBS checked, Mice were included in the study only if they were diabetic and had a blood glucose level above 180 mg/dl [14]. The treatment was continued until 28 days, and the blood glucose level was measured at 28 days post-treatment.

2.4. Histopathological changes and immunohistochemical staining

Histology and immunohistochemistry: three-micron thick sections from blocks and formalin-fixed, paraffin-embedded tissues were mounted on glass slides, deparaffinized, rehydrated, and stained with hematoxylin using standard histological techniques. After deparaffinization in xylene, the slides were rehydrated with decreasing concentrations of ethanol. For antigen retrieval, sections were incubated with citrate buffer (pH 6.0, 10 mM), heated twice in a microwave at 750 W for 4 min, after which sections were washed three times in TBS and incubated with normal.

Sections after wash, to blocking nonspecific antigen binding was blocked by incubation in PBS containing 1% BSA for 30 min at room temperature. And to ‘endogenous peroxidase activity. Sections were treated with 2% hydrogen peroxide and incubated for 24h at 4 °C with the specific immunohistochemical primary antibody.’ (anti-BCL2,1:250 mouse antibody (SC-7382, Santacruz co) and anti BAX,1:250 mouse antibody (SC-7480, Santacruz co), and anti caspase3 1:250, mouse antibody (SC-56053, Santacruz co)) diluted in PBS. The sections were washed with PBST and incubated with the secondary antibody (mouse anti-mouse IgG-BP-hRP,1;300) for 1h at 37 °C, followed by incubation with avidin-biotin peroxidase (1:10000) for 45 min, incubation with the immunodetection solution (DAB + H2O2 1%) for 10 min, washing with tap water, counterstaining with hematoxylin, dehydration with increasing levels of alcohol, and clarification with xylose. sections were examined using a light microscope and photographed. Immunoreactivity was assessed semiquantitive by non-parametric method. The stained slides (75 × 25 mm) were microscopically analyzed using a light microscope (BX40, OLYMPUS, Japan).

2.5. Quantitative real‐time RT-PCR

Total RNA was extracted from the tissues using TRIzol reagent (YTA, Iran) and treated with DNase I (Aminsan, Iran). One μg of each total RNA was reverse transcribed to cDNA using a first-strand cDNA synthesis kit (YTA, Iran). Quantitative real-time PCR was performed to assess gene expression using the StepOnePlus Real-Time PCR System (ABI, USA) and qPCRBIO SyGreen Mix (PCR Biosystems, UK). The PCR parameters were as follows: initial denaturation (one cycle at 95 °C for 2 min); 40 cycles of denaturation, annealing, and amplification (95 °C for 5 s, 60‐64 °C for 30 s); and a melting curve (starting at 65 °C and gradually increasing to 95 °C). Gene expression levels of TNF-α, IL-6, NF-κB, and Sirt1 were normalized to those of GAPDH, and expression differences were calculated according to the standard curve and efficiency (E) established for each primer set 2^-ΔΔCT formula. Primers used are listed in Table 1.

Table 1.

Sequences of forward and reverse primers used for real time quantitative PCR analyses.

Primer Sequence  
TNF-α Forward
Reverse
AGGGTCTGGGCCATAGAACT
CCACCACGCTCTTCTGTCTAC
IL-6 Forward
Reverse
AGACTTCCATCCAGTTGCCT
CATTTCCACGATTTCCCAGAGA’
NF-κB Forward
Reverse
AGCCACAGAGATGGAGGAGTTG
GGATGTCAGCACCAGCCTTTAG
Sirt1 Forward
Reverse
AGCTCCTTGGAGACTGCGAT’
ATGAAGAGGTGTTGGTGGCA

2.6. Statistical analysis

All the data generated from the research were presented as the mean ± standard deviation (SD). The values obtained were examined statistically using one-way analysis of variance (ANOVA) to confirm statistical differences between the means of each group. Tukey’s test was performed to determine the significance of the difference in means. All graphs were plotted using GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, U.S.A.).

