Skip to main content
Nature Communications logoLink to Nature Communications
. 2025 Nov 17;16:10060. doi: 10.1038/s41467-025-65012-7

RIOK2 kinase regulates the translocation of the FADD–RIPK1–Caspase-8 complex to the ER and the cleavage of Gasdermin D to drive pyroptosis

Mingtong Ma 1,2,#, Fei Wang 1,2,#, Pengfei Cui 1,2,#, Yingying Zhang 3,#, Hanyu Ma 1,2, Yifan He 1,2, Yuanna Cheng 1,2, Jingping Huang 1,2, Jingxiang Wang 1,2, Xiangyang Wu 1, Hua Yang 1,2, Ruijuan Zheng 1,2, Haowen Ma 4, Qian Cai 4, Lin Wang 1,2,, Baoxue Ge 1,2,5,
PMCID: PMC12623739  PMID: 41249793

Abstract

Macrophage infection by the pathogenic bacteria Yersinia or mimic stimulation of lipopolysaccharide (LPS) and transforming growth factor-β-activated kinase 1 (TAK1) inhibitor or tumor necrosis factor (TNF) and TAK1 inhibitor induces caspase-8-mediated gasdermin D (GSDMD) cleavage and pyroptosis. However, the upstream regulator of caspase-8-dependent cleavage of GSDMD remains elusive. Here we show that Serine/threonine-protein kinase RIO2 (RIOK2) interacts with the Fas-associated protein with death domain (FADD) and is essential for caspase-8-driven GSDMD cleavage. RIOK2’s kinase activity drives the transport of lysosome to ER through activating myosin II and thereby translocate FADD-RIPK1-caspase-8 complex from lysosome to ER. Importantly, RIOK2’s ATPase activity enhances its binding to this complex and directly triggers caspase-8 and gasdermin D cleavage both at ER and in vitro. Furthermore, RIOK2-mediated pyroptosis enhances host defense against Yersinia infection. Thus, our findings define an upstream regulator of caspase-8-dependent pyroptosis, implying a role of organelle crosstalk in spatial cleavage of gasdermins.

Subject terms: Bacterial infection, Membrane trafficking, Cell death


Macrophage infection by Yersinia or specific stimulations trigger caspase-8-mediated GSDMD cleavage. RIOK2 kinase is essential for this process by interacting with FADD and driving the lysosome-to-ER transport of the cell death complex accompanied by GSDMD cleavage, thereby enhancing host defense.

Introduction

Innate immune cells respond to pathogenic infection via inflammation and cell death. Pyroptosis is an inflammatory form of cell death that is typically driven by both the canonical activation of caspase-1 by the inflammasome (NLRP1, NLRP3, NLRC4, AIM2, or pyrin) pathway and non-canonical activation of murine Caspase-11 and its human homologs caspase-4 and −5 by cytosolic sensing of lipopolysaccharide (LPS). The activated inflammatory caspases cleave gasdermin D (GSDMD) at D275 (D276 in mouse) in the cytosol to liberate an N-terminal fragment GSDMD-N14. GSDMD-N then binds preferentially to negatively charged phospholipids, including phosphatidylinositol (PI), phosphates (PIPs), PI(4)P and PI(4,5)P2, and cardiolipin, and oligomerizes to form 10–20 nm pores on the plasma membrane to trigger pyroptosis and facilitate the release of cellular contents511. Activation of inflammasomes also leads to the maturation and release of the inflammatory cytokines interleukin (IL)−1β and IL-18. IL-1β maturation often occurs downstream of the NLRP3 inflammasome that includes apoptosis-associated speck-like protein (ASC) and CASP1, which cleaves pro-IL-1β that lacks a conventional secretion signal, enabling the release of mature IL-1β via GSDMD pores9,12,13.

Activation of NF-κB and mitogen-activated protein kinase (MAPK) signaling cascades downstream of Toll-like receptors (TLRs) leads to the production of pro-inflammatory cytokines that protect the host against pathogens through triggering both innate and adaptive immunity14. However, pathogenic bacteria have evolved multiple strategies to manipulate host innate immune signaling pathways to facilitate their infection. During pathogenic Yersinia infection, the Yersinia effector protein YopJ inhibits the activation of transforming growth factor-β-activated kinase 1 (TAK1), which is critical for host inflammatory and pro-survival signaling15,16. Inhibition of TAK1 by YopJ leads to an alternate pyroptotic pathway mediated by Toll-like receptors (TLRs) or death receptors that form a complex with the adaptor Fas-associated death domain (FADD) and receptor-interacting serine-threonine protein kinase 1 (RIPK1) and caspase-8. This results in the phosphorylation of RIPK1 to drive the activation of caspase-8, and the cleavage of downstream caspases-1, −3, −7, −9, and −1117,18. The activated caspase-8 cleaves GSDMD at Asp276 to trigger pyroptosis17,18. Blockade of TAK1 kinase activity with the specific inhibitor 5z-7-oxozeaenol (5z-7) mimics the effect of YopJ and pathogenic Yersinia infection to cause RIPK1–Caspase-8-dependent GSDMD-mediated pyroptosis in the presence of TLR ligands or tumor necrosis factor-α (TNF-α)1719. Caspase-8–caspase-3 and –caspase-7-mediated activation of apoptotic effectors downstream of Caspase-8 also contributes to overall cell death in response to Yersinia infection, leading to a mixed cell death phenotype with contributions from both pyroptotic and apoptotic pathways.

More recently, the Ragulator–Rag complex has been identified as a lysosomal platform to recruit FADD, RIPK1, and caspase-8, causing the phosphorylation of RIPK1 and activation of Caspase-8, which cleaves GSDMD and induces pyroptosis. Pyroptosis activation was shown to depend on Rag GTPase activity and lysosomal tethering of Rag–Ragulator, but not mTORC120. However, another study revealed that the Ragulator–Rag–mTORC1 complex is not required for GSDMD cleavage upon inflammasome activation, but rather promotes GSDMD oligomerization in the plasma membrane12. Ragulator–Rag promotes the production of reactive oxygen species (ROS), which triggers GSDMD oligomerization, pore formation, and pyroptosis21. N-terminal domain of GSDMD oligomerization and pore-forming activity were found to be defective in macrophages lacking the gene RagA or RagC21. Moreover, Muendlein et al. showed that ZBP1, constitutively bound to RIPK1 via RHIM-mediated interactions, facilitates interactions among caspase-8, FADD, and RIPK1, promoting Caspase-8-mediated cell death and inflammasome activation22.

In the present study, we uncover a critical role of RIOK2 in regulating caspase-8-dependent cleavage of GSDMD. We provide molecular and genetic evidence demonstrating that RIOK2’s kinase activity drives transportation of FADD-RIPK1-caspase-8 complex from lysosome to ER. RIOK2 directly interacts with FADD and promotes the association of RIOK2 with FADD–RIPK1–caspase-8 complex, which thereby directly activates cleavage of caspase-8 and GSDMD both at ER and in vitro.

Results RIOK2 promotes the formation of complex II

By performing immunoprecipitation and mass spectrometry analyses, we found that FADD interacted with RIOK2 (right open reading frame kinase 2, also known as RIO2) in response to TNF/5z-7 (Fig. 1A; Supplementary Fig. 1A; Supplementary Data 1). Other well-known cell death signal molecules including caspase-817,18,20, TRAP123, and GSDMD17,18,20,24 were also identified by this assay, (Fig. 1A; Supplementary Data 1). RIOK2 is an atypical kinase implicated in ribosome maturation and cell cycle progression2528. The interaction between FADD and RIOK2 was further confirmed by co-immunoprecipitation (co-IP) analysis (Supplementary Fig. 1B). IP FADD band size was about 22kD, a little bit lower than ~25 kDa (identical to the light (L) chain). In immortalized bone marrow-derived macrophage (iBMDM) cell lines treated with LPS/5z-7 or infected with Yersinia pseudotuberculosis (Y. pseudotuberculosis), we observed an endogenous interaction between RIOK2 and FADD (Fig. 1B, C). These results suggest that RIOK2 is a FADD-interacting protein.

Fig. 1. RIOK2 promotes the formation of complex II.

Fig. 1

A Schematic diagram of the procedure to identify FADD interaction proteins in HeLa cells overexpression FADD. Proteins identified by mass spectrometry that might interact with FADD in HeLa stimulated with or without TNF-α + 5z-7 for 1 h. The relative levels of each protein were quantified by the ratio of TNF-α + 5z-7/unstimulated control (TNF+5z-7/NC). The data represent three independent biological replicates. B, C Endogenous interaction between FADD and Riok2 in the lysates of iBMDMs treated with LPS (20 ng/ml) or LPS/5z-7(1uM) (B) or infected with Yersinia (C) was immunoprecipitated with anti-Riok2 antibody and analyzed by immunoblot with the indicated antibodies. D Immunoblot and immunoprecipitation of lysates of HEK293T cells transfected with plasmids encoding Flag-RIOK2 or HA-FADD or HA-Caspase-8 or HA-RIPK1. Endogenous interaction between Riok2 and Caspase-8 or RIPK1 in the lysates of iBMDMs treated with LPS or LPS/5z-7 (E) or infected with Yersinia (F) was immunoprecipitated with anti-Riok2 antibody and analyzed by immunoblot with the indicated antibodies. G In vitro precipitation assay of RIOK2 with FADD or Caspase-8 or RIPK1. HJ WT and Riok2−/−, FADD −/− iBMDMs or transfected with control siRNA or siRNA targeting mouse Riok2 for 48 h were treated with LPS/5z-7 for the indicated times. Endogenous FADD complex was immunoprecipitated with anti-FADD antibody and analyzed by immunoblot with the indicated antibodies. All of the immunoblot data are representative images from one of three independent experiments. Source data are provided as a Source Data file.

In the absence of cFLIPL, stimulation of LPS drives the assembly of complex II containing a death domain-containing protein FADD, RIPK1, and Caspase-824. In human embryonic kidney (HEK) 293 T cells, hemagglutinin (HA)-tagged RIPK1 and Caspase-8 were co-expressed with Flag-tagged RIOK2, and co-immunoprecipitation was assessed by anti-HA immunoprecipitation followed by anti-Flag immunoblotting. Co-immunoprecipitation of both RIPK1 and Caspase-8 with RIOK2 was detected (Fig. 1D). Moreover, interaction of endogenous RIPK1 or Caspase-8 with RIOK2 was detected in iBMDMs treated with LPS/5z-7 or infected with Y. pseudotuberculosis (Fig. 1E, F). In an in vitro precipitation assay, purified recombinant Flag-RIOK2 immunoprecipitated with His-FADD or Caspase-8 (Fig. 1G), indicating a direct interaction of RIOK2 with FADD and Caspase-8. RIOK2’s binding with RIPK1 is secondary, and not direct. However, deletion of FADD abrogated the binding of RIOK2 with RIPK1 or Caspase-8 in LPS/5z-7 stimulated iBMDMs (Fig. 1H).

Because RIOK2 interacts with FADD, RIPK1, and Caspase-8 in the cell, we postulated that RIOK2 may affect the stability of FADD–RIPK1–Caspase-8 complex. Consistent with previous reports20,24, in response to LPS/5z-7, but not LPS on its own, FADD immunoprecipitated with RIPK1, proCaspase-8, and the p43 subunit of activated Caspase-8, indicating the formation of a FADD–RIPK1–Caspase-8-containing complex that activated Caspase-8 (Fig. 1I, J). However, knockdown of RIOK2 by siRNA impaired the co-immunoprecipitation of FADD with RIPK1 or Caspase-8 in LPS/5z-7-stimulated macrophages (Fig. 1I and Supplementary Fig. 1C). Furthermore, we used CRISPR–Cas9-mediated gene editing to knock out Riok2 in iBMDMs. Knockout efficiency was verified by immunoblotting (Supplementary Fig. 1D). Similarly, knockout of RIOK2 also inhibited the interaction of FADD with RIPK1 or Caspase-8 in LPS/5z-7-stimulated iBMDMs (Fig. 1J). These results suggest that RIOK2 may promote stability of the FADD–RIPK1–Caspase-8 complex in response to LPS/5z-7.

