Development of a Hepatocyte-Specific Temporal Genetic Mouse Model Using Albumin Promoter-Driven FlpER2 Expression

Abstract

Background:

Tissue-specific gene manipulation using Cre/loxP or Flp/frt recombination systems is a cornerstone of genetically engineered mouse models. In this study, we aim to develop a novel hepatocyte-specific, tamoxifen-inducible Flp mouse line.

Methods:

BAC (bacterial artificial chromosome)-Alb(albumin)-FlpER2(estrogen receptor ligan binding domain) was developed by inserting IRES-FlpER2 cDNA between translation stop codon and 3’-UTR of the mouse albumin gene in a bacterial artificial chromosome. Upon tamoxifen induction in mice crossed with reporter lines, Western Blotting, Immunohistochemistry, Immunofluorescence Staining and X-gal Staining (5-Bromo-4-Chloro-3-Indolyl-β-D-galactopyranoside Staining) were used to verify the recombination efficiency and specificity of this mouse model.

Results:

Recombination was highly efficient and specific in hepatocytes, with no recombination detected in intrahepatic cholangiocytes or other organs in this mouse model.

Conclusions:

We generated a new tamoxifen-induced hepatocyte-specific mouse model with highly efficient recombination specifically in hepatocytes, and this model can be used to generate tumor model lines.

Introduction

The liver is a vital organ responsible for metabolic and immune defense functions. Liver-specific genetic manipulation in mouse models offers an ideal approach for studying liver physiology and the pathogenesis of liver diseases¹. A single recombinase system, such as Cre recombinase drive by albumin promoter, is widely used for liver-specific genetic manipulations. However, the complexity of most diseases, which involve multiple genetic changes and diverse cell types, requires a more versatile approach. A dual recombinase system enables the induction of genetic changes in distinct cell types within the same organism. In a previous study, we had generated a novel recombination system mediated by Flp and driven by a full-length albumin (Alb) gene promoter in a bacterial artificial chromosome (BAC-Alb-Flp)². This mouse model expresses active Flp recombinase under the control of albumin promoter, demonstrating highly efficient recombination in both hepatocytes and intrahepatic cholangiocytes due to the albumin promoter’s activity in both lineages during embryogenesis^3,4. Therefore, the BAC-Alb-Flp mediated gene manipulation was neither hepatocyte-specific nor cholangiocyte-specific⁵. This highlights a need for a system that exerts temporal control of target gene expression with cell-type specificity⁶.

The mutant estrogen receptor ligan binding domain (ER2) responds to tamoxifen but not estrogen. CreER2 and FlpER2 fusion proteins are commonly used to control the expression of a gene of interest with tamoxifen treatment^7,8. In the absence of tamoxifen, these fusion proteins remain inactive in the cytosol. In response to tamoxifen administration, they translocate into the nucleus and induce recombination between loxP or frt sites^9,10. Albumin promoter is only active in hepatocytes in adult liver. Alb-CreER2 has been established and widely used to generate temporally controlled somatic mutations selectively and efficiently in hepatocytes^11,12. To establish a versatile dual-recombinase system combining Cre/loxP and Flp/frt, we aimed to develop a new hepatocyte-specific mouse model by expressing FlpER2 in the hepatocytes.

In this study, we generated a new tamoxifen-induced FLP hepatocyte-specific mouse model by inserting a FlpER2 cDNA between translation stop codon and 3’-UTR of the mouse Alb gene in a bacterial artificial chromosome. The BAC-Alb-FlpER2 mice exhibited highly efficient recombination after tamoxifen administration specifically in hepatocytes.

Methods

Generation of BAC-Alb-FlpER2 mice

An IRES-FlpER2-attB-Kanamycin-attP cassette was amplified from a modified pIGCN21 vector¹³ using homologous arms from the mouse albumin gene present in BAC clone RP24–61D6 (purchased from https://bacpacresources.org/). The cassette was inserted between the translation stop codon and the 3’UTR of the Alb gene via recombineering¹⁴. Positive clones were selected through kanamycin resistance, which was later excised using ϕC31 integrase. Validation of Alb-FlpER2 constructs was performed by PCR with the following primers: p1: tgcaaggcacgtacgtttac, p2: gcaaagggtcgctacagacg, p3: ggcaggttcagcgacatc, and p4: ccagctggtgcttgtctgta. The BAC-Alb-FlpER2 insertion site and sequence were verified by DNA sequencing. Alb-FlpER2 transgenic mice were generated via pronuclear injection into fertilized eggs from the inbred C57BL/6J strain, and positive founders were identified through genotyping with primers p1/p2 and p3/p4.