3. Results

3.1. Effect of MET + VPS on renal inflammatory genes expression

3.1.1. Renal TNF-α expression

TNF-α levels were significantly (p < 0.001) elevated in the diabetic control group, whereas these elevated levels were remarkably decreased in diabetic groups treated with VPS at doses of 10, 20, and 40 mg/kg of body weight (p < 0.05, p < 0.001, and p < 0.001, respectively) (Figure 1(a)). Administration of MET, 200 mg/kg/day, p.o for 4 weeks) significantly diminished renal TNF-α expression in treated animals compared to VPS (10 and 20 mg/kg) (p < 0.001) in a dose-dependent manner. Meanwhile, the effect of the treatment with MET (200 mg/kg) + VPS (40 mg/kg) in combination on TNF-α expression was significantly decreased compared to the treatment with either dose of VPS alone (10, 20, and 40 mg/kg, p < 0.001).

Figure 1.

Figure 1.

Effect of MET + VPS on renal levels of inflammatory genes expression in diabetic mice. (a) Effect of MET + VPS on TNF-α expression, (b) effect of MET + VPS on IL-6 expression, (c) effect of MET + VPS on NF-kB expression, (d) effect of MET + VPS on Sirt1 expression.

Data are presented as mean ± SD (n = 10). ***(P< 0.001) vs. control group. ###(P< 0.001) vs. diabetic group. $$$(P< 0.001) vs. diabetic group + VPS10. €€€(P< 0.001) vs. diabetic group + VPS20. ¥¥¥(P< 0.001) vs. diabetic group + VPS40.

3.1.2. Renal IL-6 expression

The renal IL-6 expression levels in diabetic mice increased post administration of alloxan compared to the normal control group (p < 0.001, Figure 1(b)). The effect of the combination of MET and MET + VPS 40 on IL-6 expression levels was significant (p < 0.001) compared to treatment with either of the three doses of VPS.

3.1.3. Renal NF-kB expression

Administration of VPS (10, 20, and 40 mg/kg/day, p.o for 4 weeks) significantly diminished renal NF-kB expression in treated animals compared to the diabetic group (p < 0.001) in a dose-dependent manner. Meanwhile, the expression of NF-kB genes in the mice treated with MET (200 mg/kg/day) was significantly lower than that in the mice treated with VPS 10 and 20 (p < 0.001, Figure 1(c)). A significant decrease in NF-kB expression was observed upon administration of MET (200 mg/kg/day) + VPS 40 for four consecutive weeks when compared to the diabetic group in combination with VPS 40 (see Figure 1(c), p < 0.001).

3.1.4. Renal Sirt1 expression

Sirt1 expression levels in the kidneys of diabetic mice decreased post administration of alloxan compared to the normal control group (p < 0.001, Figure 1(d)). The effect of treatment with MET and its combination with VPS40 was more significant (p < 0.001) potent in increasing Sirt1 as compared to each of the three doses of VPS40 alone. Administration of VPS (10, 20, and 40 mg/kg/day, p.o for 4 weeks) significantly increased renal Sirt1 expression in treated animals compared to that in the diabetic group (p < 0.05).

3.2. Immunohistochemical studies

Photomicrographs of immunohistochemical staining of the control and mice treated with MET and VPS was shown in Figure 2, Apoptosis was significantly higher in the diabetic group than in the normal group (Figure 1(a), control against 1B, diabetic for Bax and caspase3) (Figure 2(a) Control group against; (b) diabetic for Bcl2), As seen in diabetic group, expression of BAX and Caspase3 increased but expression of Bcl2 as antiapototic protein decreased. However, compared to the diabetic nephropathy group, apoptosis in the MET+VPS group was reduced following VPS treatment (Figures 1(e) and 2(e) compared with 1(c) and 2(c)). Notably, apoptosis was predominantly concentrated in renal tubules (Figures 1(d) and 2(d)). Compared to the control group, the expression of Bax and cleaved caspase‑3 was enhanced in the diabetic nephropathy group, while the expression of Bcl‑2 protein was decreased. In contrast, compared with the diabetic nephropathy group, the expression of Bax and cleaved caspase‑3 was reduced in the MET+VPS group(1E), whereas the expression of Bcl‑2 was enhanced (2E). These results suggest that VPS combined with MET can reduce apoptosis in renal tissues. Also semiquantitative assay for apoptosis has shown in Figure 3.