RIOK2 regulates caspase-8-dependent pyroptosis

The formation of the FADD–RIPK1–Caspase-8 complex usually activates the phosphorylation of RIPK1 to drive the activation of Caspase-8, and the cleavage of GSDMD to trigger pyroptosis17,18. Because RIOK2 promoted stability of the FADD–RIPK1–Caspase-8 complex in response to LPS/5z-7, we next investigated whether RIOK2 participates in caspase-8-dependent pyroptosis. Riok2 floxed mice (Riok2flox/flox) were generated with exons 2 flanked by loxP sites (Supplementary Fig. 2A), and then crossed with LyZ2-IRES-iCre transgenic mice (WT Cre+/+), thus generating Riokflox/flox; LyZ2-IRES-iCre (mRiok2−/−) mice that carried Riok2 gene deletion in myeloid cells. mRiok2−/− mice showed a comparable number of myeloid cells with Riokflox/flox or Lyz2-Cre mice (Supplementary Fig. 2B). However, no detectable RIOK2 protein in BMDMs isolated from mRiok2−/− mice, indicating that LyZ2-IRES-iCre truly deleted Riok2 in vivo (Supplementary Fig. 2C). RNA sequence analysis revealed no significant different of Il1b, Tlr4, Tnfr, Fadd, Ripk1, caspase-8, Gsdmd mRNA level in Riok2 deficient iBMDM or BMDMs (Supplementary Fig. 2D; Supplementary Data 2). Previous study reported that silencing or inhibition the RIOK2 reduces proliferation of leukemic cells27,29, gastric cancer cells and colon cancer cells30, glioblastoma cells31 from 3 to 10 days, while little difference was observed within 2 days27,29. Consistently, similar cell proliferation growth was observed between control and Riok2 deletion BMDMs (Supplementary Fig. 2E, F), iBMDMs (Supplementary Fig. 2G, H) and HeLa cells (Supplementary Fig. 2I, J) in 3 days of cultivation. Considering pyroptosis is a rapid response process that often occurs within 3 hours after stimulation17,18,20,24, Riok2 deficiency caused reduced cellular proliferation may have little impact on pyroptosis in such a short period of time.

Knockdown of Riok2 by specific siRNA in iBMDMs markedly attenuated LPS/5z-7-induced cell death, as assessed by ATP loss (Fig. 2A) and lactate dehydrogenase (LDH) release (Fig. 2B) and MTT assays (Fig. 2C). Consistent with this, RIOK2 RNAi impaired LPS/5z-7- or TNF/5z-7-stimulated RIPK1 phosphorylation, and cleavage of caspase-8 or GSDMD (Fig. 2D, E and Supplementary Fig. 2K, L). Concurrent treatment of wild-type (WT) iBMDMs with LPS/5z-7 resulted in rapid pyroptotic cell death, as assessed by ATP loss (Fig. 2F) or LDH release (Fig. 2H), or MTT assays (Fig. 2G), but RIOK2-deficient iBMDMs were highly resistant to LPS/5z-7-induced pyroptosis. In addition, LPS/5z-7-induced IL-1β and IL-18 release were significantly reduced in Riok2−/− iBMDMs (Fig. 2I, J). Consistent with the findings in BMDMs, BMDMs isolated form mRiok2−/− mice showed much less ATP loss (Fig. 2K), as well as IL-1β and IL-18 release (Fig. 2L, M) in response to LPS/5z-7 stimulation. Caspase-8 maturation and GSDMD cleavage to the p30 and p20 fragments, which were detected by immunoblotting in LPS/5z-7-treated WT iBMDMs, were not detected in the RIOK2-deficient cells (Fig. 2N, O). Caspase-3/7 cleavage, occurring downstream of caspase-8 activation18,24, was blunted by RIOK2 deficiency upon LPS/5z-7 treatment (Supplementary Fig. 2N). LPS/5z-7 caused little Annexin V+ and PI- cells in WT iBMDMs at 2 hours post stimulation, which is consistent with previous report18. However, Riok2−/− iBMDMs showed similar Annexin V+ and PI- cells upon LPS/5z-7 stimulation (Supplementary Fig. 2M). More importantly, in an in vitro assay, addition of RIOK2 were found to directly activate the cleavage of both caspase-8 and GSDMD (Fig. 2P). Taken together, these results suggest that RIOK2 may function as an important regulator of pyroptosis.

Fig. 2. Loss of RIOK2 affects pyroptosis.

Fig. 2

iBMDMs transfected with control siRNA or siRNA targeting mouse Riok2 for 48 h, and treated with LPS or LPS/5z-7. Cell death was assessed and calculated by measuring the ATP level at indicated times (A), LDH release (B), cell viability (C) at 3 hours post stimulation. Immunoblotting of full-length and cleaved products of Caspase-8, p-RIPK1 (D), Gsdmd (E) when treated with LPS or LPS/5z-7 for the indicated times. WT and Riok2−/− iBMDMs were treated with LPS/5z-7 for the indicated times. Cell death was assessed and calculated by measuring the ATP level at indicated times (F), LDH release (H), cell viability (G) at 3 hours post stimulation. IM IL-1β/ IL-18 release was measured by ELISA stimulated with LPS/5z-7 for the indicated times. Immunoblotting of full-length and cleaved products of Caspase-8, p-RIPK1 (N), Gsdmd (O) when treated with LPS or LPS/5z-7 for indicated times. P In vitro cleavage assay of Caspase-8 and GSDMD protein with RIOK2 and FADD with at the present of ATP. QW Incucyte quantification of SytoxGreen+ from BMDM from WT Cre+/+, Riok2flox/flox /Riok2−/− mice cells treated for the indicated times. All of the immunoblot data are representative images from one of three independent experiments. Results in AC, FM, QW reflect the mean ± s.e.m from three independent biological experiments. Two-tailed unpaired Student’s t-test was used. Source data are provided as a Source Data file.

To determine whether RIOK2 was also involved in inflammasome- or inflammatory caspase-mediated pyroptosis, WT or Riok2-deficient BMDMs were stimulated with LPS plus nigericin to activate the NLRP3 inflammasome, LPS plus lethal factor–flagellin fusion protein (LFN-Fla) to activate the NLRC4 inflammasome, or LPS plus Poly(dA:dT) to activate the AIM2 inflammasome (canonical pathway) and pyroptosis. Activation of the canonical inflammasomes caused the relatively similar deaths of WT iBMDMs and RIOK2-deficient iBMDMs (Supplementary Fig. 3A–G). In these experiments, cell death was assessed either by an ATP assay measuring surviving cells or by an LDH assay measuring pyroptosis. GSDMD cleavage, assessed by immunoblotting, correlated with cell death, as expected. Trough IncuCyte analysis, we examined multiple forms of cell death in time-course studies, including LPS+5z-7 or TNF+5z-7 induced alternative pyroptosis (Fig. 2Q, R; Supplementary Fig. 3H–K); LPS+ Nigericin induced canonical pyroptosis (Fig. 2S; Supplementary Fig. 3L); Bcl-2 inhibitor ABT-263 or FasL induced apoptosis (Fig. 2T-U; Supplementary Fig. 3M, N); RSL3 induced ferroptosis (Fig. 2V; Supplementary Fig. 3O) and elesclomol-CuCl2(h) induced cuproptosis (Fig. 2W; Supplementary Fig. 3P). The data showed that deletion of Riok2 blocked LPS+5z-7 induced pyroptosis (Fig. 2Q, R; Supplementary Fig. 3H–K), while has no effects on LPS+ Nigericin caused pyroptosis (Fig. 2S; Supplementary Fig. 3L). These results suggest that RIOK2 may selectively regulate RIPK1–Caspase-8-dependent pyroptosis, but not inflammasome-mediated pyroptosis.

Upon Yersinia infection or LPS/TNF+5z-7 stimulation, FADD, RIPK1, and caspase-8 are recruited to the Rag-Ragulator complex. This leads to caspase-8 activation, which cleaves gasdermin D (GSDMD) and induces pyroptosis20. However, neither Rag-Ragulator deficiency in iBMDMs20 nor Gsdmd knockout (downstream of caspase-8) in BMDMs17,18 completely prevented LPS+5z-7-induced cell death, particularly at later time points (>3 hours post-stimulation). This indicates that the lysosomal caspase-8/GSDMD signaling axis partially contributes to LPS+5z-7-induced cell death. Our data exhibited that Riok2−/− iBMDM (Supplementary Fig. 3H–K) and BMDM (Fig. 2Q, R) were fully protected from cell death over 3 hours post LPS+5z-7 or TNF+5z-7 stimulation, suggesting RIOK2 broadly regulates cell death pathways. Consistent with our hypothesis, compared with control cells, decreased apoptosis, ferroptosis or cuproptosis were detected in Riok2−/− iBMDMs or mRiok2−/− BMDMs after 24 hours post stimulation (Fig. 2T–W; Supplementary Fig. 3M–P). To determine whether RIOK2 mediates cell death by targeting upstream signaling cascades (e.g., TLR4), we examined its role in cytokine production following LPS+5z-7 stimulation. ELISA analysis of supernatants revealed comparable TNF and IL-6 levels in LPS+5z-7-stimulated BMDMs from Riok2flox/flox, WT Cre+/+, or mRiok2−/− mice (Supplementary Fig. 3Q, R). These results demonstrate that RIOK2 does not modulate the TLR4 signaling cascade.

RIOK2 is an ER protein

RIOK2 is incorporated into pre-40S particles in the nucleus, participates in their export through direct binding to the CRM1 exporting, and dissociates from cytoplasmic pre-40S particles to get recycled back into the nucleus3234. Our confocal microscopy analysis revealed that treatment with LPS/5z-7 led to the robust cytoplasmic translocation of RIOK2 in iBMDM cells. Interestingly, RIOK2 was found to predominantly reside in the endoplasmic reticulum (ER), but not in lysosomes, mitochondria, or Golgi of LPS/5z-7-stimulated iBMDM cells (Fig. 3A; Supplementary Fig. 4A). Fractionation analysis also confirmed that RIOK2 was localized to the ER in LPS/5z-7-stimulated iBMDM cells (Fig. 3B). These results suggest that RIOK2 may act as an ER protein.

Fig. 3. ER-tethering RIOK2 facilitates pyroptosis.

Fig. 3

A Representative confocal fluorescence images of LPS or LPS/5z-7–treated iBMDMs for 3 hours co-stained for Riok2 with the indicated organelle markers (LAMP1, lysosomes; KDEL, endoplasmic reticulum; MitoTracker, mitochondria; GM130, Golgi) and DAPI. Scale bars, 2 μm. B Immunoblotting of Riok2, and Fadd in ER fraction from iBMDMs treated with LPS/5z-7 for the indicated times. C Representative confocal fluorescence images of iBMDMs transfected plasmids encoding Flag-RIOK2 or Flag-RIOK2(S3A) and stimulated with LPS/5z-7 for 3 hours, co-stained for Flag-Riok2 with ER markers KDEL and DAPI. Scale bars, 2 μm. D, E WT, Riok2−/−, Riok2−/−+Riok2 or Riok2−/−+Riok2(S3A) iBMDMs were stimulated with LPS/5z-7. Cell death was assessed and calculated by measuring the ATP level at indicated times (D); LDH release (E), cell viability (F) at 3 hours post stimulation. G, H IL-1β/ IL-18 release were measured by ELISA stimulated with LPS/5z-7 for the indicated times. I Representative confocal fluorescence images of LPS/5z-7–treated iBMDMs co-stained for Riok2 with Fadd and DAPI. Scale bars, 1μm. J Endogenous FADD complex was immunoprecipitated with anti-FADD antibody and analyzed by immunoblot with the indicated antibodies. K Representative confocal fluorescence images of WT, Riok2−/−, Riok2−/−+Riok2 or Riok2−/−+Riok2(S3A) iBMDMs stimulated with LPS/5z-7 for 3 h, and co-stained for RIPK1 or Caspase-8 with the endoplasmic reticulum marker KDEL and DAPI. Scale bars, 1 μm. JM Immunoblotting of full-length and cleaved products of Caspase-8, p-RIPK1 (J), Gsdmd (L) in lysates from WT and Riok2−/− iBMDMs transfected with plasmids encoding Riok2 and Riok2(S3A), and then stimulated with LPS or LPS/5z-7. All of the immunoblot data are representative images from one of three independent experiments. Two-tailed unpaired Student’s t-test (DH) were used for statistical analysis. Data are expressed as mean ± (SEM) of 3 independent experiments (DH). n = 3 independent experiments (A, C, I, K) with similar results. Nuclei were stained with DAPI (blue). Source data are provided as a Source Data file.