Mice Breeding

Reporter mouse lines R26-frt-STOP-frt-GFPCre (R26-FSF-GFPCre, R26-loxP-STOP-loxP-LacZ (R26) and P53^L/L were acquired from the Jackson Laboratory^15–17. To create Alb-FlpER2/R26-FSF-GFPCre mice, Alb-FlpER2 mice were crossed with R26-FSF-GFPCre mice. These Alb-FlpER2/R26-FSF-GFPCre mice were subsequently bred with R26-loxP-STOP-loxP-LacZ reporter mice to produce Alb-FlpER2/R26-FSF-GFPCre/R26 mice. p53^L/L mice were crossed to generate Alb-FlpER2/R26-FSF-GFPCre/P53^L/L/R26 mice. All mouse strains were maintained in a specific pathogen-free barrier facility at Mayo Clinic in Jacksonville, Florida, under protocols approved by the Mayo Clinic Institutional Animal Care and Use Committee.

RT-PCR and Genotyping

For RT-PCR, total RNA was extracted using TRIzol RNA Isolation Reagents (Invitrogen, Cat. No.: 15596026) and further purified with the RNA easy kit (Qiagen, Cat. No.: 74104). cDNA synthesis was performed using the Reverse Transcription System (Promega, Cat. No.: A3500). Genomic DNA extracted from the liver, lung and pancreas with DNA kit (Qiagen, Cat. No.:80204). For genotyping, mouse tails (1–2 mm) were clipped at 15–18 days of age and incubated with 250 μL of Buffer A (0.05 M NaOH) at 100°C for 15 minutes to prepare crude genomic DNA. After cooling, 25 μL of Buffer B (1 M Tris Base, 0.01 M EDTA, pH 8.0) was added. PCR was carried out using 1.0 μL of cDNA or tail crude DNA extract as the template, 7.5 μL of 2X MangoMix (Meridian Bioscience, Cat. No.: BIO-25034), 0.1 μL each of forward and reverse primers (50 μM), and 6.3 μL of ddH₂O. The following primers were used for detecting the FlpER2, Cre, P53^L/L, P53^Δ/Δ and LacZ genes: FlpER2 forward primer: gtgtccaggtactacgcctacg, FlpER2 reverse primer: aggccaggctgttcttcttag; Cre forward primer: gcctgcattaccggtcgatgcaac, Cre reverse primer: cgtatatcctggcagcgatcgc; P53^L/L forward primer: cacaaaaacaggttaaacccag, P53^L/L reverse primer: agcacatag gaggcagagac; P53^Δ/Δ forward primer: cacaaaaacaggttaaacccag, P53^Δ/Δ reverse primer: gaagacagaaaaggggaggg; LacZ forward primer: atcctctgcatggtcaggtc, LacZ reverse primer: cgtggcctgattcattcc.

Tamoxifen Treatment

Tamoxifen powder (Sigma, H7904) was dissolved in 100% corn oil (Sigma, C8267) to a stock with a concentration of 10 mg/mL, which was stored at −20 °C. 75 mg/kg tamoxifen was used to treat mice by gavage for 5 consecutive days. Tissues were harvested two days after the end of treatment.

Western Blotting

Western blotting was performed as previously described¹⁸. Briefly, mouse tissues were collected and homogenized in an appropriate volume of lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 2.5 mM EGTA, 0.1% Tween-20, 1 mM dithiothreitol, 1 mM NaF, 0.1 mM sodium orthovanadate, 0.1 mM phenylmethylsulfonyl fluoride, 10 mM β-glycerophosphate, 2μg/mL aprotinin, and 5μg/mL leupeptin). The homogenates were sonicated and centrifuged at 14,000 rpm at 4°C for 15 minutes. A total of 50 μg of protein was mixed with loading buffer (62.5 mM Tris-HCl pH 6.8, 2.5% SDS, 0.002% Bromophenol Blue, 0.714 M (5%) β-mercaptoethanol, 10% glycerol), denatured at 95°C for 5 minutes, and then separated by SDS-PAGE. Proteins were transferred onto a nitrocellulose membrane, followed by Ponceau S staining to confirm transfer efficiency. The membrane was washed with PBS and blocked with 5% fat-free milk for 1 hour at room temperature. Primary antibodies, anti-Cre (1:1000, Cat: 69050, Novagen) and anti-LacZ (1:1000, Cat: ab616, Abcam), were incubated with the membrane overnight at 4°C. The membrane was then incubated with a fluorescent dye conjugated secondary antibody for 1 hour at room temperature. Finally, the membrane was scanned using the Odyssey Infrared Imaging System (LI-COR Biotechnology, Lincoln, Nebraska).