Figure 2.

Figure 2.

Photomicrographs of immunohistochemical staining of the control and mice treated with MET and VPS (H&E; 400X). (1) Caspase & Bax, (2) Bcl2. (a) Control; (b) Diabetic group; (c) MET; (d) VPS; (e) MET & VPS.

*The figure is related to one sample out of three examined in each group (n = 1 per experimental group).

Figure 3.

Figure 3.

Results of apoptosis assay by non-parametric Fisher’s exact test between treatment groups SV (sodium valproate).

**: Significant compared with diabetic group P < 0.05

***: Significant compared with diabetic group P < 0.01.

4. Discussion

Diabetic nephropathy (DN) is a secondary kidney disease associated with diabetes. Renal complications are common in diabetic patients. Approximately half of patients with diabetes show signs of kidney damage during their lifetime. Renal involvement is a serious complication that can lead to a reduction in length and quality of life. In this context, type 1 diabetes, a mouse alloxan-induced diabetes model, was used in the present study to investigate the pathogenesis of diabetic nephropathy. Alloxan and STZ are widely used to induce diabetes in vitro in animal models and to evaluate the ant diabetic potential or capacity of compounds in a wide range of animals. Notably, alloxan is far less expensive and more readily available than STZ. The alloxan-diabetic animal, as a model of reactive oxygen species (ROS)-mediated beta-cell toxicity, is a factor that has further implications in understanding the mechanisms of ROS-mediated beta-cell death in both types of diabetes, resulting in hyperglycemia and diabetic complications such as nephropathy [15,16].

As shown in the present study, alloxan caused a significant increase in blood glucose levels and decreased islet size, necrotic changes in islet cells, and subsequent renal damage, which was also marked by severe glomerular congestion, tubular necrosis, and intertubular hemorrhage. These results were in accordance with [17], who reported glomerular tufts, intertubular hyperemia, and degenerative changes in the epithelial cells lining the renal tubules in STZ-induced diabetic rats. The immune-histochemically detected pro-inflammatory cytokine, TNF-α, and apoptotic mediators, Bax and caspase-3, were remarkably decreased in the kidneys of diabetic mice as a result of anti-diabetic treatment, while the expression of anti-apoptotic protein Bcl-2 was increased.

The current study included administration of VPS and MET to alloxan-treated mice at three different doses, that is, low-dose 10 mg/kg/day, medium-dose 20 mg/kg/day, and high-dose 40 mg/kg/day, p.o. for 4 consecutive weeks. Previous studies have shown that numerous factors, including excess nutrients and free fatty acids, high glucose, and ROS formation in diabetic conditions can cause activation of protein kinase C, mitogen-activated protein kinase, transcription factor NF-ĸB, endoplasmic reticulum stress, and initiate pro-apoptotic pathways that induce apoptosis and renal tissue damage [18,19].

Metformin treatment stimulates AMP-activated protein kinase phosphorylation and subsequently reduces mTOR signaling in acute kidney problems. This augments autophagy and prevents renal cells from undergoing fibrosis, hypertrophy, epithelial-mesenchymal transition, and apoptosis. VPS is also a histone deacetylation enzyme inhibitor that increases histone acetylation and promotes gene transcription. It has been proposed that these two drugs can be used to treat kidney patients. However, the therapeutic mechanisms involved remain unclear [11,14].

