Abstract
Background
The most prevalent cancer in pediatric is acute lymphoblastic leukemia (ALL). The multidrug resistance gene (MDR1) encodes the membrane transport protein P-glycoprotein (P-gp), which acts as an efflux pump. Interleukin 18 (IL18), an 18-kilodalton cytokine, plays a complex role in cancer, exhibiting both anti-cancer and pro-cancer properties. This study aims to investigate the association between polymorphisms in the MDR1 gene (G2677T, rs2032582) and IL18 gene variants (607C > A, rs1946518 and − 137G > C, rs187238) and their potential role in susceptibility to pediatric ALL in an Egyptian population. We hypothesize that specific polymorphisms in MDR1 and IL18 genes are significantly associated with an increased risk of developing pediatric ALL, and that these genetic variants may serve as potential biomarkers for early detection and prognosis.
Methods
MDR1 (G2677T) rs2032582, IL18 (607C > A) rs1946518, and IL18 (-137G > C) rs187238 variants were genotyped in 100 childhood ALL (58 male and 42 female) cases and 100 healthy controls (49 male and 51 female) using the tetra-primer amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) technique.
Results
The statistical analysis of the results indicated that the MDR1 (G2677T) rs2032582 genotypes (p = 0.051) and allele distribution (p = 0.217) showed no discernible variations between the controls and cases. The data indicate a strong correlation between the TT genotype and an elevated risk of ALL in both sexes. The allele frequency and genotype of IL18 (607C > A) rs1946518 exhibited a significant difference (p = 0.001) between the controls and cases. The results indicated a substantial difference in allele frequency (p = 0.0006) and genotype of the IL18 (-137G > C) polymorphism (p = 0.001) between the controls and cases.
Conclusions
The results suggest that the MDR1 (G2677T) rs2032582 polymorphism may not serve as a dependable prognostic indicator of the disease. In contrast, IL18 (607C > A) rs1946518 and IL18 (-137G > C) rs187238 polymorphisms may affect susceptibility to pediatric leukemia, indicating that IL18 could be a possible biomarker for the early identification of ALL.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12885-025-15132-6.
Keywords: Acute Lymphoblastic Leukemia, Multidrug Resistance Gene, Interleukin 18, Polymorphism
Background
Acute lymphoblastic leukemia (ALL) is a particularly aggressive form of hematopoietic cancer that is both physiologically diverse and clinically aggressive. The clonal proliferation and accumulation of immature lymphoid progenitor cells are the causes of this condition, which ultimately results in extensive infiltration of the thymus, peripheral blood, bone marrow, and lymphoid organs [1, 2]. It represents the most common pediatric malignancy, accounting for approximately 80% of all acute leukemia cases in children [3]. ALL can arise from distinct lymphoid progenitor lineages, most commonly giving rise to B-cell or T-cell leukemia, and less frequently to mixed-lineage leukemias. The pathogenesis of ALL is frequently driven by aberrant gene expression, commonly resulting from chromosomal translocations that disrupt normal hematopoietic development. About 20% of pediatric cancers in Egypt are ALL, with an estimated yearly incidence of 4 cases per 100,000 pediatric [4]. Although the precise etiology of ALL remains unclear, pediatric cases have been associated with various risk factors, including environmental exposures, ionizing radiation, inherited genetic syndromes, and underlying genetic susceptibility [5].
The multidrug resistance gene (MDR1), also known as ATP-binding cassette sub-family B member 1, is located on chromosome 7 at the position 21.1 [6]. Its complementary DNA measures approximately 4.5 kilobases in length. This gene features a core promoter region and consists of 28 exons [7]. The MDR1 gene is responsible for the encoding of P-glycoprotein (P-gp), which is a membrane transport protein that performs the function of an efflux pump. This protein is also required for the transport of various chemicals, including several drugs, through cell membranes in both directions. P-gp is primarily expressed in the epithelial cells of the gut, where it plays a crucial role in the absorption, distribution, and the overall pharmacological effects of many medications [8]. The prevalent MDR1 mutation in the coding region is the mutation of G2677T. This polymorphism has been significantly correlated with variability of plasma levels of P-gp substrates following increasing or decreasing trend [9]. It is a significant problem that the MDR1 (G2677T) gene polymorphism constitutes a barrier to successful treatment of cancer patients treated by chemotherapy including leukemia patients [10]. A number of studies have evaluated the relationship between the MDR1 (G2677T) polymorphism and leukemia risk; however, the results have been inconsistent [11].