To further investigate the regulatory mechanism underlying the localization of RIOK2 at ER, we performed large-scale screening of a protein kinase inhibitor compound library to identify the molecules that selectively inhibit the ER localization of RIOK2. From the 1055 compounds screened, we found that NO.172 (GSK461364)35 and NO.311 (MLN0905)36, both of which are Polo-like kinase (PLK) inhibitors, significantly blocked the ER localization of RIOK2, while showing no significant effects on RIOK2 nuclear export (Supplementary Fig. 4B, C). PLK1 is a highly conserved Ser/Thr kinase in eukaryotes and plays a critical role in various aspects of mitosis, such as G2/M transition, spindle formation, chromosome congression, and segregation, as well as cytokinesis3740. It has been shown that human RIOK2 is phosphorylated by PLK1 at Ser335, Ser380, and Ser54841. Although mouse Riok2 Thr335 is not conserved to human RIOK2 Ser335, both of them are Plk1 consensus phosphorylation sites, E/D-X-S/T41 (Supplementary Fig. 4D). To examine whether the phosphorylation of RIOK2 by PLK1 has any effect on its ER localization, we generated human phosphorylated RIOK2 S335A/S380A/S548A triple mutant [RIOK2(S3A)]. Through confocal microscopy analysis, we observed no detectable translocation of RIOK2 (S3A) mutant to ER in LPS/5z-7-stimulated macrophages (Fig. 3C). These results suggest that the ER translocation of RIOK2 may require the phosphorylation of RIOK2 by PLK1 in response to LPS/5z-7 stimulation.

ER-tethering RIOK2 facilitates pyroptosis

ER is an important intracellular organelle that plays a key role in maintaining cellular homeostasis4244. It has been established that the misfolded proteins in the ER can lead to endoplasmic reticulum stress (ERS), which triggers activation of the NLRP3 inflammasome and pyroptosis45,46. Thus, we tested whether ERS could be involved in mediating LPS/5z-7-induced pyroptosis. Upon applying 4-phenylbutyric acid (4-PBA), an ERS inhibitor that interacts with exposed hydrophobic segments of unfolded proteins to reduce ER stress47,48, we found no significant change in LPS/5z-7-induced ATP loss (Supplementary Fig. 4E) or LDH release in macrophages (Supplementary Fig. 4F) or cell viability decrease (Supplementary Fig. 4G). Three transmembrane receptors can activate the unfolded protein response (UPR) on the ER, including inositol-requiring enzyme 1α (IRE1α), pancreatic endoplasmic reticulum kinase (PERK), and activating transcription factor 6 (ATF6), which sense stress in the ER lumen to activate relevant downstream signal transduction pathways and improve the processing capacity of unfolded and misfolded proteins in the ER49,50. To further clarify the involvement of IRE1α, PERK, and ATF6 in caspase-8 dependent pyroptosis, we used IRE1 inhibitor MKC8866, PERK inhibitor Amgen 44, ATF-6 inhibitor Melatonin51,52 in WT and Riok2−/− iBMDMs upon LPS/5z-7 stimulation. However, none of these inhibitors could reduce LPS/5z-7 caused ATP loss and LDH release (Supplementary Fig. 4H, 4I), as well as caspase-8 cleavage (Supplementary Fig. 4J). Thus IRE1α, or PERK, or ATF6 mediated ERS may not be involved in the regulation of caspase-8 dependent pyroptosis. ER is also known as an important intracellular Ca2+ store, and Ca2+ is a universal second messenger that regulates a wide variety of cellular reactions53. However, treatment with bepridil (BPD), a membrane-permeable calcium channel blocker, showed no significant effects on LPS/5z-7-induced pyroptosis (Supplementary Fig. 4E–G). Taken together, these findings suggest that ERS or ER-related calcium may not be involved in the regulation of Caspase-8-dependent pyroptosis.

We next investigated whether and how ER localization of RIOK2 is required for Caspase-8-dependent pyroptosis. Treatment with PLK1 inhibitor significantly blocked pyroptosis, as indicated by ATP loss (Supplementary Fig. 4K) and LDH release (Supplementary Fig. 4L), in LPS/5z-7-stimulated iBMDMs. PLK1 inhibitor also reduced RIPK1 phosphorylation, and Caspase-8 and GSDMD cleavage in response to LPS/5z-7 stimulation (Supplementary Fig. 4M). Consistent with this, LPS/5z-7-induced ATP loss (Fig. 3D) or LDH release (Fig. 3E) or cell viability decrease (Fig. 3F), as well as IL-1β and IL-18 release (Fig. 3G, H) were significantly inhibited in Riok2−/− iBMDMs complemented with RIOK2(S3A), but not with wild-type RIOK2. These results suggest that ER localization of RIOK2 may regulate Caspase-8-dependent pyroptosis.

Given that RIOK2 was localized to the ER, we set out to examine whether ER translocation of RIOK2 promotes stability of the FADD–RIPK1–Caspase-8 complex in response to LPS/5z-7. Indeed, our confocal analysis revealed that RIOK2 co-localized with FADD at the ER (Fig. 3I) in LPS/5z-7-stimulated iBMDM cells. Similarly, fractionation analysis also confirmed that RIOK2 interacted with FADD at ER in LPS/5z-7-stimulated iBMDM cells (Fig. 3B). However, inhibiting the ER translocation of RIOK2 by PLK1 inhibitor eliminated the interaction of FADD with RIPK1 or Caspase-8 (Supplementary Fig. 4N). Consistently, complementation of Riok2−/− iBMDMs with RIOK2 (S3A) mutant, but not with wild-type RIOK2, impaired the formation of FADD–RIPK1–Caspase-8 complex on ER (Fig. 3J, K), and reduced RIPK1 phosphorylation, and cleavage of Caspase-8 or GSDMD, in response to LPS/5z-7 stimulation (Fig. 3L, M). These results suggest that ER tethering RIOK2 may drive recruitment of the FADD–RIPK1–Caspase-8 complex to ER, thus triggering Caspase-8-dependent pyroptosis.

RIOK2 drives the transport of lysosomes to ER

It has been shown that Caspase-8 and RIPK1 co-localizes on lysosome in response to LPS/5z-7 stimulation20. Because translocation of RIOK2 to ER drove recruitment and formation of FADD–RIPK1–Caspase-8 complex at ER, we therefore hypothesis that LPS/5z-7 may trigger a translocation of FADD–RIPK1–Caspase-8 complex between lysosome and ER. Indeed, our confocal microscopy analysis revealed a co-localization between lysosome and ER in LPS/5z-7-stimulated macrophages (Fig. 4A, B). Deletion of Riok2 in iBMDMs diminished co-localization of lysosome and ER (Fig. 4C, D), suggesting that RIOK2 may drive transport of lysosome to ER. To investigate whether the existence of FADD–RIPK1–Caspase-8 complex in lysosome and ER is related, we isolated lysosome and ER fractions from LPS/5z-7-stimulated iBMDMs and analyzed the protein level of FADD-RIPK1-Caspase-8 by using western immunoblot. Interestingly, LPS/5z-7 stimulation induced the appearance of FADD/RIPK1/Caspase-8 on lysosome, but later on ER (Fig. 4E, F). Deletion of Riok2 in iBMDMs had no significant effects on the presence of FADD-RIPK1-Caspase-8 on lysosome, but almost abolished their presence on ER in response to LPS/5z-7 stimulation (Fig. 4G, H). Moreover, the cleavage of GSDMD was observed to increase at the ER from LPS/5z-7-stimulated iBMDMs (Fig. 4F), but deletion of Riok2 in iBMDMs eliminated LPS/5z-7-induced GSDMD cleavage on the ER (Fig. 4H). Together, these results suggest that RIOK2 may drive the translocation of FADD/RIPK1/Caspase-8 from lysosome to ER through promoting transport of lysosome to ER in response to LPS/5z-7 stimulation, which may facilitate GSDMD cleavage on ER.

Fig. 4. Transport of lysosome to ER by RIOK2 determines pyroptosis.

Fig. 4

Representative confocal fluorescence images of WT or Riok2−/− iBMDMs stimulated with LPS/5z-7 for indicated times in (A) or 2 h in (C), and co-stained for Lysosome marker LAMP1 and ER marker KDEL and DAPI. Scale bars, 2 μm; Quantification of colocalization of indicated proteins with organelles in multiple confocal images by calculating Manders’ overlap coefficient (B, D). E, F Immunoblotting of indicated proteins in Lysosome or ER fraction from iBMDMs stimulated with LPS/5z-7 for the indicated times. G, H Immunoblotting of indicated proteins in Lysosome or ER fraction from WT or Riok2−/−iBMDMs stimulated with LPS/5z-7 for the indicated times. I Immunoblotting of indicated proteins from WT or RIOK2−/− iBMDMs stimulated with LPS/5z-7 for the indicated times. J, K Representative confocal fluorescence images of WT or Riok2−/− iBMDMs or Riok2−/−+Riok2 iBMDMs treated with myosin II inhibitor (-)-Blebbistatin (50uM, 0.5 hour) stimulated with LPS/5z-7 for 2 h in (K), and co-stained for Lysosome marker LAMP1 and ER marker KDEL and DAPI. Scale bars, 2 μm. L In vitro kinase assay of p-MYL9 protein with or without Riok2 or FADD. MO WT and Riok2−/− iBMDMs treated with myosin II inhibitor (-)-Blebbistatin (50uM, 0.5 hour) and then stimulated with LPS/5z-7. Cell death was assessed and calculated by measuring the ATP level at indicated times (M); LDH release (N), cell viability (O)at 3 hours post stimulation. P, Q IL-1β/ IL-18 release were measured by ELISA stimulated with LPS/5z-7 for the indicated times. (R) Immunoblotting of indicated proteins from WT or Riok2−/−iBMDMs treated with myosin II inhibitor (-)-Blebbistatin (50uM, 0.5 hour), stimulated with LPS/5z-7 for the indicated times. S, T Immunoblotting of indicated proteins in Lysosome or ER fraction from WT or Riok2−/− iBMDMs treated with myosin II inhibitor (-)-Blebbistatin (50uM, 0.5 hour) stimulated with LPS/5z-7 for the indicated times. All of the immunoblot data are representative images from one of three independent experiments. Two-tailed unpaired Student’s t-test (B, D, J, MQ) was used for statistical analysis. Data are expressed as mean ± (SEM) of 3 independent experiments (B, D, J, M, N). n = 3 independent experiments with similar results. A, C, K Nuclei were stained with DAPI (blue). Source data are provided as a Source Data file.

We next investigated how RIOK2 regulates the transport of lysosomes to the ER. The intracellular vesicle transport relies on a cytoskeletal track, which involves the activation of motor proteins such as myosin54,55. Activation of myosin II is reported to be dependent on its phosphorylation on Ser19 and Thr1856. Significant phosphorylation of myosin II was detected in wild-type, but not in Riok2−/− iBMDMs stimulated with LPS/5z-7 (Fig. 4I). Inhibition of myosin II by (-)-Blebbistatin, a specific myosin II inhibitor57 blocked LPS/5z-7-induced aggregation of lysosome and ER (Fig. 4J, K). However, the impairment of myosin II inhibitor on the transport of lysosome to ER was not detected in Riok2−/− iBMDMs as in wild-type iBMDMs (Fig. 4J, K). Our immunoprecipitation and mass spectrometry analysis also identified myosin II as the most abounded FADD-interacting protein in lysate from HeLa cells stimulated with TNFα + 5z-7 (Supplementary Fig. 5A). The interaction between FADD and myosin II was confirmed by endogenous co-IP in TNF/7z-7 stimulated HeLa cells (Supplementary Fig. 5B, C). We also detected a direct interaction between FADD and RIOK2 with myosin II (Supplementary Fig. 5D). In an in vitro kinase assay, we found that RIOK2 activated the phosphorylation of Myosin II at the presence of FADD protein (Fig. 4L). These results suggest that RIOK2 may regulate the transport of lysosome to ER through activating myosin II.

