Reverse genetics study disclaims the role of African swine fever virus gene I196L in the pathogenesis in pigs

Abstract

African swine fever virus (ASFV) genome encodes over 170 genes, but only a small number have been investigated for their roles in disease progression. Understanding the genetic and biological functions of these lesser-known genes accelerates the specification of open reading frames involved in pathogenesis in host animals and the development of ASF vaccines. In this study, we deleted the I196L gene of the highly virulent parental strain AQS-C-1-22 to generate the ASFV mutant AQSΔI196L. In vitro, AQSΔI196L replicated similarly to the parental virus in immortalized porcine kidney macrophage cultures. Pigs intramuscularly inoculated with 10² median tissue culture infectious dose (TCID₅₀) AQSΔI196L developed similar clinical signs and consequences (e.g., high fever, anorexia, and death) as infections with the parental strain. However, viremia in AQSΔI196L-inoculated pigs was slightly reduced compared with pigs inoculated with the parental strain. These findings suggest that the I196L gene does not significantly affect the pathogenicity of the virus in pigs.

INTRODUCTION

African swine fever virus (ASFV) causes African swine fever (ASF), a fatal infectious disease in pigs and wild boars. ASFV belongs to the genus Asfivirus of the family Asfarviridae and is classified in the nucleocytoplasmic large double-stranded DNA virus group. Its genome is approximately 190 kilobase pairs, encoding over 170 genes [7]. ASFVs are classified into 23 genotypes based on partial nucleotide sequence of B646L gene [11, 21].

ASFV originated in Africa and circulates among African wild Suidae species, such as warthogs and river hogs, and Argasidae ticks of the genus Ornithodoros in wildlife. Around the 1960s, genotype I ASFV invaded Europe, spread to Latin America, and caused extensive damage. By the mid-1990s, it had been successfully eradicated in most areas except Sardinia, Italy. In 2007, genotype II ASFV emerged in Georgia and subsequently spread to the Caucasus region, Russia, Eastern and Central Europe, and Asia, causing significant economic losses to the pig industry [3, 4, 6, 8, 28].

Due to the lack of measures to completely prevent the spread of ASF, enormous efforts and substantial resources have been dedicated to developing effective vaccines against this disease. Live attenuated vaccines are considered the most promising type of vaccine, as they induce robust protective immunity in pigs. There are two types of live attenuated vaccines: one consists of genetically modified viruses produced through artificial genome editing technologies, and the other comprises naturally attenuated viruses obtained through serial passages in infected animals or cell cultures [2, 10, 15]. Recently, three attenuated strains have been licensed and are now being used to control the spread of ASF in a limited number of countries. However, concerns remain regarding reversion to virulence and unintended transmission of vaccine strains [2, 5, 20]. As a result, a safe and effective vaccine candidate is still lacking. Therefore, it is increasingly important to identify additional target genes suitable for the development of live attenuated vaccines against ASF.

According to previous studies, highly conserved genes such as I177L and A137R have been suggested to be suitable targets for vaccine development [2, 10]. This implies that a high level of conservation is one of the important factors in selecting target genes. Based on this finding, in this study, we focused on the highly conserved uncharacterized viral gene I196L, which is expressed during late-stage ASFV infection in vitro [17, 27]. To explore the function of the I196L gene, we established an I196L gene-deleted mutant (AQSΔI196L) by genetic manipulation of AQS-C-1-22, an ASFV genotype II strain, and studied its replication potential in cell cultures and pathogenesis in pigs.

MATERIALS AND METHODS

Cells and viruses

The highly virulent ASFV strain AQS-C-1-22 (genotype II) was initially isolated from an illegally imported pork product from China seized by the Animal Quarantine Service of Japan [12]. We routinely propagated AQS-C-1-22 in immortalized porcine kidney macrophages (IPKM) [18] maintained in high-glucose Dulbecco Modified Eagle Medium (Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum, 10 μg/mL bovine insulin (Sigma, St. Louis, MO, USA), 25 μM monothioglycerol (Wako, Osaka, Japan), and antibiotics suspension (Sumitomo Bakelite Co., Tokyo, Japan) at 37°C under an atmosphere of 5% CO₂. All experiments in this study were performed in the biosafety level 3 facility of an institute accredited by the national authority of Japan.