Interleukin 18 (IL18) is located on chromosome 11q22.2-q22.23 and consists of six exons. This cytokine plays a crucial role in the inflammatory response, and chronic inflammation is closely related with the development of several forms of cancer as well as their progression [12, 13]. IL18 is a pleiotropic pro-inflammatory cytokine and a member of the IL1 superfamily, known as an interferon-gamma-inducing factor. IL18 is described as a double-edged sword, exhibiting both anti-tumor and pro-tumor effects [14]. On the anti-tumor side, IL18 activates natural killer cells and promotes Th1 responses. It also stimulates the secretion of various cytokines and chemokines, leading to the elimination of tumor cells, thus contributing to both innate and adaptive immunity [15].
Conversely, IL18 can also stimulate various tumor cell behaviors, including angiogenesis, proliferation, migration, and immune evasion [16]. Elevated levels of IL18 have been observed in various solid tumors, such as gastric, lung, and breast cancers [17, 18]. IL18 expression levels are regulated by at least two polymorphisms: (607C > A) rs1946518 and (−137G > C) rs187238 [19]. The (−137G > C) rs187238 polymorphism in the IL18 gene promoter may modify the binding site for the histone 4 transcription factor-1, leading to changes in IL18 expression levels [20]. Additionally, while there is no evidence of IL18 overexpression in childhood ALL patients, elevated IL18 levels have been documented in various leukemia types, including ALL [21].
Methods
Study participants
This study included 100 pediatric patients diagnosed with ALL (58 males and 42 females). As a control group, 100 unrelated, healthy blood donors (51 females and 49 males) without any history of chronic illness, matched to the case group by geographic location and ethnic background, were selected. Pediatric ALL patients were evaluated by the Pediatric Oncology Department at the Oncology Centre, Mansoura University, Egypt, between July 2024 and April 2025 while undergoing treatment or routine follow-ups.
The criteria for the study included pediatric patients under 18 years of age who were newly diagnosed and had no family history of leukemia or other cancers. The selection criteria were applied to individuals presenting with any concurrent acute or chronic inflammatory disorders, cardiovascular diseases, or other malignancies. Participants were mandated to exhibit no indications of personal or familial cancer history or other chronic diseases. Individuals over the age of 18, as well as those with acute or chronic diseases that could hinder their participation in the experiment, were also excluded, along with patients diagnosed with other oncological diseases. Informed consent for enrollment in the study was secured from the legal guardians of all participants. Supportive information and demographic data were collected from all participants or their parents.
Sample collection
A total of 5 mL of peripheral blood samples were collected from 100 patients diagnosed with ALL, utilizing sterile and single-use plastic syringes. Additionally, 100 control samples were obtained from a healthy cohort, divided into 2 mL of blood collected in EDTA tubes for DNA extraction and hematology investigation. The extraction was conducted in accordance with the standard protocols specified in the QIAGEN QIAamp DNA Blood Mini Kit (QIAGEN, Germany), adhering to the manufacturer’s guidelines [22].
Patients had a comprehensive medical history review along with general and localized clinical examinations. The clinical data for ALL patients were retrieved from their archives. Such as cases and control groups as regards the following laboratory findings; Age, gender, Total Leukocyte Count (TLC), Hemoglobin (HB), Glutamate Pyruvate Transaminase (GPT), Glutamate Oxaloacetate Transaminase (GOT), Creatinine, Bilirubin and Albumin.
Amplification of the MDR1 (G2677T) rs2032582, of IL18 (607C > A) rs1946518 and IL18 (−137G > C) rs187238 variants by T-ARMS-PCR method
The MDR1 (G2677T) rs2032582, IL18 (607C > A) rs1946518, and IL18 (−137G > C) rs187238 variants were analyzed using the tetra-primer amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) method. The PCR reaction mixture was prepared in a final volume of 25 µl, consisting of 4 µl of template DNA, 2 µl of each primer, and 13 µl of Taq master mix (Thermo Scientific). Amplification was performed using an Applied Biosystems™ Thermal Cycler. Subsequently, the resulting PCR products were separated by electrophoresis on a 2% agarose gel containing 0.5 µg/ml ethidium bromide and visualized under UV light through transillumination. Genotyping images were captured using a digital camera. Each polymorphism was amplified using its specific primers and PCR conditions as detailed in Table 1.