Immunohistochemistry

Mice tissues were fixed in 4% paraformaldehyde for 24 hours. The fixed samples were dehydrated in 70%, 80%, 90%, 100% ethanol, made transparent with xylene, embedded in paraffin at 52–54 °C, sectioned at 5 μm, pasted on glass slides, and baked at 50°C overnight. After de-paraffinization and rehydration, the slides were subjected to antigen retrieval in 10 mM sodium citrate buffer for 15 min, then endogenous peroxidase quenching in 3% H₂O₂/PBS for 15 min. The slides were incubated with primary antibodies overnight in a humidified chamber at 4°C. The primary antibody used was anti-Cre antibody (1:3000, Cat: 69050, Novagen) or β-galactosidase (Invitrogen/Life Technologies, A-11132, dilution 1:800). The next day, the primary antibody was discarded, and the secondary antibody (DAKO HRP anti-rabbit Lot 11478723) was added for a 30 min incubation at room temperature. Subsequently, DAB solution was added to develop for 3–10 min, followed by counterstaining with hematoxylin. After counterstaining, the samples were dehydrated, mounted and cover slipped. Images were acquired by Aperio AT2 Digital Pathology Slide Scanners (Leica Biosystem).

Immunofluorescence Staining

Multiplex fluorescence staining (Opal520, Opal 570, and Opal 690) was obtained using a PerkinElmer Opal kit (Catalog # NEL840001KT, Marlborough, MA.) Staining was optimized and performed according to manufacturer’s instructions. Tissue was fixed in 10% formalin, paraffin embedded, cut into 4-mm sections, and put on slides. Slides were heated at 65 °C for 3 h, deparaffinized with series of xylenes, and rehydrated with decreasing concentrations of alcohol followed by formaldehyde fixation. The slides were subjected to antigen retrieval buffer of PH 6 using microwave treatment (MWT) followed by cooling at room temperature. Slides were blocked with blocking agent provided with the kit and incubated for 1 h with primary antibody against Cytokeratin 19 (CK19, Abcam, ab133496, dilution 1:500) in a humidified chamber at room temperature. Opal polymer HRP Ms + Rb (Perkin Elmer, Marlborough, MA) was used as the secondary antibody. CK19 visualization was accomplished using Opal 520 Fluorophore (1:150), after which the slides were placed in target antigen retrieval solution 9 and heated using MWT. The slides were then incubated with Hepatocyte nuclear factor 4-alpha antibody (HNF-4α, Abcam, ab181604, dilution 1:5000) overnight at 4°, followed by the secondary antibody. HNF-4α staining was visualized using Opal 570 Fluorophore (1:150) and the slides were placed in target antigen retrieval solution 9 for MWT, followed by cooling at room temperature. Slides were blocked with blocking agent provided with the kit and incubated with primary antibody against β-galactosidase (Invitrogen/Life Technologies, A-11132, dilution 1:800) for 1h, followed by the secondary antibody. β-galactosidase staining was visualized using Opal 690 Fluorophore (1:150) and the slides were placed in target antigen retrieval solution 6 for MWT to remove unbound antibody. Nuclei were subsequently stained with 4′,6-diamidino-2-phenylindole solution provided with the kit, and the sections were coverslipped using Prolong Gold mounting media (Thermo Fisher Scientific).

X-gal Staining

Frozen tissue sections generated on a cryostat were fixed with 0.2% glutaraldehyde and 2% formaldehyde on ice for 5 minutes, then incubated overnight at 37°C with X-gal staining buffer (1 mg/mL X-gal, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl₂, and 0.02% NP-40). After staining, sections were counterstained with nuclear fast red buffer (1% nuclear fast red, 5% aluminum sulfate) at room temperature for 5 minutes. For whole-mount X-gal staining, tissues were fixed in 0.2% glutaraldehyde and 2% formaldehyde on ice for 30 minutes, rinsed with buffer (PBS containing 0.02% Igepal, 0.01% sodium deoxycholate, 2 mM MgCl₂) at 4°C for 30 minutes, followed by shaking at room temperature for 30 minutes twice. The tissues were then incubated with X-gal staining/rinse buffer (5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 0.5 mg/mL X-gal solution) at 37°C overnight.