Generation of the recombinant virus

We generated I196L gene-deleted ASFV (AQSΔI196L) by homologous recombination between the parental ASFV genome and a recombinant vector. We replaced the 290 bp in the middle section of the I196L gene (between positions 176,174–176,464 on the virus genome) with a fluorescent marker gene (AcGFP) sequence combined under the p72 gene promoter. To facilitate this, up- and downstream flanking sequences of the target region were connected to both ends (Fig. 1A). The upstream region consisted of 1,023 bp at positions 175,151–176,173, and the downstream region consisted of 1,000 bp at positions 176,465–177,464. Using the specific primer sets listed in Table 1, the upstream region, p72 gene promoter, AcGFP, and downstream region were amplified and cloned into a pGEM-T Easy Vector in the specified order (pTE-ΔI196L). After the transfection of pTE-ΔI196L into IPKM cells, they were infected with AQS-C-1-22 at a multiplicity of infection (MOI) of 0.1. Viral supernatants were collected when infected cells detached due to the cytopathic effect and were then subjected to plaque purification and limiting dilution to isolate recombinant viruses. The recombinant viral DNA was extracted and checked for target gene replacement using conventional polymerase chain reaction (PCR) with primer sets targeting the I196L and AcGFP genes (Table 1).

Fig. 1.

Genome structure and sequence of AQSΔI196L. (A) AQSΔI196L generation using homologous recombination to insert an AcGFP gene with a p72 promoter in AQS-C-1-22 instead of the I196L gene. (B) Next-generation sequencing of the AQSΔI196L genomes. Blue: coverage when mapped to the parent strain AQS-C-1-22. Arrowhead: I196L gene deletion.

Table 1. The list of primer sets for plasmid generation and recombinant virus isolation checks.

Primer sets for plasmid		Sequences (5ʹ-3ʹ)
Upstream	Forward	taatacgactcactatagggagcattgtctccgtgtaagatagaga
	Reverse	gacttttcctccggcgacccgccagttaaaaatgcgactcaagg
Downstream	Forward	tggatgagctgtacaagtgagttgttgtgggtgaaatagttgtactag
	Reverse	atttaggtgacactatagaaacaacaaagaaccatagccagc
p72 gene promoter	Forward	gggtcgccggaggaaaagtcaaaagg
	Reverse	tcggcgcccttgctcaccatatataatgttataaaaataattt
AcGFP	Forward	atggtgagcaagggcgccga
	Reverse	tcacttgtacagctcatccatgcc
Primer sets for isolation checks		Sequences (5ʹ-3ʹ)
I196L gene	Forward	acagggaaaaaggggattaggttg
	Reverse	gctccatacccatcagtctgga
AcGFP gene	Forward	aagcgcgatcacatgatctacttcg
	Reverse	gctccatacccatcagtctgga

Next-Generation Sequencing

The viral supernatant was centrifuged at 170,000 × g at 4°C for 2 hr, and the pellet was resuspended in 100 µL of phosphate-buffered saline (PBS) and treated with 250 U benzonase nuclease (Merck, Darmstadt, Germany) at 37°C for 1 hr. Then the viral DNA was extracted using a High Pure Viral Nucleic Acid Kit (Roche, Basel, Switzerland), and next-generation sequencing analysis was performed using an iSEQ platform (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol. The viral reads were trimmed using Trimmomatic v0.36.3 [1] and mapped to the reference sequence of the parental AQS-C-1-22 strain using Bowtie2 v2.3.0 [16] on the Galaxy web-based platform [9].

Virus growth assays

IPKM cells were inoculated with AQS-C-1-22 or AQSΔI196L at an MOI of 0.01 and incubated at 37°C for 1 hr. The cells were washed three times with PBS and maintained in fresh medium. The supernatants were collected daily from the IPKM cultures until 5 days post inoculation (dpi), and the viral titers were determined as previously described [18]. The virus titers were presented as the median tissue culture infectious dose (TCID₅₀) value from three independent assays.

Animal experiments

All animal experiments complied with the Regulations on the Care and Use of Laboratory Animals of the National Institute of Animal Health (NIAH, Tsukuba, Japan) of the National Agriculture and Food Research Organization (NARO, Tsukuba, Japan), the Guidelines for Conduct of Animal Experimentation of the Science Council of Japan [13], and the Animal Research: Reporting of In Vivo Experiments (ARRIVE) Guidelines [14]. The Institutional Animal Care and Use Committee (Approval No. R4-I035-NIAH) of NIAH at NARO reviewed and approved the animal experiments.