Table 1.
Primers and PCR product for each gene polymorphisms
| SNP (Gene) | Sequence (5’ → 3’) | PCR Program | PCR Product Length |
|---|---|---|---|
| MDR1 (G2677T) rs2032582 | Forward outer primer 5’ TCAGAAAATAGAAGCATGAGTTGTGA-3’ [23] |
Initial denaturation: 94 °C, 5 min Denaturation: 95 °C, 2 min Annealing: 56 °C, 1 min Extension: 72 °C, 1 min Final extension: 72 °C, 10 min (30 cycles) |
219 bp (G-allele) 290 bp (T-allele) 453 bp (internal control) |
| Reverse outer primer 5’ GAACTGGCTTTGCTACTTTCTGTAAG-3’. | |||
| Forward inner primer 5’ CACTGAAAGATAAGAAAGAACTAGAAGATG- 3’ | |||
| Reverse inner primer 5’ TATTTAGTTTGACTCACCTTCCCGGA- 3’ | |||
| IL18 (607C > A) rs1946518 | Forward outer 5′ - CCTACAATGTTACAACACTTAAAAT − 3′ [24, 25] |
Initial denaturation: 95 °C, 5 min Denaturation: 95 °C, 30 s annealing: 53 °C, 20 s Extension: 72 °C, 30 s Final extension: 72 °C, 10 min (30 cycles) |
208 bp (C allele) 278 bp (A allele) 440 bp (internal control) |
| Reverse outer 5′ -ATAAGCCCTAAATATATGTATCCTTA − 3′ | |||
| Forward inner 5′ -GATACCATCATTAGAATTTTGTG − 3′ | |||
| Reverse inner 5′ -GCAGAAAGTGTAAAAATTATCAA − 3′ | |||
| IL18 (−137G > C) rs187238 | Forward outer 5′-AGATGCTTCTAATGGACTAAGGAG-3′ [26] |
Initial denaturation: 94 °C, 3 min Denaturation: 94 °C, 20 s Annealing: 54 °C, 20 s Extension: 72 °C, 20 s Final extension: 72 °C, 5 min (40 cycles) |
261 bp (C and G alleles) 446 bp (internal control) |
| Reverse outer 5′-GGCAAAATGCACTGGGAGACAAT-3′, | |||
| Forward inner 5′-GCCCCAACTTTTACGGAAGAATAG-3′ | |||
| Reverse inner 5′-ATGTAATATCACTATTTTCATGAACTG-3′. |
Statistical analysis and data interpretation
Genotypic data for the MDR1 (G2677T) rs2032582, IL18 (− 607C > A) rs1946518, and IL18 (− 137G > C) rs187238 polymorphisms were collected, structured, and statistically analyzed utilizing SPSS software, version 26 (IBM Corp., Armonk, NY, USA). Qualitative data were reported as frequencies and percentages, whilst quantitative data were conveyed as mean ± standard deviation for normally distributed variables and as median (minimum–maximum) for non-normally distributed variables. The Kolmogorov–Smirnov test was employed to evaluate normality. Using the chi-square test, Hardy-Weinberg equilibrium (HWE) was evaluated for every single nucleotide polymorphism (SNP) in the control group to determine whether observed genotype frequencies differed from expected distributions. SNPs that significantly deviated from HWE (p < 0.05) were excluded from subsequent analyses to minimize the potential influence of genotyping errors or population stratification.
Group comparisons for qualitative variables were conducted using the Chi-square test, Fisher’s exact test, or Monte Carlo simulation, as applicable. The Mann–Whitney U test was employed to compare two research groups about non-normally distributed quantitative data. The autonomous samples The Student’s t-test was employed to compare two groups for normally distributed quantitative data. A binary logistic regression analysis was performed to assess the cumulative impact of several independent variables on a binary outcome, employing stepwise, forward Wald, or enter approaches as suitable.