RESULTS

Generation of BAC-Alb-FlpER2 mice

To generate a hepatocyte-specific FlpER2 expression system, an IRES-FlpER2-attB-Kanamycin-attP cassette was amplified from a modified pIGCN21 vector using primers with homologous arms from the mouse Alb gene. Recombineering technology was used to integrate this cassette into a BAC (clone RP24–61D6) between the translation stop codon and the 3’-UTR through homologous recombination. Following positive selection with kanamycin, the kanamycin resistance cassette was excised using ϕC31 integrase (Fig. 1A). Transgenic mice were created by pronuclear injection into embryos of inbred C57BL/6J mice. Positive BAC-Alb-FlpER2 founder mice were identified by PCR using target gene primers p1/p2 and p3/p4(Fig. 1B). The presence of the target gene was further verified by Sanger sequencing.

Fig.1.

Generation and validation of Alb-FlpER2 transgenic mice. A: Schematic representation of the Alb-FlpER2 genetic configurations carrying the IRES-FlpER2 constructs in BAC. B: PCR examination in three E. coli clones (#a, #b, and #c) using two pairs of primers, with wild-type E. coli DNA was included as a negative control (NC). BAC, bacterial artificial chromosome; IRES, internal ribosome entry site; PCR, polymerase chain reaction.

Characterization of Alb-FlpER2 Mice

To generate Alb-FlpER2/R26-FSF-GFPCre transgenic mice, Alb-FlpER2 mice were crossed with -R26-FSF-GFPCre reporter mice, which express GFPCre upon Flp-mediated recombination (Fig. 2A). The pups were identified by genotyping using FlpER2 and Cre primers, with 18S rRNA as an internal reference (Fig. 2B). Double transgenic mice were treated with tamoxifen to activate the FlpER2 recombinase. To verify whether the GFPCre fusion protein was expressed specifically in hepatocytes, we harvested liver and pancreas tissues from mice which had been treated with tamoxifen (75 mg/kg) via gavage for 5 consecutive days. Western blot analysis showed that Cre was expressed in the liver, but not in the pancreas of Alb-FlpER2/R26-FSF-GFPCre mice (Fig. 2C). To assess the efficiency of the Alb-FlpER2/R26-FSF-GFPCre recombination system, we performed immunohistochemistry (IHC) for Cre on liver and pancreas samples. The results demonstrated that approximately 100% of hepatocytes were stained for Cre, while intrahepatic ductal cells and pancreatic cells were not (Fig. 2D). Immunofluorescence Staining (IF) staining of the liver confirmed that Cre was specifically expressed in hepatocytes and not in cholangiocytes (Fig. 2E).

Fig.2.

Validation of recombination efficiency and specificity in the Alb-FlpER2 transgenic mice. A: Schematic illustration of GFPCre expression in the Alb-FlpER2/R26-FSF-GFPCre mouse model. B: RT-PCR using FlpER2 specific primers revealed expression of the FlpER2 gene, while the detection of Cre mRNA in the Alb-FlpER2/R26-FSF-GFPCre double transgenic mice indicated successful Flp-mediated recombination. This recombination led to the expression of the Cre gene after tamoxifen treatment. C: Western blot using anti-Cre antibody detected Cre expression in the liver but not in the pancreas after tamoxifen treatment. D. IHC using anti-Cre antibody in Alb-FlpER2/R26-FSF-GFPCre mice showed positive staining in the hepatocytes (black arrow), but negative staining in intrahepatic cholangiocytes (green arrow) and the pancreas after tamoxifen treatment(20X). E. multi-immunofluorescence staining of CK19, HNF-4α, and Cre protein expression in the liver of Alb-FlpER2/R26-FSF-GFPCre mice showed positive staining of CK19 in intrahepatic cholangiocytes(green arrow), positive staining of HNF-4α in hepatocytes(white arrow), positive staining of Cre in hepatocytes (white arrow), and negative staining of Cre in intrahepatic cholangiocytes (green arrow) after tamoxifen treatment (20X).