In addition to the role of oxidative stress in the induction of nephropathy, inflammation and apoptosis may also play important roles in kidney dysfunction and histological deterioration. Alloxan-induced diabetic mice in the present study exhibited a remarkable increase in the expression of the pro-inflammatory cytokines TNF-α and caspase-3, as well as a decrease in the anti-apoptotic markers Bcl-2 and sirt1. These results are in agreement with a previous study by Pradeep and Srinivasan [20], who demonstrated that STZ-induced diabetic rats with the simultaneous increase in advanced glycation end products, NF-kB, Cyclooxygenase-2, cytokines, and Bcl2 leads to an increase in the risk of diabetic nephropathy. Therefore, it seems that these alloxans and STZ not only affect the AGE-RAGE pathway, but also lead to a cascade attenuation of the NF-κB and TGF-β1 signaling pathways (apoptosis), which ultimately leads to the attenuation of hyperglycemia-induced renal damage. Consequently, renal TNF-α, NF-κB, and IL-6 in the present study showed increased expression in diabetic kidneys and decreased expression in diabetic mice treated with MET and/or VPS, reflecting the anti-inflammatory effect of these drugs. The effect of MET and VPS in combination was significantly potent when compared with groups treated with each of these medicinal compounds alone.

Donate-Correa et al. (2020) focused on the pathogenesis of pro-inflammatory molecules and mechanisms related to the development and progression of diabetic nephropathy and discussed the potential utility of new strategies based on agents that target inflammation. They stated that future therapeutic approaches with the ability to modulate inflammatory processes could be useful in the prevention or treatment of diabetic nephropathy. These incoming therapies focus on the modulation of inflammatory pathways, including inflammatory cytokines, oxidative stress, and NF-κB expression [21].

Izquierdo et al. (2012) found that after paricalcitol treatment of patients with renal disease, levels of the inflammatory markers CRP, TNF-α, IL-6, and IL-18 were significantly reduced in serum, and the level of anti-inflammatory cytokine IL-10 was increased. They stated that the activation of NF-κB caused by the increase in ROS is essential for the subsequent expression of pro-inflammatory cytokines, such as TNF-α [22].

As mentioned above, the present study indicated that the expression of Bax and caspase-3 was remarkably increased in diabetic mice and decreased as a result of treatment with MET and/or VPS. The effect of MET alone and MET concomitant with VPS seemed to be more potent in decreasing the expression of Bax and caspase-3 than the effect of each alone. Moreover, the combined effect of the two drugs was significant compared to the group treated with VPS alone. Renal expression of the anti-apoptotic protein Bcl-2 exhibited a reverse pattern of changes with Bax and caspase-3. Treatment with a combination of MET and VPS was the most effective in increasing Bcl-2 expression. These observations indicated a protective effect of MET and VPS on alloxan-induced renal apoptosis, probably by modifying the expression of Bax, Bcl-2 family proteins, and caspase-3. VPS treatment alters Bcl2 expression and inhibits caspase-3 activation, which may be a protective mechanism against apoptosis in injured renal cells [23]. A similar result was observed in a previous study conducted on STZ-treated mice [24]. Other studies conducted on alloxan-induced diabetic rats treated with VPS reported glucose-lowering, antihyperlipidemic, and antioxidant effects [25].

In a study by Pang et al. on culture medium containing interstitial fibroblasts from rat kidney tissue, it was determined that histone deacetylase (HDACi) may show antifibrotic properties by inactivating these fibroblasts [26].

In a study by Marumo et al. on C57BL/6J male mice, trichostatin A was shown to improve interstitial tubular damage of kidney tissue caused by ureteral obstruction by reducing macrophage infiltration and fibrotic changes [27].

In a study conducted by Cosentino et al. on zebrafish larvae and laboratory mice, the administration of phenylthio (a type of HDACi) within 24–48 h after the induction of acute kidney injury caused rapid recovery and decreased tubular atrophy. Interstitial fibrosis occurs after injury and recovery [28].

Liu et al. indicated the involvement of HDAC class I in fibrogenesis and the activation of renal fibroblasts through the modulation of TGF-β signaling [29]. In their study on male mice, Liu et al. showed that silencing HDAC reduced glomerulosclerosis, inflammatory cytokine release, podocyte apoptosis, and kidney damage [30].