Transport of lysosome to ER determines pyroptosis

Given that RIOK2 may regulate both the transport of lysosome to ER and caspase-8-dependent pyroptosis, we next investigated whether transport of lysosome to ER contributes to caspase-8-dependent pyroptosis. The data showed that treatment of myosin II inhibitor markedly reduced LPS/5z-7-induced pyroptosis (Fig. 4M–O) and cytokines release (Fig. 4P–Q) of iBMDMs. Myosin II inhibitor also reduced RIPK1 phosphorylation, caspase-8 and GSDMD cleavage in response to LPS/5z-7 stimulation (Supplementary Fig. 5E, F). However, myosin II inhibitor has no effects on canonical inflammatory caspase-mediated pyroptosis in response to LPS plus nigericin or LPS plus LFN-Fla or LPS plus Poly(dA:dT) stimulation (Supplementary Fig. 5G–J), suggesting that myosin II mediated transport of lysosome to ER may selectively mediate RIPK1–Caspase-8-dependent pyroptosis, but not inflammasome-mediated pyroptosis. Furthermore, the inhibition of myosin II inhibitor on the LPS/5z-7-induced ATP loss and LDH release (Fig. 4M–O) or cytokines release (Fig. 4P-Q) was not detected in Riok2−/− iBMDMs as in wild-type iBMDMs, as well as RIPK1 phosphorylation, and caspase-8 and GSDMD cleavage (Fig. 4R). These results suggest that RIOK2 may trigger Caspase-8-dependent pyroptosis through promoting the myosin II-mediated transport of lysosome to ER.

To further investigate how transport of lysosome to ER regulate the pyroptosis, we treated iBMDM cell with myosin II inhibitor and then analyzed the protein level of FADD/RIPK1/Caspase-8 by western immunoblot. Inhibition of transport of lysosome to ER by (-)-Blebbistatin in iBMDMs did not significant change the amount of FADD/RIPK1/Caspase-8 protein on lysosome, but almost abolished their presence on ER (Supplementary Fig. 5K-L). Consistently, treatment of myosin II inhibitor significantly suppressed GSDMD activation on ER (Supplementary Fig. 5L). Treatment with a myosin II inhibitor abolished the inhibitory effect caused by Riok2 deficiency. Specifically, it restored the translocation of the FADD-RIPK1-Caspase-8 complex to the ER and the cleavage of GSDMD at the ER (Fig. 4S-T). These results suggest that RIOK2 may regulate the Caspase-8-dependent pyroptosis through promoting myosin II-mediated transport of lysosome to ER, thus leading to translocation of FADD-RIPK1-Caspase-8 from lysosome to ER to facilitate the cleavage of GSDMD on ER.

It has been shown that the recruitment of FADD–RIPK1–Caspase-8 complex to lysosomes depends on its binding to the Rag-Ragulator complex20. Indeed, deletion of RagC abrogated the lysosomal localization of FADD–RIPK1–Caspase-8 in LPS/5z-7-treated macrophages (Supplementary Fig. 5M). Interestingly, we noticed that deletion of RagC also inhibited inducible translocation of FADD–RIPK1–Caspase-8 complex to ER (Supplementary Fig. 5N). Consistently, cleavage of GSDMD at ER was also markedly blocked in LPS/5z-7-stimulated RagC−/− iBMDM (Supplementary Fig. 5N). However, in an in vitro assay, RagC was not found capable of cleaving purified GSDMD together with FADD and caspase-8 (Supplementary Fig. 5O). Together, these data suggest that LPS/5z-7 stimulation may induce the RagC-mediated recruitment of FADD–RIPK1–Caspase-8 complex to lysosome, and later translocation of FADD–RIPK1–Caspase-8 complex from lysosome to ER for the cleavage of GSDMD at ER via RIOK2.

RIOK2’s kinase or ATPase activity drives pyroptosis

To further clarify the mechanism underlying the regulation of pyroptosis by RIOK2, we next investigated whether kinase or ATPase activity of RIOK2 is required for LPS/5z-7-induced pyroptosis. Treatment with CQ211, a most potent and selective RIOK2 ATPase inhibitor reported so far30, markedly inhibited the LPS/5z-7-induced ATP loss (Supplementary Fig. 6A) or LDH release (Supplementary Fig. 6B) or cell viability decrease (Supplementary Fig. 6C) or cytokines release (Supplementary Fig. 6D, E) in iBMDMs. Consistent with this, LPS/5z-7-induced ATP loss (Fig. 5A) or LDH release (Fig. 5B) or cell viability decrease (Fig. 5C) or IL-1β and IL-18 release (Fig. 5D, E) was markedly inhibited in Riok2−/− iBMDMs complemented with RIOK2 (D246A), RIOK2 ATPase and kinase -defective mutants, but not with wild-type RIOK2. LPS/5z-7- or TNF/5z-7-stimulated formation of FADD–RIPK1–Caspase-8 complex, phosphorylation of RIPK1, and cleavage of Caspase-8 were also impaired by CQ211 (Supplementary Fig. 6F-H). In Riok2−/− iBMDMs complemented with RIOK2 (D246A), but not with wild-type RIOK2, treatment of LPS/5z-7 did not lead to the formation of the FADD–RIPK1–Caspase-8 complex, phosphorylation of RIPK1, nor cleavage of Caspase-8 (Fig. 5F). Moreover, treatment of CQ211 or complementation of ATPase and kinase -defective mutants RIOK2 (D246A) markedly inhibited the LPS/5z-7-induced cleavage of GSDMD in iBMDM cells (Fig. 5F; Supplementary Fig. 6I). More importantly, in an in vitro assay, ATPase-inactive mutants of RIOK2 failed to trigger the cleavage of Caspase-8 and GSDMD (Fig. 5G). These findings suggest that ATPase activity of RIOK2 may drive the formation and activation of FADD–RIPK1–Caspase-8 complex to trigger cleavage of GSDMD and pyroptosis.

Fig. 5. RIOK2 kinase or ATPase activity drives pyroptosis.

Fig. 5

AC Riok2−/− iBMDMs transfected with plasmids encoding Riok2 or Riok2(D123A) or Riok2(D246A) stimulated with LPS/5z-7. Cell death was assessed and calculated by measuring the ATP level at indicated times (A) LDH release (B), cell viability (C) at 3 hours post stimulation. D, E IL-1β/ IL-18 release were measured by ELISA stimulated with LPS/5z-7 for the indicated times. F Endogenous FADD complex was immunoprecipitated with anti-FADD antibody and analyzed by immunoblot with the indicated antibodies. G In vitro cleavage assay of Caspase-8 and GSDMD protein with RIOK2 or RIOK2(D246A) and FADD with at the present of ATP. H Immunoblotting of indicated proteins from WT iBMDMs or Riok2−/− iBMDMs transfected with plasmids encoding Riok2 or Riok2(D246A) then stimulated with LPS/5z-7 for the indicated times. I Immunoblotting of indicated proteins from WT iBMDMs or Riok2−/− iBMDMs transfected with plasmids encoding Riok2 or Riok2(D246A), then stimulated with LPS/5z-7 for the indicated times. I, J Representative confocal fluorescence images of WT or Riok2−/− iBMDMs transfected with plasmids encoding Riok2 or Riok2(D246A), and stimulated with LPS/5z-7 for 2 h, and co-stained for Lysosome marker LAMP1 and ER marker KDEL and DAPI. Scale bars, 2 μm; Quantification of colocalization of indicated proteins with organelles in multiple confocal images by calculating Manders’ overlap coefficient (J). K In vitro kinase assay of p-MYL9 protein with or without RIOK2, RIOK2(D246A) or FADD. Riok2−/− iBMDMs transfected with plasmids encoding Riok2 or Riok2(D246A), and treated with myosin II inhibitor (-)-Blebbistatin (50uM, 0.5 hour), then stimulated with LPS/5z-7. Cell death was assessed and calculated by measuring the ATP level at indicated times (L); LDH release (M), cell viability (N) at 3 hours post stimulation. Immunoblotting of indicated proteins in Lysosome (O) or ER (P) fraction from WT iBMDMs or Riok2−/− iBMDMs transfected with plasmids encoding Riok2 or Riok2(D246A) then stimulated with LPS/5z-7 for the indicated times. All of the immunoblot data are representative images from one of three independent experiments. Data are expressed as mean ± (SEM) of 3 independent experiments (AE, J, LN). Two-tailed unpaired Student’s t-test (AE, J, LN) was used for statistical analysis. n = 3 independent experiments with similar results. (I. Nuclei were stained with DAPI (blue)). Source data are provided as a Source Data file.

We next investigated whether LPS/5z-7-induced transport of lysosome to ER required RIOK2’s kinase activity. Inhibition of RIOK2 by CQ211 inhibited LPS/5z-7-induced phosphorylation of myosin II (Supplementary Fig. 6J) as well as LPS/5z-7-induced co-localization of lysosome with ER (Supplementary Fig. 6K, L). Similarly, complementation of Riok2−/− iBMDMs with a kinase-defective mutant RIOK2 (D246A), but not with wild-type RIOK2, also showed much lower level of phosphorylation of myosin II (Fig. 5H) as well as less agglomeration of lysosome with ER (Fig. 5I, J). Mechanistically, RIOK2D246A, a RIOK2’s kinase inactive mutants, failed to activate the phosphorylation of Myosin II at the presence of FADD protein (Fig. 5K) in an in vitro kinase assay. Furthermore, treatment of myosin II inhibitor eliminated the inhibitory effect of RIOK2 kinase activity by CQ211 on LPS/5z-7-induced ATP loss or LDH release (Supplementary Fig. 5M, N). Similarly, the impaired pyroptosis in Riok2−/− iBMDMs complemented with a kinase-defective mutant RIOK2 (D246A), but not with wild-type RIOK2, was not observed when the myosin II inhibitor was added (Fig. 5L-N). These results suggest that the kinase activity of RIOK2 may drive the transport of lysosomes to ER and pyroptosis by activating myosin II.

Next, we examined the contribution of the kinase activity of RIOK2 to the translocation of the FADD-RIPK1-Caspase-8 complex to the ER. Inhibition of RIOK2’s ATPase activity by CQ211 did not significantly change the localization of FADD-RIPK1-Caspase-8 on lysosomes in LPS/5z-7-induced iBMDMs (Supplementary Fig. 6O), but markedly decreased their content of FADD-RIPK1-Caspase-8 on ER (Supplementary Fig. 6P). Similarly, Riok2−/− iBMDMs complemented with kinase-defective mutant RIOK2 (D246A) had a similar level of FADD-RIPK1-Caspase-8 complex with those counterparts complemented with wild-type RIOK2 on lysosome (Fig. 5O). However, Riok2−/− iBMDMs complemented with kinase-defective mutant RIOK2 (D246A), but not with wild-type RIOK2, had much less FADD-RIPK1-Caspase-8 complex on their ER (Fig. 5P). Moreover, inhibition of RIOK2’s activity by CQ211 markedly inhibited the cleavage of GSDMD at the ER in LPS/5z-7-induced iBMDMs (Supplementary Fig. 6P). Above all, our data suggested that RIOK2’s kinase activity may mediate the translocation of the FADD-RIPK1-Caspase-8 complex from the lysosome to the ER for the cleavage of GSDMD at the ER.

RIOK2-mediated pyroptosis contributes to inflammation and host defense

We next examined the role of RIOK2 in pyroptosis induced by Y. pseudotuberculosis. Like LPS/5z-7 treatment, Yersinia infection in WT iBMDMs triggered massive pyroptosis, as assessed by ATP loss (Fig. 6A) or LDH release (Fig. 6B) or cell viability decrease (Fig. 6C), or IL-1β and IL-18 release (Supplementary Fig. 7A, B). As expected, this correlated with FADD–RIPK1–Caspase-8 complex formation (Fig. 6D) and the cleavage of Caspase-8 and GSDMD to their active forms (Fig. 6E, F). Thus, RIOK2 is also a prerequisite for Yersinia-triggered pyroptosis. Consistent with LPS/5z-7 stimulation, CQ211 treatment blocked Yersinia FADD–RIPK1–Caspase-8 complex formation (Fig. 6G) and cleavage of Caspase-8 and GSDMD (Fig. 6H, I), suggesting that RIOK2 ATPase activity is required for Yersinia-induced pyroptosis. It has been shown that Caspase-8-dependent pyroptosis provides host defense against Yersinia infection58. To investigate whether RIOK2 plays a functional role in Yersinia infection in vivo, we orally challenged Riok2f/f and mRiok2−/− mice with Y. pseudotuberculosis, and found deletion Riok2 increased spleen and liver bacteria CFU at 3 days post infection (Fig. 6J, K). Furthermore, treatment with CQ211 resulted in significantly higher bacterial burden in the spleen and liver, suggesting that RIOK2 is required for host defense against Y. pseudotuberculosis in vivo (Fig. 6L, M).