Results
Demographic, laboratory and clinical parameters between studied groups
The present study included 100 ALL cases and 100 individuals in the control group. A comparison of demographic characteristics between the groups showed no significant differences in age (p = 0.159) or gender (p = 0.202). The mean age of cases was 9.9 ± 4.1 years, compared to 9.1 ± 3.7 years in the control group. Regarding gender distribution, 58% of the ALL patients were male and 42% were female, while the control group consisted of 49% males and 51% females. When comparing laboratory results between the cases and control groups, there were significant differences in TLC, Hb, GPT, GOT, and creatinine levels (p < 0.001 for each). Higher values of TLC, Hb, and creatinine were observed in the control group compared to cases, while GPT and GOT levels were lower in the control group than in the ALL cases (Table 2).
Table 2.
Comparison of demographic and laboratory parameters between studied groups
| Parameters Mean ± SD or N (%) |
Cases group (N = 100) |
Controls group (N = 100) |
P value |
|---|---|---|---|
| Age/years | 9.9 ± 4.1 | 9.1 ± 3.7 | 0.159 |
| Gender | |||
| Male | 58(58) | 49(49) | 0.202 |
| Female | 42(42) | 51(51) | |
| Albumin | 4.1 ± 0.5 | 4.1 ± 0.5 | 0.800 |
| GPT | 53.7(9–794) | 28(20–38) | < 0.001* |
| GOT | 33.5(10–561) | 24(16–39) | < 0.001* |
| Creatinine | 0.5(0.2–51.3) | 0.9(0.8–1.1) | < 0.001* |
| Bilirubin | 0.7(0.2–4.3) | 0.7(0.4–0.9) | 0.477 |
Used test: Student t test, Chi-Square test, Mann Whitney U test, *statistically significant, data expressed as mean ± SD, median (range)
TLC Total Leukocyte Count, HB Hemoglobin, GPT Glutamate Pyruvate Transaminase, GOT Glutamate Oxaloacetate Transaminase
The clinical presentation of the cases showed that 71% of patients had fever, 98% had pallor, 64% had bone pain, 72% had increased weight, 13% had arthritis, 48% had lymphadenopathy, and 24% had jaundice. Regarding flow cytometry results, 26% of the cases were diagnosed with T-ALL and 74% with B-ALL. As for treatment response, 49% of patients experienced relapse. Regarding other laboratory findings, the mean blast cell count was 87.5 ± 11.5. Immunophenotyping revealed the following marker positivity among patients: CD10 (77%), CD34 (71%), CD19 (75%), Human Leukocyte Antigen-DR (51%), CD79a (71%), CD38 (37%), CD13 (12%), CD33 (15%), CD2 (13%), CD7 (21%), CD117 (8%), CD4 (19%), CD11b (7%), CD22 (41%), CD58 (56%), CD81 (44%), TdT (29%), CD3 (26%), and CD8 (15%) (Table 3).
Table 3.