In an in vivo experiment, Dong et al. reported the activation of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) by inhibiting HDAC [31].

In a study conducted on sodium valproate and diabetic nephropathy in rats in 2016 by XIN-YI SUN, it was stated that endoplasmic reticulum stress is an important mechanism for the pathogenesis of diabetic nephropathy, and changes in histone acetylation can affect the transcription of genes that affect endoplasmic reticulum stress. have a role. Sodium valproate, a nonselective inhibitor of histone deacetylase, can play an inhibitory role in kidney tissue by increasing the expression of glucose-regulated protein (GRP78), decreasing the expression of C/EBP-homologous protein (CHOP), and reducing DNA damage by genes. 153 and caspase 12, as well as upregulation of histone H4 acetylation in the promoter of GRP78… in the diabetic nephropathy model in rats [32].

5. Conclusions

Based on these effects, VPS in combination with MET seems to be a pleiotropic agent with multiple mechanisms of action and protective effects against damage caused by diabetic nephropathy.

The study concluded that VPS and/or MET potentially protect against alloxan-induced DN, probably via their ability to improve the diabetic condition, and decrease apoptosis by attenuating the renal expression of Bax and caspase-3, cytokine and chemokine gene expression, and enhancing the expression of Bcl-2 and anti-inflammatory responses.

The synergistic protective effects of MET and VPS were completely dependent on the expression of inflammatory genes, and the expression of genes such as Sirt1 and Bcl-2caused effective protection on kidney function. Our findings demonstrate that VPS in combination with MET may be useful in treatment of renal nephropathy in animal model but. further studies should be conducted in this field in the future.

Acknowledgments

The authors appreciate the financial and technical support provided by the Department of Pharmacy at Mazandaran University of Medical Sciences. All the authors contributed to the conception and design of the study. Material preparation, data collection, and analysis were performed by Parisa Saberi-Hasanabadi and Dr. Ramin Ataee as supervisors and designers of the project, Hossein Ghalhenoi and Seyed Mohammad Reza Sayedi Moqadam collaborated and led the PCR experiment, Roghayeh Jahani as the toxicological consulter, Fereshteh Talebpour Amiri, as a pathological experiment designer and director, and Sepideh Saberi. as technical lab specialists collaborate in biochemical experiments. All authors have read and approved the final manuscript.

Funding Statement

This work was supported by a grant from the Mazandaran University of Medical Sciences (grant number 1396).

Ethics approval

Animal experimentation protocols were conducted in accordance with the recommendations of the Mazandaran University of Medical Sciences Animal Ethical Committee (Code: IR.MAZUMS.4. REC.1397.1396).

Disclosure statement

The authors (s) declare that there are no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