Fig. 6. RIOK2-mediated pyroptosis contributes to inflammation and host defense.

Fig. 6

AF WT and Riok2−/− iBMDMs infected with Y. pseudotuberculosis (MOI = 20) for indicated times. Cell death was assessed and calculated by measuring the ATP level at indicated times (A), LDH release (B), cell viability (C) at 3 hours post stimulation (B), endogenous FADD complex was immunoprecipitated with anti-FADD antibody and analyzed by immunoblot with the indicated antibodies (D), Immunoblotting of full-length and cleaved products of Caspase-8, p-RIPK1 (D), Gsdmd (F) in lysates. GI treated with Riok2 inhibitor CQ211 (10uM, 1 hour) and then infected with Y. pseudotuberculosis (MOI = 20) for indicated times. Endogenous FADD complex was immunoprecipitated with anti-FADD antibody and analyzed by immunoblot with the indicated antibodies (G), Immunoblotting of full-length and cleaved products of Caspase-8, p-RIPK1 (H), Gsdmd (I) in lysates. J, K 6-8 weeks female WT Cre+/+, Riok2f/f but non-littermate control and mRiok2−/− mice orally challenged with Y. pseudotuberculosis (~200 CFU /mice). CFU in Spleen (J) and Liver (K) at 3 days post infection. L, M 6-8 weeks female C57BL/6 mice treated with CQ211 (25 mg/kg) for 2 days, and then orally challenged with Y. pseudotuberculosis (~200 CFU/mice). CFU in Spleen (L) and Liver (M) at 3 days post infection. All of the immunoblot data are representative images from one of three independent experiments. Two-tailed unpaired Student’s t-test (AC) and two-sided Mann-Whitney U-test (JM) were used for statistical analysis. Data are expressed as mean ± (SEM) of 3 independent experiments (AC). mean ± s.e.m. of n = 10 mice in (JM). Source data are provided as a Source Data file.

Discussion

Caspase-8-dependent GSDMD cleavage triggers pyroptosis and host defense against pathogens such as Yersinia infection. Our study reveals an ATPase activity of RIOK2 triggers Caspase-8-dependent GSDMD cleavage both in vitro and at the ER. On the other hand, RIOK2 activates myosin II to promote the transport of lysosomes to the ER, which facilitates the translocation of the FADD–RIPK1–Caspase-8 complex from the lysosome to the ER. Furthermore, RIOK2-mediated pyroptosis contributed to inflammation and host defense against Yersinia infection (Supplementary Fig. 5). Thus, we conclude that the kinase activity of RIOK2 is critical for triggering caspase-8-mediated pyroptosis, which requires interorganellar communication between the ER and lysosome for the spatial cleavage of GSDMD at the ER in an energy-dependent manner, although additional studies are required to solidify this conclusion.

The physiological function of all eukaryotic cells is based on the coordination of membrane-enclosed organelles and the plasma membrane. Despite the importance of GSDMD cleavage in various cellular functions or diseases, mechanisms regulating the GSDMD cleavage by the coordination of different organelles remain largely unknown. We found that transport of lysosome to ER by RIOK2 is required for caspase-8-dependent cleavage of GSDMD at ER through facilitating the translocation of FADD–RIPK1–Caspase-8 complex from lysosome to ER. Transport of lysosome to ER needs the activation of myosin 2 by RIOK2’s kinase activity, which drives the movement of lysosome in an energy-dependent manner. Our data demonstrate that RIOK2’s ATPase activity drives caspase-8-dependent cleavage of GSDMD at ER, indicating that different organelles are involved in the spatial cleavage of GSDMD. To the best of our knowledge, our study demonstrates that cleavage of GSDMD is a spatially-organized and energy-dependent process. However, detailed mechanism underlying the coordination of different organelles in the regulation of pyroptosis and their connection with plasma membrane needs further investigation.

Macrophage infection by the pathogenic bacteria Yersinia or mimic stimulation of LPS/5z-7 induces RIPK1- and caspase-8-mediated GSDMD cleavage and pyroptosis17,18. In addition, Caspase-3- and caspase-8-mediated activation of apoptotic effectors downstream of caspase-8 also contributes to overall cell death in response to Yersinia infection18, leading to a mixed cell death phenotype with contributions from both pyroptotic and apoptotic pathways. The Ragulator–Rag complex is required during this Caspase-8-dependent but inflammasome-independent form of pyroptosis20. In response to Yersinia, Ragulator–Rag functions as a tethering platform at the lysosome for recruitment of the FADD-RIPK1–Caspase-8 complex20. We found that deletion of RagC blocked the cleavage of GSDMD at ER in LPS/5z-7-treated macrophages, but RagC is not able to activate Caspase-8-dependent cleavage of GSDMD in vitro. The inhibitory effect of RagC on the spatial cleavage of GSDMD at ER is probably due to its central role in the recruitment of FADD–RIPK1–Caspase-8 complex to lysosomes. Indeed, inducible translocation of FADD–RIPK1–Caspase-8 complex to ER was not observed in LPS/5z-7-stimulated RagC−/− iBMDMs. However, deletion of RIOK2 or inhibition of its ATPase or kinase activity abolished the cleavage of GSDMD at ER. Furthermore, RIOK2, but not its ATPase-defective mutants, directly activated in vitro cleavage of Caspase-8 and GSDMD. Coupled with the recruitment of FADD–RIPK1–Caspase-8 complex previously reported to lysosome by Rag-Ragulator complex20, our observations suggest that RagC may mediate recruitment of FADD–RIPK1–Caspase-8 complex to lysosome, and RIOK2 may later drive the transport of lysosome to ER to facilitate the translocation of FADD–RIPK1–Caspase-8 complex from lysosome to ER and subsequent the cleavage of GSDMD at ER. However, whether lysosome truly forms membrane contact sites with ER during Caspase-8-dependent pyroptosis awaits further investigation by using electron microscopy, structured illumination microscopy and high spatial and temporal resolution confocal live cell imaging.

ER is an important intracellular organelle that plays a key role in maintaining cellular homeostasis. It has been established that ERS can induce different cell death modes, including autophagy, apoptosis, ferroptosis, and pyroptosis59. LPS treatment disrupts cellular homeostasis indicated by the active inflammatory response and the increased levels of ER stress, autophagy, and apoptosis in a TLR4-dependent manner, while FOXA2 overexpression can alleviate these changes to restore cellular homeostasis in bovine hepatocytes60. However, our data indicate that ERS or ER-related calcium is not involved in LPS-induced pyroptosis. Our observation that tethering of RIOK2 on ER is required for its recruitment of FADD, RIPK1, and caspase-8 to induce caspase 8 activation and GSDMD cleavage at ER suggests that the ER is an important platform for the execution of cell death. However, the mechanism underlying the ER-to-plasma membrane trafficking and pore formation needs further investigation.

It has been established that RIOK2, an essential assembly unit of the 40S particle of the ribosome in human cells25, may function as an ATPase28. RIOK2 shepherds the last steps of maturation of the 40S subunit, during which the ATPase activity of RIOK2 is indispensable for the release of RIOK2 and other processing factors from the nascent pre-40S subunit and for ribosomal maturation. Analysis of the crystal structure of eukaryotic RIOK2–ATP–Mg2+ complex revealed that the active site contains ADP-Mg2+ and a phosphoaspartate intermediate typically found in Na+, K+, and Ca2+ ATPases, but not protein kinases. Consistent with this, RIOK2 exhibits robust ATPase activity in vitro28. Our data demonstrate that RIOK2 catalytic activity is not required for the activation of myosin II to transport lysosome to ER, but also required for the assembly of the FADD–RIPK1–caspase-8 complex at ER and subsequent caspase-8-dependent cleavage of GSDMD. We propose that phosphoryl transfer from ATP to Asp257 in RIOK2’s active site and subsequent hydrolysis of the aspartylphosphate could be a trigger to power caspase-8-dependent pyroptosis,

RIO kinases (RIOK) belong to an evolutionarily conserved family of atypical kinases found in eukaryotes and archaea32,61. RIOK2 is an indispensable trans-acting factor with an ATPase-dependent function during ribosome maturation25,27,28,33. RIOK2 also acts as an integral component of the transcriptional regulatory network governing human hematopoietic differentiation62. It has been observed that RIOK2 was highly expressed in many malignant tumors and is significantly associated with tumor survival, metastasis, and immune cell infiltration9,26,63,64. Cox proportional hazards regression revealed an association between higher expression of RIOK2 and shorter overall survival and relapse-free survival63. Here, we uncovered an unexpected function of RIOK2 as a master regulator of innate immune responses through promoting both inflammation and cell death. To the best of our knowledge, a functional role of RIOK2 in the immune system has been demonstrated. RIOK2 is also upregulated in activated CD4+ T cells65, so it will be interesting to characterize the function of RIOK2 and the mechanism by which it regulates the activation of CD4+ T cells.

In addition to the effect on gene expression, RIOK2 can also be regulated at multiple levels, such as epigenetic modifications, gene alterations, and post-translational modifications. Alteration of RIOK2 via DNA methylation and phosphorylation was found to be related to tumorigenesis63. RIOK2 has the ability to auto-phosphorylate, which is important for its function33.The phosphorylation of RIOK2 by Polo-like kinase 1 (Plk1) at Ser335, Ser380, and Ser548 has been suggested to function in mitotic progression41, but its best documented molecular function is linked to the synthesis of the small ribosomal subunit. RIOK2 phosphorylation at Ser483 by RSK (p90 ribosomal S6 kinase) facilitates late stages of pre-40S particle maturation27. Loss of RIOK2 ATPase activity led to a decrease in protein synthesis and to ribosomal instability followed by apoptosis in leukemic cells, but not in fibroblasts28,66.The ATPase activity is also needed for RIOK2 to drive caspase-8-mediated pyroptosis. Comprehensive analysis of RIOK2’s upstream regulation and RIOK2-mediated regulatory pathways will deepen our understanding of the role of RIOK2 in different cellular functions and its deregulation in different diseases, and provide targetable options to treat tumors, inflammatory diseases, as well as other hematologic disorders.

The ability to engage caspase-8-mediated cell death pathways has been shown to be critically important for host survival in response to Yersinia pestis infection in vivo, with Ripk3−/−Casp8−/− mice rapidly succumbing to infection due to uncontrolled bacterial growth and decreased inflammatory cytokine production, including that of IL-1β67. We found that treatment with the RIOK2 inhibitor CQ211 significantly increased bacterial burden in the spleen from Y. pseudotuberculosis-infected mice, suggesting that RIOK2 is required for host defense against Y. pseudotuberculosis in vivo. Further work is needed to explore the potential of the RIOK2 agonist for the development of therapeutic targets.

In summary, we propose that Caspase-8-dependent pyroptosis are regulated at least three steps (Supplementary Fig. 8): recruitment of FADD-RIPK1-Caspase-8 complex to lysosome promoted by lysosomal Ragulator–Rag complex, followed by kinase-dependent transport of lysosome to ER by RIOK2-medated activation of myosin II, which drives the translocation of FADD-RIPK1-Caspase-8 complex from lysosome to ER and results in further ATPase-dependent cleavage of GSDMD at ER by RIOK2.

Methods

Relevant ethical regulations

All protocols were approved by the local ethics committee of Tongji University (permit number: TJAA06522101). The use of animals in our work was approved by the local ethics committee of Tongji University (permit number: TJAA06522101). All mice were bred and maintained under specific pathogen-free (SPF) conditions in the animal facility of Southeast University, under a 12-h light/dark cycle with controlled temperature (20  ±  1 °C) and relative humidity (50  ±  5%).