The clinical presentation of studied cases
|
N = 100 (%) |
Implications | |
|---|---|---|
| Fever | 71(71) | A common symptom of leukemia. |
| Pallor | 98(98) | A significant symptom arising from anemia |
| Bone Pain | 64(64) | Suggests bone marrow infiltration. |
| Increased Weight | 72(72) | Reflects the systemic and local effects of adipose tissue abnormalities |
| Arthritis | 13(13) | Possible Juvenile Idiopathic Arthritis |
| Lymphadenopathy | 48(48) | The infiltration of cancerous lymphoblasts into lymph nodes. |
| Jaundice | 24(24) | May indicate hemolysis |
| Flow cytometry | ||
| T-ALL | 26(26) | Aggressive nature and potential for relapse |
| B-ALL | 74(74) | B-ALL the most common type of ALL in children |
| Relapsed or finishing treatment Relapsed | 49(49) | High rate of relapse; constant monitoring is required. |
| BLAST (mean ± SD) | 87.5 ± 11.5 | High blast count consistent with leukemia cells are proliferating |
| CD10 | 77(77) | Precursor B cells marker |
| CD34 | 71(71) | Hematopoietic stem cells marker |
| CD19 | 75(75) | A cell surface marker presents on B cells |
| Human Leukocyte Antigen-DR | 51(51) | Common in early precursor cells. |
| CD79A | 71(71) | Role in B-cell precursor cells |
| CD38 | 37(37) | Serves as a potential therapeutic target, |
| CD13 | 12(12) | A myeloid marker |
| CD33 | 15(15) | A myeloid marker |
| CD2 | 13(13) | T-lineage marker. |
| CD7 | 21(21) | A cell surface protein |
| CD117 | 8(8) | Early hematopoietic progenitor marker. |
| CD4 | 19(19) | Helper T-cell marker |
| CD11b | 7(7) | Myeloid lineage |
| CD22 | 41(41) | B-lineage marker |
| CD58 | 56(56) | role in cell adhesion |
| CD81 | 44(44) | Its expression can be a prognostic marker |
| TdT | 29(29) | Lymphoid immaturity marker |
| CD3 | 26(26) | T-cell lineage marker |
| CD8 | 15(15) | Cytotoxic T-cell marker. |
Comparison of MDR1 (G2677T) rs2032582 genotype between cases and control groups
The study revealed no significant difference between the case and control groups with the MDR1 (G2677T) rs2032582 genotype (p = 0.051) and allele frequency (p = 0.217). Female cases had genotype distribution as follows; 38.1% GG, 52.4% GT and 9.5% TT. male cases had MDR1 (G2677T) rs2032582 genotype distribution as follows; 46.6% GG, 43.1% GT and 10.3% TT. Female controls had genotype distribution as follows; 45.1% GG and 54.9% GT. Male controls had genotype distribution as follows; 55.1% GG and 44.9% GT (Table 4; Figure 1a, b).
Table 4.
Comparison of MDR1 (G2677T) rs2032582 genotype and allele frequencies between case and control groups with HWE analysis
| MDR1 (G2677T) rs2032582 | Cases group | Control groups | p-value | ||
|---|---|---|---|---|---|
| Female N = 42(%) |
Male N = 58(%) |
Female N = 51(%) |
Male N = 49(%) |
||
| GG | 16(38.1) | 27(46.6) | 23(45.1) | 27(55.1) | P = 0.051 |
| GT | 22(52.4) | 25(43.1) | 28(54.9) | 22(44.9) | |
| TT | 4(9.5) | 6(10.3) | 0 | 0 | |
| Allele frequencies | N = 84 | N = 116 | N = 102 | N = 98 | |
| G | 54 | 79 | 74 | 76 | P = 0.217 |
| T | 30 | 37 | 28 | 22 | |
Used test: Chi-Square test, data expressed as number (%)
Fig. 1.
Figure 1 (a) MDR1 (G2677T) rs2032582 genotype among cases and control groups. b Gel electrophoresis of the T-ARMS-PCR product for the MDR1 (G2677T) rs2032582 gene variant. Lane 1 showed the homozygous GG genotype with a band at 290 bp and an internal control band at 453 bp. Lanes 3, 4, 7, 11, and 15 showed the homozygous TT genotype with a band at 219 bp and the internal control at 453 bp. Lanes 2, 5, 6, 8-10 and 12-14 represented the heterozygous GT genotype, showing bands at 219 bp (T allele), 290 bp (G allele), and the internal control at 453 bp. M: 100 bp DNA ladder (Thermo Scientific)
Distribution of IL18 (607C > A) rs1946518 gene polymorphism in ALL cases compared to controls
The study showed a significant difference between the case and control groups with regard to the IL18 (607C > A) rs1946518 genotype (p = 0.001) and allele frequency (p = 0.001). Female cases had genotype distribution as follows; 21.4% CC, 71.4% AC and 7.1% AA. male cases had genotype distribution as following; 24.1% CC, 74.1% AC and 1.7% AA. Female controls had genotype distribution as follows; 66.7% CC and 33.3% AC. Male controls had genotype distribution as follows; 63.3% CC, 34.7% AC and 2% AA (Table 5; Figure 2a, b).
Table 5.