References

  • 1.Sagoo MK, Gnudi L.. Diabetic nephropathy: an overview. Diabetic Nephro Methods Protocols. 2020:3–7. [DOI] [PubMed] [Google Scholar]
  • 2.Rahimi Z. The role of renin angiotensin aldosterone system genes in diabetic nephropathy. Can J Diabetes. 2016;40(2):178–183. doi: 10.1016/j.jcjd.2015.08.016. [DOI] [PubMed] [Google Scholar]
  • 3.Allan M, McCafferty K, Sheaff M, et al. Identification and management of diabetic nephropathy. Medicine (Baltimore). 2023;51(4):262–268. doi: 10.1016/j.mpmed.2023.01.005. [DOI] [Google Scholar]
  • 4.Naaman SC, Bakris GL.. Diabetic nephropathy: update on pillars of therapy slowing progression. Diabetes Care. 2023;46(9):1574–1586. doi: 10.2337/dci23-0030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang L, Cao W.. Histone deacetylase 3 (HDAC3) as an important epigenetic regulator of kidney diseases. J Mol Med (Berl). 2022;100(1):43–51. doi: 10.1007/s00109-021-02141-8. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang L, Miao R, Yu T, et al. Comparative effectiveness of traditional Chinese medicine and angiotensin converting enzyme inhibitors, angiotensin receptor blockers, and sodium glucose cotransporter inhibitors in patients with diabetic kidney disease: a systematic review and network meta-analysis. Pharmacol Res. 2022;177:106111. doi: 10.1016/j.phrs.2022.106111. [DOI] [PubMed] [Google Scholar]
  • 7.Liu H, Wang Q, Shi G, et al. Emodin ameliorates renal damage and podocyte injury in a rat model of diabetic nephropathy via regulating AMPK/mTOR-mediated autophagy signaling pathway. Diabetes Metab Syndr Obes. 2021;14:1253–1266. doi: 10.2147/DMSO.S299375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Khan S, Jena G, Tikoo K.. Sodium valproate ameliorates diabetes-induced fibrosis and renal damage by the inhibition of histone deacetylases in diabetic rat. Exp Mol Pathol. 2015;98(2):230–239. doi: 10.1016/j.yexmp.2015.01.003. [DOI] [PubMed] [Google Scholar]
  • 9.Esmaeeli H. The renoprotective effects of sodium valproate as a histone deacetylase inhibitor on diabetic nephropathy. Regulation. 2020;7:9. [Google Scholar]
  • 10.Ramu G, Gayathri C.. Comparative efficacy of ACE inhibitors and ARBS in managing microalbuminuria in diabetic nephropathy: a clinical study. Romanian J Diab Nut Metabol Dis. 2023;30(4):717–725. [Google Scholar]
  • 11.Advani A, Huang Q, Thai K, et al. Long-term administration of the histone deacetylase inhibitor vorinostat attenuates renal injury in experimental diabetes through an endothelial nitric oxide synthase-dependent mechanism. Am J Pathol. 2011;178(5):2205–2214. doi: 10.1016/j.ajpath.2011.01.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Corremans R, Vervaet BA, Dams G, et al. Metformin and canagliflozin are equally renoprotective in diabetic kidney disease but have no synergistic effect. Int J Mol Sci. 2023;24(10):9043. doi: 10.3390/ijms24109043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Alhaider AA, Korashy HM, Sayed-Ahmed MM, et al. Metformin attenuates streptozotocin-induced diabetic nephropathy in rats through modulation of oxidative stress genes expression. Chem Biol Interact. 2011;192(3):233–242. doi: 10.1016/j.cbi.2011.03.014. [DOI] [PubMed] [Google Scholar]
  • 14.Eisenreich A, Leppert U.. Update on the protective renal effects of metformin in diabetic nephropathy. Curr Med Chem. 2017;24(31):3397–3412. doi: 10.2174/0929867324666170404143102. [DOI] [PubMed] [Google Scholar]
  • 15.Gross JL, De Azevedo MJ, Silveiro SP, et al. Diabetic nephropathy: diagnosis, prevention, and treatment. Diabetes Care. 2005;28(1):164–176. doi: 10.2337/diacare.28.1.164. [DOI] [PubMed] [Google Scholar]
  • 16.Lenzen S. The mechanisms of alloxan-and streptozotocin-induced diabetes. Diabetologia. 2008;51(2):216–226. doi: 10.1007/s00125-007-0886-7. [DOI] [PubMed] [Google Scholar]