Conversion of Alb-FlpER2 for Cre Recombination

In Alb-FlpER2/R26-FSF-GFPCre double transgenic mice, R26-FSF-GFPCre expression serves as a reporter and enables the transition from the Flp recombination system to the Cre recombination system. To assess Cre recombination activity, we crossed Alb-FlpER2/R26-FSF-GFPCre mice with the Cre reporter line R26-LSL-LacZ, which expresses β-galactosidase upon Cre-mediated recombination, and generated Alb-FlpER2/R26-FSF-GFPCre/R26 mice (Fig. 3A)¹⁶. Triple transgenic Alb-FlpER2/R26-FSF-GFPCre/LacZ mice were genotyped by PCR using three pairs of primers targeting FlpER2, Cre, and LacZ sequences (Fig. 3B). To determine the tissue-specific expression profile of the reporter genes in Alb-FlpER2/R26-FSF-GFPCre/R26 and Alb-FlpER2/R26-FSF-GFPCre mice, we treated the mice with tamoxifen and analyzed the liver and pancreas tissues via western blot using anti-Cre and anti-β-galactosidase (LacZ) antibodies. The data showed that Cre and β-galactosidase were expressed in the liver but not in pancreas of Alb-FlpER2/R26-FSF-GFPCre/R26 mice. In contrast, Cre expressed in the liver of Alb-FlpER2/R26-FSF-GFPCre mice only with no expression in the pancreas (Fig. 3C). To evaluate the efficiency of hepatocyte-specific expression of β-galactosidase, tissues were stained with IHC (anti-LacZ) and X-gal. Whole-mount X-gal staining further confirmed β-galactosidase expression in the liver but not in the pancreas (Fig. 3D). Scanned images revealed that nearly 100% of hepatocytes were stained, while intrahepatic ductal cells were not (Fig. 4A). Multiple immunofluorescence analyses also demonstrated that almost 100% of hepatocytes were positive for β-galactosidase expression after tamoxifen treatment, whereas intrahepatic cholangiocytes lacked β-galactosidase staining. Multi-immunofluorescence showed HNF-4α (hepatocyte marker) expressed in all hepatocytes, and all HNF-4α-positive cells expressed β-galactosidase. Meanwhile, CK19 (duct-cell marker) was expressed in all intra-cholangiocytes, but none of the CK19-positive cells showed any β-galactosidase staining in the liver of tamoxifen-treated mice (Fig. 4B). This confirms that nearly 100% of hepatocytes expressed β-galactosidase following tamoxifen treatment, with no expression in intrahepatic cholangiocytes.

Fig 3.

Conversion of Flp recombination to Cre recombination using Alb-FlpER2/R26-FSF-GFPCre mice. A: Schematic illustration of LacZ expression in the of Alb-FlpER2/R26-FSF-GFPCre/R26 mouse model. B: RT-PCR was performed using FlpER2, Cre and LacZ-specific primers. C: Cre and LacZ proteins were examined by Western blot in the liver and pancreas. Expression of Cre and LacZ was observed in the liver, but not in the pancreas. D: Whole mount X-gal staining in the liver and pancreas (the black arrow indicates the spleen attached) of Alb-FlpER2/R26-FSF-GFPCre/R26 mice. Positive staining was observed in the liver only after TM treatment.

Fig 4.

Characteristic and utility of Alb-FlpER2/R26-FSF-GFPCre/R26 transgenic mice. A: LacZ expression examined by IHC and X-gal staining in the liver from Alb-FlpER2/R26-FSF-GFPCre/R26 mice showed positive staining in hepatocytes (black arrow) but not in intrahepatic cholangiocytes (red arrow) after tamoxifen treatment(20X). B: Multi-immunofluorescence staining of CK19, HNF-4α, and LacZ protein expression in the liver of Alb-FlpER2/R26-FSF-GFPCre/R26 mice showed positive staining of CK19 in intrahepatic cholangiocytes, positive staining of HNF-4α in hepatocytes, positive staining of LacZ in hepatocytes (green arrow), and negative staining of LacZ in intrahepatic cholangiocytes (white arrow) after tamoxifen treatment (20X). C: Schematic illustration ofp53 deletion in the Alb-FlpER2/R26-FSF-GFPCre/R26 mouse model. B: PCR analysis of liver, lung and pancreas tissues from Alb-FlpER2/R26-FSF-GFPCre/R26 using p53^L/L and p53^Δ/Δ primers, with or without tamoxifen treatment.

Alb-FlpER2/R26-FSF-GFPCre-mediated hepatocyte-specific p53 deletion.