Comparison of IL18 (607C>A) rs1946518 genotype and allele frequencies between case and control groups with HWE analysis
| IL18 (607C > A) rs1946518 | Cases group | Control groups | Test of significance | ||
|---|---|---|---|---|---|
| Female N = 42(%) |
Male N = 58(%) |
Female N = 51(%) |
Male N = 49(%) |
||
| CC | 9(21.4) | 14(24.1) | 34(66.7) | 31(63.3) | P = 0.001* |
| AC | 30(71.4) | 43(74.1) | 17(33.3) | 17(34.7) | |
| AA | 3(7.1) | 1(1.7) | 0 | 1(2.0) | |
| Allele | N = 84 | N = 116 | N = 102 | N = 98 | |
| C | 48 | 71 | 85 | 79 | P = 0.001* |
| A | 36 | 45 | 17 | 19 | |
Used test: Chi-Square test *statistically significant, data expressed as number (%)
Fig. 2.
Figure 2 (a) IL18 (607C >A) rs1946518 genotype among case and control groups. (b) Gel electrophoresis of the T-ARMS-PCR product for IL18 (607C>A) rs1946518 gene variant. Lane 7 showed the homozygous AA genotype with a band 278 bp and internal control band at 440bp. Lanes 1-3,6 and 8-13 showed the homozygous CC genotype with a band at 208bp and internal control at 440bp. Lanes 4 and 5 showed heterozygous AC genotype at 208bp for C allele, and A allele at 278 bp and internal control at 440bp. M: 100 bp DNA ladder (Thermo scientific)
Association of the IL18 (−137G > C) rs187238 variant with susceptibility to ALL
The analysis revealed a statistically significant difference between the control group and the cases in terms of the IL18 (−137G > C) rs187238 genotype (p = 0.001) and the frequency of the allele (p = 0.0006). In female cases, the distribution of the IL18 (−137G > C) rs187238 genotype was as follows: 26.2% of patients had GG, 69% had GC, and 4.8% had CC. Among male cases, 27.6% had the GG genotype, 67.2% had the GC genotype, and 5.2% had the CC genotype. Female controls were as follows: 68.6% had GG, while 31.4% had GC. Among male controls, 32.7% had the GG genotype, 65.3% had the GC genotype, and 2% had the CC genotype (Table 6; Figure 3a, b).
Table 6.
Comparison of IL18 (−137G>C) rs187238 genotype and allele frequencies between case and control groups with HWE analysis
| IL18 (−137G > C) rs187238 | Cases group | Control group | p-value | ||
|---|---|---|---|---|---|
| Female N = 42(%) |
Male N = 58(%) |
Female N = 51(%) |
Male N = 49(%) |
||
| GG | 11(26.2) | 16(27.6) | 35(68.6) | 16(32.7) | P = 0.001* |
| GC | 29(69.0) | 39(67.2) | 16(31.4) | 32(65.3) | |
| CC | 2(4.8) | 3(5.2) | 0 | 1(2) | |
| Allele | N = 84 | N = 116 | N = 102 | N = 98 | |
| G | 51 | 71 | 86 | 64 | P = 0.0006* |
| C | 33 | 45 | 16 | 34 | |
Used test: Chi-Square test *statistically significant, data expressed as number (%)
Fig. 3.
Figure 3 (a) IL18 (-137G>C) rs187238 genotype among case and control groups. (b) Gel electrophoresis of the T-ARMS-PCR product for IL18 (-137G>C) rs187238 gene variant. Lanes 1,2 and 9,10 showed heterozygous GC genotype, with both G and C alleles present at 261 bp and internal control band at 446 bp. Lanes 5,6 and 11,12 showed homozygous GG genotype. Lanes 3,4;7,8 and 13,14 showed homozygous CC genotype. M: 100 bp DNA ladder (Thermo scientific)
Genetic polymorphisms of MDR1 (G2677T) rs2032582, IL18 (607C > A) rs1946518, and IL18 (−137G > C) rs187238 among Egyptian children with ALL compared to healthy controls
The comparison between the total cases versus the total control groups includes the following genotypes: A significant difference was detected between the groups regarding the MDR1 (G2677T) rs2032582 genotype (p = 0.005), with a higher frequency of the TT genotype (10% of cases versus 0% of controls, p = 0.001). A significant difference was also detected between them regarding the distribution of recessive genes.