All pigs received feed and water ad libitum. We observed the pigs daily for clinical signs and welfare disturbances during the experimental period. We used the minimum number of animals in our study and carefully minimized their suffering.

We investigated the pathogenicity of AQSΔI196L using nine healthy (males and females) 8-week-old Landrace, Large White, and Duroc pigs purchased from a commercial pig supplier. All pigs were checked for the absence of ASFV using quantitative PCR (qPCR) [19] and anti-ASFV antibodies using a commercially available kit (ID Screen African Swine Fever Indirect kit, IDvet, Grabels, France) before commencing the experiment. We inoculated four pigs intramuscularly with 10² TCID₅₀ of AQSΔI196L and the remainder with 10² TCID₅₀ of the parental AQS-C-1-22 strain (positive control). We monitored all pigs’ body temperatures and clinical symptoms daily and collected blood samples at the indicated intervals. A humane endpoint was considered when pigs showed markedly reduced activity and lay down, justifying euthanasia on welfare grounds.

Quantitative PCR

We extracted viral DNA from whole blood using a High Pure Viral Nucleic Acid Kit (Roche, Basel, Switzerland). Then, we performed qPCR on the viral DNA as described in our previous report [17].

Sequence alignment

Alignment of ASFV I196L gene Nucleotide sequences from various ASFV strains were collected from the GenBank database. These sequences were aligned using ClustalW in MEGA version 11.0 software [23]. The sequences used in this alignment are as follows: E75 (NC_044958.1), BA71V (NC_001659.2), Lisbon60 (KM262844.1), NHV (NC_044943.1), OURT88/3 (NC_044957.1), 47/Ss/2008 (NC_044955.1), Benin (NC_044956.1), 26544OG10Italy (NC_044947.1), Georgia (NC_044959.2), AQS (LC659087.1), Belgium/Etalle/wb/2018 (MK543947.1), HLJ18 (MK333180.1), China/2018/AnhuiXCGQ (MK128995.1), wbBS01 (MK645909.1), Ken05/Tk1 (NC_044945.1), R35 (MH025920.1), N10 (MH025919.1), Kenya1950 (NC_044944.1), Ken06.Bus (NC_044946.1).

Statistics

We performed all statistical analyses using KaleidaGraph software (Synergy Software, Reading, PA, USA). The data obtained from the viral growth assays were analyzed using two-tailed Student t-test. P-values <0.05 were considered statistically significant.

RESULTS

Conservation of the I196L gene among various ASFV isolates

First, we compared the amino acid sequences of the I196L genes among various field strains of ASFVs of distinct genotypes by multiple sequence alignment using MEGA11 software [23] (Fig. 2). There was a high level of homology among the different ASFVs listed in Fig. 2; the amino acid sequence showed a similarity of 85–99% across the strains of distinct genotypes and almost 100% similarity within both genotypes I and II. Genotypes IX and X showed lower levels of similarity with AQS-C-1-22, ranging from 85% to 92% at the amino acid level.

Fig. 2.

Multiple sequence alignment of the amino acids of the I196L protein in 19 representative ASFV isolates. Dots indicate the amino acid residues that correspond with the obtained consensus sequence. Asterisks (*) indicate conserved amino acid residues among the isolates. Sequence logos indicate the degree of conservation.

Generation and purification of recombinant ASFV by deleting the I196L gene

Next, we attempted to establish a recombinant isolate with a deletion in the I196L gene by modifying the parental virulent strain using standard homologous recombination (Fig. 1A). Whole genome analysis data of the isolated mutant (AQSΔI196L) demonstrated that the genomic sequence was identical to that of the parental AQS-C-1-22 strain, except for the target region substituted with the AcGFP green fluorescent marker gene cassette (Fig. 1B).

Growth kinetics of AQSΔI196L in macrophage cell culture

We evaluated the replication potential of AQSΔI196L in IPKM cells by infecting them with the mutant AQSΔI196L or the parental AQS-C-1-22 strain at an MOI of 0.01. There was a significant difference in the replication rate between AQSΔI196L and the parental strain at 3 dpi, but this was not significant at 4 and 5 dpi (Fig. 3).

Fig. 3.

In vitro growth of AQSΔI196L and parental AQS-C-1-22. Immortalized porcine kidney macrophages (IPKM) cells were inoculated with AQSΔI196L or parental AQS-C-1-22 at a multiplicity of infection (MOI) of 0.01. The supernatants were collected daily until 5 days post inoculation (dpi), and the viral titers were determined. Data are shown as means ± standard deviations for three independent experiments. Asterisks (*) indicate significant differences compared with AQS-C-1-22 (*P<0.01 by two-tailed Student t-test).