To confirm hepatocyte-specific gene deletion using Alb-FlpER2/ R26-FSF-GFPCre mice, we crossed Alb-FlpER2/ R26-FSF-GFPCre mice with p53^L/L mice (Fig. 4C). Genotyping confirmed the Alb-FlpER2 and p53^L/L genotype. Following TM treatment, PCR analysis using p53^L/L recombination primers (p53^Δ/Δ) demonstrated p53 deletion in the liver, but not in the lung or pancreas (Fig. 4D).

COUCLUSIONS

In this study, we have generated a new transgenic mouse model, designed for tamoxifen-induced FLP-mediated genetic manipulation specifically in hepatocytes. The model demonstrated high recombination efficiency. Notably, BAC-Alb-FlpER2 mice can be combined with other cell-specific Cre systems, allowing for more complex genetic manipulations in liver research.

Compared to the previously developed Alb-CreER2 mice, the BAC-Alb-FlpER2 model offers several key advantages. Like the BAC-Alb-Flp model, the BAC contains the entire Alb gene, including all regulatory elements such as enhancers and introns. Additionally, we precisely inserted the IRES-FlpER2 cassette between the translation stop codon and the 3’-UTR of the Alb gene using recombineering technology, ensuring both specificity and efficiency of transgene expression. The insertion was confirmed by PCR and Sanger sequencing. Our BAC-Alb-FlpER2 mice exhibited remarkably high recombination efficiency and specificity, as demonstrated by FlpER2-mediated R26-FSF-GFPCre and LacZ reporter expression.

The crossbreeding of BAC-Alb-FlpER2 mice with R26-FSF-GFPCre mice not only acted as a gene expression reporting system but also demonstrated its versatility by enabling the switch from the Flp recombination system to the Cre recombination system. The tamoxifen-inducible Alb-FlpER2 could manipulate genes temporally, providing an opportunity for sequential gene manipulation for the hepatocyte lineage of the mice. Further crossbreeding of Alb-FlpER2/R26-FSF-GFPCre mice with loxp-floxed mice allowed for the assessment of Cre-mediated recombination (Fig. 5). The specific expression of Cre and β-galactosidase in the hepatocyte of Alb-FlpER2/R26-FSF-GFPCre/R26 triple transgenic mice confirmed the effective transition between recombination systems. Additionally, hepatocyte-specific p53 deletion further validated the utility of this new transgenic mouse model for hepatocyte-targeted genetic studies.

Fig 5.

Alb-FlpER2/R26-FSF-GFPCre transgenic mice can be used to activate oncogenes and/or delete tumor suppressors for HCCs. In combination with Cre or CreER system that induced by distinct cell-specific promoters, different genes can be targeted in distinct cells specifically.

Liver diseases involve multiple cell types and complex genetic alterations. The BAC-Alb-FlpER2 mouse line, when combined with one or more cell-specific Cre transgenic lines, enables the study of intricate cell-cell interactions that contribute to liver disease in mice. This model provides a powerful tool for investigating specific cell types, such as oval cells. By integrating the BAC-Alb-FlpER2 transgene with other Cre lines targeting distinct cell types, researchers can precisely manipulate different genes within separate cell populations. This unique capability opens new possibilities for exploring cell-cell interactions within the liver. Additionally, the tamoxifen-inducible genetic manipulation allows for the examination of complex genetic interactions and their roles in disease progression and maintenance, providing deeper insights into the molecular mechanisms driving hepatic disorders.

In summary, we generated an inducible FlpER2 recombinase-mediated recombination system driven by the full-length mouse Alb gene in a bacterial artificial chromosome. This system enables efficient, hepatocyte-specific recombination. When paired with the Cre-LoxP system, it offers researchers the flexibility to modify different genes either simultaneously or sequentially in various cell types, providing a powerful tool for liver research.

Impact and implications:

This model can be used to facilitate temporal genetic manipulations of frt-flanked genes specifically in hepatocytes. Additionally, combining this mouse line with other cell-specific Cre recombination lines enables the manipulation of different genes in hepatocytes and other cell types to generate tumor models.

Highlights:

This BAC-Alb-FlpER2 mouse model enables precise, tamoxifen-inducible genetic manipulation in hepatocytes. It enhances versatility when combined with Cre systems for multi-cell-type genetic studies.

Abbreviations

BAC

bacterial artificial chromosome

Alb

albumin

IHC

immunohistochemistry

GFP

Green Fluorescent Protein