Bacterial strains and cells

The Y. pseudotuberculosis YPIII strain, a gift from Dr. Shiyun Chen (Wuhan Institute of Virology, Chinese Academy of Sciences), was grown overnight in 2× YT broth at 26 °C. On the day of infection, bacteria were diluted 1:50 into 2× YT plus 20 mM MgCl2 and 20 mM sodium oxalate and grown for 2 hours at 26 °C, followed by a shift to 37 °C for 2 hours. Bacteria were then washed in phosphate-buffered saline (PBS; Invitrogen) and added to cells at an MOI of 40. Next, 100 μg/ml gentamicin was added to the cultures 2 hours after infection. To quantify the number of bacteria that had been taken up by cells, iBMDMs were infected with the Y. pseudotuberculosis YPIII strain at the MOI indicated in the corresponding figures. Thirty minutes later, cells were washed with PBS three times, and gentamicin was added to kill extracellular bacteria. Then, intracellular bacteria were released by treating cells with 0.05% Triton X-100 before lysates were serially diluted and plated on 2× YT agar. Bacterial colonies were counted after 1 day of culture at 37 °C.

Immortalized BMDMs (Oricellbio, M3-1001), HEK293T cells (ATCC CRL-3216) HeLa cells (ATCC CRM-CCL-2) were authenticated by short-tandem repeat analysis. Mycoplasma infection was tested monthly with the Mycoplasma PCR Detection Kit (Beyotime). Cell lines cultivated for less than 15 passages since their procurement were used in the following experiments. The cells were resuspended in DMEM (HyClone) mixed with 10% (v/v) fetal bovine serum (FBS, Gibco) for experiments. Macrophages were cultured in RPMI-1640 medium supplemented with 10% (v/v) FBS. Peritoneal macrophages were obtained from mice(4~6weeks) three days after injection of thioglycollate (BD). All the cells were routinely tested for contamination by mycoplasma.

Riok2 Knockout Mice

To obtain conditional Riok2-KO mice in myeloid cells (for short as mRiok2 −/− in this study), Briefly, Riok2 floxed mice (Riok2flox/flox) were generated on the background of C57BL/6 J with exons 2 flanked by loxP sites Exon 2 was selected as the conditional knockout region (cKO region). The region contains a 139 bp coding sequence. Deletion of this region should result in the loss of function of the mouse.

Specific-pathogen-free.4-week-old Riok2flox/flox female mice were mated with male C57BL/6J-Lyz2-IRES-iCre+/+ mice (Cyagen, Product ID: C001358), thus generating Riokflox/flox; LyZ2-IRES-iCre (mRiok2−/−) mice that carried Riok2 gene deletion in myeloid cells. The mouse mating was performed by crossing of female mice carrying the floxed RIOK2 allele (F0, Riok2f/f) with male mice expressing Cre recombinase (LyZ2-IRES-iCre+/+) to generate F1 mice (Riok2ᶠˡᵒˣ/⁺; Lyz2-Cre⁺). The experimental group (F2 generation): Riokflox/flox; LyZ2-IRES-iCre+/+ (mRiok2−/−) was obtained through reciprocal hybridization of the F1 generation: Cross between F1 generation mice with genotype Riok2ᶠˡᵒˣ/⁺; Lyz2-Cre⁺ (both females and males have the same genotype). 25 % of Genotype proportion of the F2 generation was Riokflox/flox; LyZ2-IRES-iCre+/+(mRiok2−/−). No significant difference was observed between Riokflox/flox; and mRiok2−/− mice during breeding. LyZ2-IRES-iCre+/+ Riok2wt/wt and Riokflox/flox mice were used as non-littermate control but age-synchronized to 6-8 weeks female experimental mice, with body weights controlled at 23 ± 3 g for females Moreover, all animal experiments were reviewed and approved by the Animal Experiment Administration Committee of Tongji University School of Medicine.

Yersinia infection

On the day of infection, bacteria were diluted 1:50 into LB broth and grown for 4 hours at 37 °C. Bacteria were then washed with PBS and added to cells at a MOI of 20. Next, 100 μg/ml gentamicin was added to the cultures 0.5 hours after infection to kill extracellular bacteria.

For in vivo infection, mice were fasted for 16 hours and challenged with 2 × 108 colony-forming units (CFU) of stationary-phase bacteria by oral gavage. To determine bacterial burden, mice were euthanized 5 days after infection, and tissues were harvested, homogenized in 1 ml of phosphate-buffered saline (PBS), and serially diluted on LB agar. To prevent the potential factors affecting the mice experiments due to sex differences, we used only the female animals in all the mice infection experiments. All the mice were age-matched and sex-matched in each experiment. No animals were excluded from the study. No additional randomization or blinding was used to allocate experimental groups.

Plasmids, reagents, and antibodies

The following antibodies and reagents were used for western blot,IF or CO-IP: CD107b / LAMP2 Monoclonal antibody(66301-1-Ig),CoraLite® Plus 488 Anti-Mouse CD107a / LAMP1 (1D4B) (CL488-65050), CoraLite® Plus 488-conjugated Caspase-8/p43/p18 Monoclonal antibody(CL488-66093), CoraLite® Plus 647-conjugated Phospho-RIPK1 (Ser161) Monoclonal antibody (CL647-66854) were from Proteintech. Monoclonal anti-Flag antibody (F3165) and anti–β-actin antibody (A1978) were from Sigma-Aldrich. Antibodies against HA (#3724, #2367), Flag (#14793), cleaved Caspase-8 (#8592), Caspase-8 (#4927), Caspase-3 (#9665), Caspase-7 (#12827), RIPK1 (#3493), Phospho-RIPK1 (#31122) were from Cell Signaling Technology. Monoclonal anti-FADD antibody (sc-166516) was from Santa Cruz Biotechnology for Western blot. Running buffer used for SDS-PAGE is from Sangon (C520001), the molecular weight markers is from abclonal (RM02949), secondary antibody from abclonal HRP-conjugated Goat anti-Rabbit IgG (H + L) (AS014) or HRP-conjugated Goat anti-Mouse IgG (H + L) (AS003). Monoclonal anti-GSDMD antibody (ab209845), monoclonal anti–pro Caspase-8 antibody (ab108333), and monoclonal anti-FADD antibody (ab124812) for co-IP were from Abcam. RIOK2 antibody (Abclonal, Catalog: A12122), for human WB (1/1000 dilution), RIOK2 Monoclonal Antibody (OTI3E11) (Invitrogen, Catalog:MA5-26060) for mouse WB (1/1000 dilution) and IF (1/100 dilution). Anti-RIO2 antibody (Abcam, Catalog: ab88485) for IP (1/100 dilution).

(-)-Blebbistatin (HY-13441), Dimethyl fumarate (HY-17363), Disulfiram (HY-B0240), MLN0905 (HY-15155) were from MCE. LPS (#L4524), etoposide (#E1383), 5z-7 (O9890) were from Sigma-Aldrich. Recombinant murine TNF-α (#315-01 A) was from Peprotech. Nigericin (tlrl-nig) was from Invivogen. Anti-Calnexin - ER Marker (ab22595) was from Abcam. CQ211 was provided by Qian Cai (College of Pharmacy, Jinan University).

Cell death

LDH release assay

LDH release into the cell culture supernatant was quantified using an LDH Cytotoxicity Assay Kit (Beyotime) and expressed as a percentage of total cellular LDH (100% lysis). ATP loss assay: For the CellTiter-Glo assay, CTG reagent (Promega, G7570) was mixed at a 1:1 ratio with supernatant from the treatment plate. The mix was incubated for 10 min at room temperature on the shaker, followed by luminescence measurement.On the day of infection, bacteria were diluted 1:50 into LB broth and grown for 4 hours at 37 °C. Bacteria were then washed with PBS and added to cells at a MOI of 20. Next, 100 μg/ml gentamicin was added to the cultures 0.5 hours after infection to kill extracellular bacteria.

Cell viability

The cell viabilities were evaluated by 3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay.

RIOK2 KO cells

LentiCRISPRv2 vectors were utilized to generate knockout (KO) cells. HEK293T cells were transfected by a mixture of Lipofectamine 2000 (Invitrogen, 11668030) with pMD2.G, pSPAX2 and LentiCRISPRv2 (Changsha Youbio Tech, VT8107) harboring the guide (g)RNA that targeted GCGGCTCATGTACCTAAGCT for Riok2 or scrambled gRNA. The lentiviruses were harvested 48 h post-transfection and were utilized to infect cells (The immortalized BMDMs was purchased from Oricellbio(M3-1001). The infected cells were then selected with puromycin (4 μg/mL) and single cell clone was acquired through serial dilutions in a 96-well plate. The KO cells were confirmed by Western blot and used for further experiments.

Endoplasmic reticulum (ER) extraction

ER was extracted following the manufacturer’s instruction (Sigma-Aldrich, ER0100). Briefly, 1 × 108 iBMDMs per sample were homogenized in 2 mL of 1× isotonic extraction buffer and sequentially centrifuged at speed of 1000 x g to remove cell debris as well as nuclear, and then, centrifuged at 12 000 x g to remove mitochondria. The clear supernatant fraction, together with the top lipid layer, was carefully collected and subjected to ultracentrifuging at speed of 100,000 x g for 1 hour to isolate ER. The supernatant was discarded and the ER pellet on the bottom was sufficiently suspended in 600 µL of isotonic extraction buffer and subjected to analysis.

Mass spectrometry analysis

The experimental setup utilized a high-resolution mass spectrometer, specifically the timsTOF Pro (Bruker), coupled with an ultra-high-performance liquid chromatography system, the nanoElute (Bruker). Key materials and reagents included Urea (Sinopharm), Tris-base (Bio-Rad), DTT (Bio-Rad), IAA (Sigma), Zeba Spin columns (Pierce), and enzymes such as Trypsin (EVLiXiR), Chymotrypsin (Sigma), Glu-C (Wako), and LysC (Wako).

For the experimental method, Flag-FADD/Flag-vector overexpressed HeLa cells that treated with or without TNF-α + 5z-7 were immunoprecipitated with anti-FADD/IgG antibody (1:30 dilution) (ab124812) and Protein A/G (Thermo Fisher,88803). The immunoprecipitated samples were performed on three biological replicates. The beads were then washed and boiled into 1× SDS loading buffer for SDS-PAGE analysis, followed by Commassie blue staining. Sample digestion was performed by reducing and alkylating the test sample, followed by enzymatic digestion (enzyme-to-substrate ratio of 1:50) at 37 °C for approximately 20 hours. The digested products were desalted, lyophilized, and reconstituted in 0.1% formic acid (FA) solution for storage at −20 °C. For mass spectrometry analysis, each sample was separated using the nanoElute HPLC system at a flow rate of 300 nL/min. Mobile phase A consisted of 0.1% FA in water, and mobile phase B contained 0.1% FA in acetonitrile (99.9%). The column (Thermo Scientific EASY column, 25 cm, ID 75 μm, 1.9 μm, C18) was equilibrated with 95% A, and the separation gradient was set as follows: 0.00–18.00 min, linear increase from 5% to 35% B; 18.00–20.00 min, linear increase from 35% to 80% B; and 20.00–30.00 min, maintained at 80% B.

Mass spectrometric detection was conducted using the timsTOF Pro instrument in positive ion mode, with an ion source voltage of 1.5 kV. Both MS and MS/MS analyses were performed using TOF detection, with a scan range of 100–1700 m/z. Data acquisition employed the Parallel Accumulation-Serial Fragmentation (PASEF) mode, where one full MS scan was followed by eight PASEF MS/MS scans per cycle (cycle time: 0.95 sec), targeting precursor ions with charge states 0–5. Dynamic exclusion was set to 24 seconds to prevent repeated sequencing of the same ions. Raw data files were processed using MaxQuant software (version 1.6.14) against a relevant database to identify proteins.