  • 17.Ahmed OM. Histopathological and biochemical evaluation of liver and kidney lesions in streptozotocin diabetic rats treated with glimepiride and various plant extracts. J Union Arab Biol A. 2001;16:585–625. [Google Scholar]
  • 18.Shen J, Dai Z, Li Y, et al. TLR9 regulates NLRP3 inflammasome activation via the NF-kB signaling pathway in diabetic nephropathy. Diabetol Metab Syndr. 2022;14(1):26. doi: 10.1186/s13098-021-00780-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Fang L, Li X, Luo Y, et al. Autophagy inhibition induces podocyte apoptosis by activating the pro-apoptotic pathway of endoplasmic reticulum stress. Exp Cell Res. 2014;322(2):290–301. doi: 10.1016/j.yexcr.2014.01.001. [DOI] [PubMed] [Google Scholar]
  • 20.Pradeep SR, Srinivasan K.. Alleviation of oxidative stress-mediated nephropathy by dietary fenugreek (Trigonella foenum-graecum) seeds and onion (Allium cepa) in streptozotocin-induced diabetic rats. Food Funct. 2018;9(1):134–148. doi: 10.1039/c7fo01044c. [DOI] [PubMed] [Google Scholar]
  • 21.Donate-Correa J, Luis-Rodríguez D, Martín-Núñez E, et al. Inflammatory targets in diabetic nephropathy. J Clin Med. 2020;9(2):458. doi: 10.3390/jcm9020458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Izquierdo MJ, Cavia M, Muñiz P, et al. Paricalcitol reduces oxidative stress and inflammation in hemodialysis patients. BMC Nephrol. 2012;13(1):159. doi: 10.1186/1471-2369-13-159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Singh D, Gupta S, Verma I, et al. Hidden pharmacological activities of valproic acid: a new insight. Biomed Pharmacother. 2021;142:112021. doi: 10.1016/j.biopha.2021.112021. [DOI] [PubMed] [Google Scholar]
  • 24.Akindele AJ, Otuguor E, Singh D, et al. Hypoglycemic, antilipidemic and antioxidant effects of valproic acid in alloxan-induced diabetic rats. Eur J Pharmacol. 2015;762:174–183. doi: 10.1016/j.ejphar.2015.05.044. [DOI] [PubMed] [Google Scholar]
  • 25.Igunnu A, Omotehinse A, David OS, et al. Valproic acid displays anti-diabetic and pro-antioxidant effects in high-fat diet and streptozotocin-induced type 2 diabetic rats. Nig J Pure Appl Sci. 2019;32(1). [Google Scholar]
  • 26.Pang M, Kothapally J, Mao H, et al. Inhibition of histone deacetylase activity attenuates renal fibroblast activation and interstitial fibrosis in obstructive nephropathy. Am J Physiol Renal Physiol. 2009;297(4):F996–F1005. doi: 10.1152/ajprenal.00282.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Marumo T, Hishikawa K, Yoshikawa M, et al. Histone deacetylase modulates the proinflammatory and-fibrotic changes in tubulointerstitial injury. Am J Physiol Renal Physiol. 2010;298(1):F133–F141. doi: 10.1152/ajprenal.00400.2009. [DOI] [PubMed] [Google Scholar]
  • 28.Cosentino CC, Skrypnyk NI, Brilli LL, et al. Histone deacetylase inhibitor enhances recovery after AKI. J Am Soc Nephrol. 2013;24(6):943–953. doi: 10.1681/ASN.2012111055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu N, He S, Ma L, et al. Blocking the class I histone deacetylase ameliorates renal fibrosis and inhibits renal fibroblast activation via modulating TGF-beta and EGFR signaling. PLoS One. 2013;8(1):e54001. doi: 10.1371/journal.pone.0054001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu F, Zong M, Wen X, et al. Silencing of histone deacetylase 9 expression in podocytes attenuates kidney injury in diabetic nephropathy. Sci Rep. 2016;6:33676. doi: 10.1038/srep33676. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 31.Dong W, Jia Y, Liu X, et al. Sodium butyrate activates NRF2 to ameliorate diabetic nephropathy possibly via inhibition of HDAC. J Endocrinol. 2017;232(1):71–83. doi: 10.1530/JOE-16-0322. [DOI] [PubMed] [Google Scholar]
  • 32.Sun XY1, Qin HJ2, Zhang Z3, et al. Valproate attenuates diabetic nephropathy through inhibition of endoplasmic reticulum stress‑induced apoptosis. Mol Med Rep. 2016;13(1):661–668. doi: 10.3892/mmr.2015.4580. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Renal Failure are provided here courtesy of Taylor & Francis

RESOURCES