AQS∆I196L virulence in pigs

Pigs inoculated with 10² TCID₅₀ of the parental virus (positive control, n=5) showed high fever and typical clinical signs of ASF, such as anorexia and diarrhea, by 5 dpi, and all were dead by 10 dpi. Similarly, all pigs inoculated with 10² TCID₅₀ of AQS∆I196L (n=4) showed high fever (>41°C) and clinical signs, such as anorexia and depression (Fig. 4A), and died by 10 dpi. All parental virus- or AQSΔI196L-inoculated pigs developed splenomegaly and severe hemorrhagic lesions in the celiac lymph nodes.

Fig. 4.

Pathogenicity of AQSΔI196L in pigs. (A) Rectal temperature of pigs inoculated with the parental virus or AQSΔI196L. A temperature >40°C (red line) was defined as fever. (B) Viral copy number in whole blood as determined by quantitative polymerase chain reaction (qPCR). Dotted blue lines: qPCR detection limit. Crosses: dead or euthanized pigs.

In pigs inoculated with the parental virus, viremia started at 4 dpi, and the viral load in the blood showed a sharp increase. In contrast, AQS∆I196L-inoculated pigs exhibited viremia at 2–4 dpi. Interestingly, two of the four AQSΔI196L-inoculated pigs demonstrated a relatively slow elevation of viral gene copies in their blood (Fig. 4B).

DISCUSSION

The functions of most ASFV genes remain elusive [25]. In this study, we focused on the I196L gene, which is widely conserved among ASFVs of various genotypes, suggesting that it plays a vital role in viral activities, such as replication, infection, or pathogenesis. Therefore, we generated an I196L-deficient mutant of ASFV (AQSΔI196L) and analyzed its virological potential using a reverse genetic approach.

The I196L locus overlaps the flanking upstream sequence of I177L, a potent pathogenic element of ASFV. Therefore, we replaced the middle section of I196L and induced a frameshift within the open reading frame (ORF) to avoid unnecessary attenuation by affecting the downstream gene function. Whole genome sequencing of the resultant I196L-deficient mutant strain demonstrated marker gene insertion in the expected position of the target region (Fig. 1A). Deletion of the I196L gene scarcely affected replication activity in vitro and slowly escalating viremia in pigs after inoculation with the mutant strain. It has been reported that the deletion of the I177L gene in ASFV led to drastically decreased replicability in vitro and lowered viremia in vivo compared with the parental virulent virus [2]. Thus, it is likely that the modification in the I196L ORF only exerted a minimal effect on the downstream gene function.

Several research groups have previously generated genetically modified ASFV strains with deletions in genes of unknown function, such as X69R [22], EP296R [24], C84L [26], and I177L [2]. Virulence assessment of these deletion mutants in pigs has demonstrated considerable variation in their pathogenic properties. While the I177L or C84L-deleted virus exhibited distinctly reduced or partially reduced virulence, deletions of X69R or EP296R had minimal impact, suggesting that these genes may have redundant or auxiliary functions in viral pathogenesis in pigs [22]. In the present study, deletion of the I196L gene resulted in slightly reduced viral replication in IPKM cell cultures and moderately attenuated the severity and onset of viremia in experimentally infected pigs. However, similar to the X69R and EP296R deletion mutants, the I196L mutant did not significantly compromise overall viral virulence in the experimental model. These findings indicate that I196L may not be essential for viral virulence under the conditions tested, potentially due to functional redundancy with other viral genes or compensatory mechanisms. Further investigation using additional experimental models and complementation studies is necessary to fully elucidate the role of I196L in ASFV pathogenesis.

In conclusion, our findings demonstrate that I196L, despite its high conservation across ASFV strains, appears to be dispensable for viral replication and pathogenicity under the experimental conditions used in this study. Systematic functional analysis of these poorly characterized ASFV genes is essential for elucidating the viral gene hierarchy and identifying potential candidates for live-attenuated vaccine development. Distinguishing between essential and functionally redundant genes will contribute to our fundamental understanding of ASFV biology and may facilitate the rational design of safe and efficacious ASFV vaccines. Continued research efforts in this area are necessary to develop effective control strategies against this economically devastating disease.

CONFLICT OF INTEREST

The authors declare no conflict of interest.