Lysosome extraction

In all, 1 × 108cells per sample were grown to 90% confluency, treated with LPS and 5z-7. All subsequent steps of the lysosomal isolation were performed according to manufacturer’s description (LYSISO1, 233-140-8). In brief, cells were centrifuged at 600 x g for 5 min, resuspended in 2.7 packed cell volume of 1 × extraction buffer, and homogenized in a glass Dounce homogenizer. The nuclei were removed by centrifugation at 1000 x g for 10 min. The postnuclear supernatant was centrifuged at 20,000 x g for 20 min, and the resulting pellet, containing the crude lysosomal fraction, was resuspended in a minimal volume of 1 × extraction buffer (0.4 ml per 108cells). To enrich the lysosomes, the suspension was further purified by density gradient centrifugation at 150.000 x g for 4 h on a multistep OptiPrep (Sigma-Aldrich, Steinheim, Germany) gradient according to the manufacturer’s description. Altogether, 0.5 ml fractions were collected starting from the top of the gradient. Each fraction was assayed for Caspase-8, GSDMD, and Lamp2 by western blotting.

Mitochondrial isolation

Mitochondrial extraction from cultured cells was performed according to the attached protocol using the mitochondria isolation kit (ab110170; Abcam, Cambridge, UK). Both cytoplasm and mitochondria were collected for western blotting.

Transfection and reverse transcription-PCR (RT-PCR) analysis

To generate lentivirus for mouse Riok2 complementation, the pLenti-CMV- RIOK2 WT- Flag, pLenti-CMV- RIOK2 D246A- Flag, or pLenti-CMV-Flag plasmids (Youbio, plasmids products) were co-transfected with psPAX2 (Addgene, #12260) and pMD2.G(Addgene, #12259) into HEK293T cells. After 6 hours, the media was changed to DMEM supplemented with 10 % FBS. After an additional 60 hours, the viral supernatants were harvested and centrifuged at 3000 rpm at 4 °C for 10 min to remove cell debris. The collected supernatant was then filtered through a 0.45 μm membrane (Millipore, Darmstadt, Germany, HAWP04700) and used for infecting cells.

The sequences of the siRNA against mouse RIOK2:5′- GGCATTAAGCCAAGCTGTAGA-3′; negative control siRNA (si-Ctrl): 5′-GGCUCUAGAAAAGCCUAUGCdTdT-3′(Ribobio, Design products to target genes). iBMDM cells were transfected with the siRNAs independently using siRNA-Mate transfection reagent (G04003, from GenePharma), in accordance with the manufacturer’s instructions.

IncuCyte analysis

For IncuCyte analysis, cells were seeded into 24-well plates for overnight incubation. 50 nM SytoxGreen (Molecular Probes) plus the indicated cell death stimuli were added, and the cells were moved into an IncuCyte live cell imaging system. Cells were imaged and the SytoxGreen-labeled cells (counted as dead cells) were quantified. When percentages are shown, total cell number was quantified at the end of each course of treatment, using 200 μg/ml digitonin (Sigma-Aldrich) to permeabilize all cells which were stained with 50 nM SytoxGreen. Data were then expressed as a percentage of SytoxGreen+ cells to total cell numbers. At least 3 experiments were performed with 3 replicates for each condition.

Western blot and Co-immunoprecipitation (Co-IP)

For Immunoblot, cell lysates or precipitates in 1× sodium dodecyl sulfate (SDS) protein sample buffer were denatured at 95 °C for 8 min and then resolved by electrophoresis through a 4% to 15% SDS-polyacrylamide gel. Separated proteins were transferred onto polyvinylidene difluoride (PVDF) membranes and were blocked with 5% skimmed milk for more than one hour. The membranes were then incubated with the prespecified antibodies at the indicated dilutions. An enhanced chemiluminescence reagent (Thermo Fisher Scientific) was applied for Immunoblot.

For Co-IP, 1 × 107 HeLa or iBMDM cells were lysed in an IP buffer (50 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, 1% NP-40, 1 mmol/L EDTA, 5% glycerol) containing protease inhibitor cocktails. The lysates were centrifuged at 17000 x g for 15 min, and the cellular debris was discarded. For immunoprecipitation, the lysates were then incubated with corresponding antibodies such as FADD (1:30) or Riok2(1:100) combined with 18uL protein A/G (Thermo Fisher,88803) per sample on a rotary shaker at 4 °C overnight. The IP gels or beads were washed four times using the IP buffer, and then eluted in 4% SDS buffer for the subsequent western blotting analysis. For immunoblotting, the protein sample lysate or precipitates were denatured in 1× sodium dodecyl sulfate (SDS) protein sample buffer and then separated using 10% or 12% SDS-polyacrylamide gel. The proteins were transferred onto a nitrocellulose membrane and incubated with the antibodies, the secondary antibody HRP-conjugated Goat anti-Rabbit IgG (H + L) (AS014) was used for the primary rabbit antibody, and HRP-conjugated Goat anti-Mouse IgG (H + L) (AS003) was used for the primary mouse antibody.

Immunofluorescent assay, confocal microscopy

Cells were fixed with 4% paraformaldehyde (PFA) in PBS for 25 min at room temperature. Cells then were blocked and permeabilized for 30 min in blocking buffer (PBS containing 1% bovine serum albumin (BSA) and 0.1% Triton X-100). Cells were then incubated with primary antibody in 4 °C for overnight and secondary antibody for 1 h at room temperature. Nuclei were labeled by staining with DAPI. Images were collected using a Leica TCS SP8 confocal laser microscopy system (Leica Microsystems, Buffalo Grove, IL) and processed with ImageJ (V1.8.0.112). Manders’ overlap coefficient was calculated using ImageJ (where each point represents 30 cells). All images are representative of at least three independent experiments.

In vitro kinase assay

The recombinant human RIOK2 WT/ D246A protein (Sangon Biotech), FADD Fusion Protein (Proteintech) were dissolved in kinase buffer (50 mM HEPES, pH 7.5, 10 mM MgCl2, 150 μM ATP, 50 mM NaCl, 0.02% BSA, and 1 mM DTT), then incubated with the recombinant protein MYL9 (Proteintech) were mixed with at 37 °C for 90 min. Then, the reaction mixture was subjected to SDS-PAGE.

Recombinant GSDMD cleavage in vitro assay

Recombinant Gsdmd (5ug) was incubated in the presence or absence of 5ug recombinant Caspase-8, recombinant human RIOK2 WT/ D246A protein (Sangon Biotech), or FADD Fusion Protein (Proteintech) at 37 °C for 60 min in Caspase reaction buffer (20 mM PIPES pH 7.2, 10% sucrose, 150 μM ATP, 100 mM NaCl, 0.1% CHAPS, 1 mM EDTA, 10 mM DTT). Samples were then subjected to SDS-PAGE.

Statistics & reproducibility

Statistical significance between groups was determined by two-tailed Student’s t-test, two-tailed analysis of variance followed by Bonferroni post hoc test or two-sided Mann–Whitney U-test. Differences were significant at P < 0.05. The experiments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

41467_2025_65012_MOESM2_ESM.pdf (29.3KB, pdf)

Description of Additional Supplementary File

Supplementary Data 1 (242.6KB, xlsx)
Supplementary Data 2 (4.2MB, xlsx)
Reporting summary (3MB, pdf)

Source data

Source Data.zip (8MB, zip)

Acknowledgements

We thank Prof. Xing Liu (Institut Pasteur of Shanghai, Chinese Academy of Sciences) for providing RIPK1 and Caspase-8 plasmids and RagC−/− iBMDMs; Prof. Shiyun Chen (Wuhan Institute of Virology, the Chinese Academy of Sciences) for providing Y. pseudotuberculosis strain; Prof. Feng. Shao (National Institute of Biological Sciences) and Prof. Jiahuai. Han (Xiamen University) for critical reading of the manuscript; members of Baoxue. Ge’s laboratory (Shanghai Key Laboratory of Tuberculosis, Shanghai Pulmonary Hospital, Tongji University School of Medicine, Shanghai, China) for helpful discussions and technical assistance. This project was supported by grants from National Natural Science Foundation of China (32188101, 32030038, 91842303, 31730025, 82122029, 82500001, and 82071776); National Key R&D Program of China (2023YFC2307300; 2022YFC2302900 and 2021YFA1300902); Chinese National Program on Key Basic Research Project (2017YFA0505900); The Most Important Clinical Discipline in Shanghai (2017ZZ02003); Shanghai Rising-Star Program (20QA1408400); “Chen Guang” project (19CG22) Shanghai Municipal Education Commission and Shanghai Education Development Foundation.

Author contributions

Conceptualization: B.X.G., L.W.; Methodology: X.Y.W., H.Y., R.J.Z., Q.C.; Investigation: M.T.M., F.W., P.F.C., Y.Y.Z., C.N.C., Y.F.H., J.P.H., J.X.W., H.Y.M., H.W.M.; Funding acquisition: B.X.G., L.W.; Supervision: B.X.G.; Writing: B.X.G., L.W.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work. A peer review file is available.

Data availability

Source data are provided in this paper. The proteomics data generated in this study have been deposited in PXD065979, and the associated hyperlinks were https://proteomecentral.proteomexchange.org/cgi/GetDataset?ID=PXD065979. The RNA-Seq data have been deposited to the SRA database (accession number: PRJNA1291948). Proteomics data is provided as Supplementary Data 1. RNA sequencing data is provided as Supplementary Data 2. The processed proteomics and RNA sequencing data are available in the Source Data file. New allele and mouse with the MGI database (MGI: 8219551). Source data are provided with this paper.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Mingtong Ma, Fei Wang, Pengfei Cui, Yingying Zhang.

Contributor Information

Lin Wang, Email: 651377481@qq.com.

Baoxue Ge, Email: gebaoxue@sibs.ac.cn.

Supplementary information

The online version contains supplementary material available at 10.1038/s41467-025-65012-7.

References

  • 1.Booty, L. M. & Bryant, C. E. Gasdermin D and Beyond - Gasdermin-mediated Pyroptosis in Bacterial Infections. J. Mol. Biol.434, 167409 (2022). [DOI] [PubMed] [Google Scholar]
  • 2.Broz, P. & Dixit, V. M. Inflammasomes: mechanism of assembly, regulation and signalling. Nat. Rev. Immunol.16, 407–420 (2016). [DOI] [PubMed] [Google Scholar]
  • 3.Broz, P., Pelegrin, P. & Shao, F. The gasdermins, a protein family executing cell death and inflammation. Nat. Rev. Immunol.20, 143–157 (2020). [DOI] [PubMed] [Google Scholar]
  • 4.Green, D. R. The coming decade of cell death research: five riddles. Cell177, 1094–1107 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Aglietti, R. A. et al. GsdmD p30 elicited by caspase-11 during pyroptosis forms pores in membranes. Proc. Natl. Acad. Sci. USA113, 7858–7863 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ding, J. et al. Pore-forming activity and structural autoinhibition of the gasdermin family. Nature535, 111–116 (2016). [DOI] [PubMed] [Google Scholar]
  • 7.He, W. T. et al. Gasdermin D is an executor of pyroptosis and required for interleukin-1beta secretion. Cell Res25, 1285–1298 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kayagaki, N. et al. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling. Nature526, 666–671 (2015). [DOI] [PubMed] [Google Scholar]
  • 9.Liu, X. et al. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature535, 153–158 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sborgi, L. et al. GSDMD membrane pore formation constitutes the mechanism of pyroptotic cell death. EMBO J.35, 1766–1778 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Shi, J. et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature526, 660–665 (2015). [DOI] [PubMed] [Google Scholar]
  • 12.Evavold, C. L. et al. The pore-forming Protein Gasdermin D regulates Interleukin-1 Secretion from living macrophages. Immunity48, 35–44.e36 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Heilig, R. et al. The Gasdermin-D pore acts as a conduit for IL-1beta secretion in mice. Eur. J. Immunol.48, 584–592 (2018). [DOI] [PubMed] [Google Scholar]
  • 14.O’Neill, L. A., Golenbock, D. & Bowie, A. G. The history of Toll-like receptors - redefining innate immunity. Nat. Rev. Immunol.13, 453–460 (2013). [DOI] [PubMed] [Google Scholar]
  • 15.Monack, D. M., Mecsas, J., Ghori, N. & Falkow, S. Yersinia signals macrophages to undergo apoptosis and YopJ is necessary for this cell death. Proc. Natl. Acad. Sci. USA94, 10385–10390 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Paquette, N. et al. Serine/threonine acetylation of TGFbeta-activated kinase (TAK1) by Yersinia pestis YopJ inhibits innate immune signaling. Proc. Natl. Acad. Sci. USA109, 12710–12715 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Orning, P. et al. Pathogen blockade of TAK1 triggers caspase-8-dependent cleavage of gasdermin D and cell death. Science362, 1064–1069 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sarhan, J. et al. Caspase-8 induces cleavage of gasdermin D to elicit pyroptosis during Yersinia infection. Proc. Natl. Acad. Sci. USA115, E10888–E10897 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chen, K. W. et al. Extrinsic and intrinsic apoptosis activate pannexin-1 to drive NLRP3 inflammasome assembly. EMBO J38 (2019). [DOI] [PMC free article] [PubMed]
  • 20.Zheng, Z. et al. The Lysosomal Rag-Ragulator Complex Licenses RIPK1 and Caspase-8-mediated Pyroptosis by Yersinia. Science372 (2021). [DOI] [PMC free article] [PubMed]
  • 21.Evavold, C. L. et al. Control of gasdermin D oligomerization and pyroptosis by the Ragulator-Rag-mTORC1 pathway. Cell184, 4495–4511.e4419 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Muendlein, H. I. et al. ZBP1 promotes LPS-induced cell death and IL-1beta release via RHIM-mediated interactions with RIPK1. Nat. Commun.12, 86 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Condelli, V. et al. TRAP1 is involved in BRAF regulation and downstream attenuation of ERK phosphorylation and cell-cycle progression: a novel target for BRAF-mutated colorectal tumors. Cancer Res.74, 6693–6704 (2014). [DOI] [PubMed] [Google Scholar]
  • 24.Muendlein, H. I. et al. cFLIP(L) protects macrophages from LPS-induced pyroptosis via inhibition of complex II formation. Science367, 1379–1384 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ameismeier, M., Cheng, J., Berninghausen, O. & Beckmann, R. Visualizing late states of human 40S ribosomal subunit maturation. Nature558, 249–253 (2018). [DOI] [PubMed] [Google Scholar]
  • 26.Asquith, C. R. M., East, M. P. & Zuercher, W. J. RIOK2: straddling the kinase/ATPase line. Nat. Rev. Drug Discov.18, 574 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Cerezo, E. L. et al. RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit. PLoS Gene.t17, e1009583 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ferreira-Cerca, S. et al. ATPase-dependent role of the atypical kinase Rio2 on the evolving pre-40S ribosomal subunit. Nat. Struct. Mol. Biol.19, 1316–1323 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Messling, J. E. et al. Targeting RIOK2 ATPase activity leads to decreased protein synthesis and cell death in acute myeloid leukemia. Blood139, 245–255 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ouyang, Y. et al. Discovery of 8-(6-Methoxypyridin-3-yl)-1-(4-(piperazin-1-yl)-3-(trifluoromethyl)phenyl)-1,5-dihydro-4H-[1,2,3]triazolo[4,5-c]quinolin-4-one (CQ211) as a Highly Potent and Selective RIOK2 Inhibitor. J. Med Chem.65, 7833–7842 (2022). [DOI] [PubMed] [Google Scholar]
  • 31.Read, R. D. et al. A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma. PLoS Genet9, e1003253 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Vanrobays, E., Gelugne, J. P., Gleizes, P. E. & Caizergues-Ferrer, M. Late cytoplasmic maturation of the small ribosomal subunit requires RIO proteins in Saccharomyces cerevisiae. Mol. Cell Biol.23, 2083–2095 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zemp, I. et al. Distinct cytoplasmic maturation steps of 40S ribosomal subunit precursors require hRio2. J. Cell Biol.185, 1167–1180 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fischer, U. et al. A non-canonical mechanism for Crm1-export cargo complex assembly. Elife4 (2015). [DOI] [PMC free article] [PubMed]
  • 35.Gilmartin, A. G. et al. Distinct concentration-dependent effects of the polo-like kinase 1-specific inhibitor GSK461364A, including differential effect on apoptosis. Cancer Res.69, 6969–6977 (2009). [DOI] [PubMed] [Google Scholar]
  • 36.Duffey, M. O. et al. Discovery of a potent and orally bioavailable benzolactam-derived inhibitor of Polo-like kinase 1 (MLN0905). J. Med. Chem.55, 197–208 (2012). [DOI] [PubMed] [Google Scholar]
  • 37.Barr, F. A., Sillje, H. H. & Nigg, E. A. Polo-like kinases and the orchestration of cell division. Nat. Rev. Mol. Cell Biol.5, 429–440 (2004). [DOI] [PubMed] [Google Scholar]
  • 38.Takaki, T., Trenz, K., Costanzo, V. & Petronczki, M. Polo-like kinase 1 reaches beyond mitosis-cytokinesis, DNA damage response, and development. Curr. Opin. Cell Biol.20, 650–660 (2008). [DOI] [PubMed] [Google Scholar]
  • 39.van Vugt, M. A. & Medema, R. H. Getting in and out of mitosis with Polo-like kinase-1. Oncogene24, 2844–2859 (2005). [DOI] [PubMed] [Google Scholar]
  • 40.Archambault, V. & Glover, D. M. Polo-like kinases: conservation and divergence in their functions and regulation. Nat. Rev. Mol. Cell Biol.10, 265–275 (2009). [DOI] [PubMed] [Google Scholar]
  • 41.Liu, T. et al. Phosphorylation of right open reading frame 2 (Rio2) protein kinase by polo-like kinase 1 regulates mitotic progression. J. Biol. Chem.286, 36352–36360 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Schwarz, D. S. & Blower, M. D. The endoplasmic reticulum: structure, function and response to cellular signaling. Cell Mol. Life Sci.73, 79–94 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Araki, K. & Nagata, K. Protein folding and quality control in the ER. Cold Spring Harb. Perspect. Biol.3, a007526 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wu, H., Carvalho, P. & Voeltz, G. K. Here, there, and everywhere: The importance of ER membrane contact sites. Science361 (2018). [DOI] [PMC free article] [PubMed]
  • 45.Lebeaupin, C. et al. ER stress induces NLRP3 inflammasome activation and hepatocyte death. Cell Death Dis.6, e1879 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Ke, R., Wang, Y., Hong, S. & Xiao, L. Endoplasmic Reticulum stress Stress-Related Factor IRE1alpha regulates TXNIP/NLRP3-mediated pyroptosis in diabetic nephropathy. Exp. Cell Res.396, 112293 (2020). [DOI] [PubMed] [Google Scholar]
  • 47.Pao, H. P. et al. Suppression of endoplasmic reticulum stress by 4-PBA protects against hyperoxia-induced acute lung injury via up-regulating Claudin-4 Expression. Front Immunol.12, 674316 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yam, G. H., Gaplovska-Kysela, K., Zuber, C. & Roth, J. Sodium 4-phenylbutyrate acts as a chemical chaperone on misfolded myocilin to rescue cells from endoplasmic reticulum stress and apoptosis. Invest Ophthalmol. Vis. Sci.48, 1683–1690 (2007). [DOI] [PubMed] [Google Scholar]
  • 49.Zhang, J. et al. Endoplasmic reticulum stress-mediated cell death in liver injury. Cell Death Dis.13, 1051 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ren, J., Bi, Y., Sowers, J. R., Hetz, C. & Zhang, Y. Endoplasmic reticulum stress and unfolded protein response in cardiovascular diseases. Nat. Rev. Cardiol.18, 499–521 (2021). [DOI] [PubMed] [Google Scholar]
  • 51.Volkmann, K. et al. Potent and selective inhibitors of the inositol-requiring enzyme 1 endoribonuclease. J. Biol. Chem.286, 12743–12755 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Bu, L. J. et al. Melatonin, a novel selective ATF-6 inhibitor, induces human hepatoma cell apoptosis through COX-2 downregulation. World J. Gastroenterol.23, 986–998 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Berridge, M. J., Bootman, M. D. & Roderick, H. L. Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol.4, 517–529 (2003). [DOI] [PubMed] [Google Scholar]
  • 54.Lu, Q., Li, J. & Zhang, M. Cargo recognition and cargo-mediated regulation of unconventional myosins. Acc. Chem. Res47, 3061–3070 (2014). [DOI] [PubMed] [Google Scholar]
  • 55.Titus, M. A. Myosin-driven intracellular transport. Cold Spring Harb. Perspect. Biol. 10 (2018). [DOI] [PMC free article] [PubMed]
  • 56.Garrido-Casado, M., Asensio-Juarez, G. & Vicente-Manzanares, M. Nonmuscle Myosin II regulation directs its multiple roles in cell migration and division. Annu. Rev. Cell Dev. Biol.37, 285–310 (2021). [DOI] [PubMed] [Google Scholar]
  • 57.Ponsaerts, R. et al. The myosin II ATPase inhibitor blebbistatin prevents thrombin-induced inhibition of intercellular calcium wave propagation in corneal endothelial cells. Invest. Ophthalmol. Vis. Sci.49, 4816–4827 (2008). [DOI] [PubMed] [Google Scholar]
  • 58.Demarco, B. et al. Caspase-8-dependent gasdermin D cleavage promotes antimicrobial defense but confers susceptibility to TNF-induced lethality. Sci. Adv. 6 (2020). [DOI] [PMC free article] [PubMed]
  • 59.Zhang, X. et al. N6-methyladenosine modification governs liver glycogenesis by stabilizing the glycogen synthase 2 mRNA. Nat. Commun.13, 7038 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Xie, W. et al. Forkhead box protein A2 alleviates toll-like receptor 4-mediated inflammation, endoplasmic reticulum stress, autophagy, and apoptosis induced by lipopolysaccharide in bovine hepatocytes. J. Dairy Sci.106, 2089–2112 (2023). [DOI] [PubMed] [Google Scholar]
  • 61.Esser, D. & Siebers, B. Atypical protein kinases of the RIO family in archaea. Biochem. Soc. Trans.41, 399–404 (2013). [DOI] [PubMed] [Google Scholar]
  • 62.Ghosh, S. et al. Identification of RIOK2 as a master regulator of human blood cell development. Nat. Immunol.23, 109–121 (2022). [DOI] [PubMed] [Google Scholar]
  • 63.Li, K. et al. Pan-cancer analyses reveal multi-omics and clinical characteristics of RIO kinase 2 in cancer. Front. Chem.10, 1024670 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Weinberg, F. et al. The Atypical Kinase RIOK1 Promotes Tumor Growth and Invasive Behavior. EBioMedicine20, 79–97 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Subbannayya, Y. et al. The proteomic landscape of resting and activated cd4+ t cells reveal insights into cell differentiation and function. Int. J. Mol. Sci.22 (2020). [DOI] [PMC free article] [PubMed]
  • 66.Miller, J. L., Velmurugan, K., Cowan, M. J. & Briken, V. The type I NADH dehydrogenase of Mycobacterium tuberculosis counters phagosomal NOX2 activity to inhibit TNF-alpha-mediated host cell apoptosis. PLoS Pathog.6, e1000864 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Weng, D. et al. Caspase-8 and RIP kinases regulate bacteria-induced innate immune responses and cell death. Proc. Natl. Acad. Sci. USA111, 7391–7396 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

41467_2025_65012_MOESM2_ESM.pdf (29.3KB, pdf)

Description of Additional Supplementary File

Supplementary Data 1 (242.6KB, xlsx)
Supplementary Data 2 (4.2MB, xlsx)
Reporting summary (3MB, pdf)
Source Data.zip (8MB, zip)

Data Availability Statement

Source data are provided in this paper. The proteomics data generated in this study have been deposited in PXD065979, and the associated hyperlinks were https://proteomecentral.proteomexchange.org/cgi/GetDataset?ID=PXD065979. The RNA-Seq data have been deposited to the SRA database (accession number: PRJNA1291948). Proteomics data is provided as Supplementary Data 1. RNA sequencing data is provided as Supplementary Data 2. The processed proteomics and RNA sequencing data are available in the Source Data file. New allele and mouse with the MGI database (MGI: 8219551). Source data are provided with this paper.


Articles from Nature Communications are provided here courtesy of Nature Publishing Group

RESOURCES