A significant difference was detected between studied groups in relation to IL18 (607C > A) rs1946518 (p = 0.001) with a higher frequency of AC genotype among the case than the control group (73% versus 34%, p = 0.001). Conversely, the CC genotype was observed at a lower frequency in the case group than in the control group (23% versus 65%, p = 0.001). Gene dominance and overdominance also demonstrated significant differences between the groups.
A significant difference was detected between groups concerning IL18 (−137G > C) rs187238 (p = 0.001). The GC genotype was more frequent in the case group compared to the control group (68% versus 48%, p = 0.004), whereas the GG genotype was less frequent among the case group than the control group (27% versus 51%, p = 0.0005). Gene dominance and overdominance also demonstrated statistically significant difference (Table 7).
Table 7.
Comparison of studied model genotypes between cases and control
| Model genotypes | Cases group |
Control groups | Test of significance | P value | Odds ratio (95%CI) |
||
|---|---|---|---|---|---|---|---|
| N = 100 | N = 100 | ||||||
| MDR1 (G2677T) rs2032582 | |||||||
| Codominante | GG | 43(43) | 50(50) | P = 0.005* | 0.320 | 0.7(0.4–1.3) | |
| GT | 47(47) | 50(50) | 0.671 | 0.8(0.5–1.5) | |||
| TT | 10(10) | 0 | 0.001* | Undefined | |||
| Dominant | GG | 43(43) | 50(50) | P = 0.321 | R | ||
| GT + TT | 57(57) | 50(50) | 1.3(0.7–2.3) | ||||
| Recessive | GG + GT | 90(90) | 100(100) | P = 0.001* | Undefined | ||
| TT | 10(10) | 0 | |||||
| Overdominante | GG + TT | 53(53) | 50(50) | P = 0.671 | R | ||
| GT | 47(47) | 50(50) | 1.1(0.6–1.9) | ||||
| IL18 (607C > A) rs1946518 | |||||||
| Codominante | CC | 23(23) | 65(65) | P = 0.001* | 0.001* | 0.1(0.0–0.2.0.2) | |
| AC | 73(73) | 34(34) | 0.001* | 5.2(2.8–9.6) | |||
| AA | 4(4) | 1(1) | 0.174 | 4.1(0.4–37.5) | |||
| Dominant | CC | 23(23) | 65(65) | P = 0.001* | R | ||
| CC + AC | 77(77) | 35(35) | 6.2(3.3–11.5) | ||||
| Recessive | CC + AC | 96(96) | 99(99) | P = 0.170 | R | ||
| AA | 4(4) | 1(1) | 4.1(0.4–37.5) | ||||
| Overdominante | CC + AA | 27(27) | 66(66) | P = 0.001* | R | ||
| AC | 73(73) | 34(34) | 2.2(2.8–9.6) | ||||
| IL18 (−137G > C) rs187238 | |||||||
| Codominante | GG | 27(27) | 51(51) | P = 0.001* | 0.0005* | 0.3(0.1–0.6) | |
| GC | 68(68) | 48(48) | 0.004* | 2.3(1.2–4.0.2.0) | |||
| CC | 5(5) | 1(1) | 0.097 | 5.2(0.5–45.4) | |||
| Dominant | GG | 27(27) | 51(51) | P = 0.0005* | R | ||
| CC + CC | 73(73) | 49(49) | 2.8(1.5–5.0.5.0) | ||||
| Recessive | GG + GC | 95(95) | 99(99) | P = 0.097 | 5.2(0.5–45.4) | ||
| CC | 5(5) | 1(1) | R | ||||
| Overdominante | GG + CC | 32(32) | 52(52) | P = 0.004* | R | ||
| GC | 68(68) | 48(48) | 2.3(1.2–4.0.2.0) | ||||
| AG | 60(60) | 88(88) | R | ||||
Used test: Chi-Square test *statistically significant, data expressed as number (%). 95% CI: 95% confidence interval for the difference between the means for both groups
Relation between MDR1 (G2677T) rs2032582, IL18 (607C > A) rs1946518, IL18 (−137G > C) rs187238 and clinical, laboratory findings of the cases
This study demonstrated significant relation between MDR1 (G2677T) rs2032582 genotype and CD117 (p = 0.007) with higher frequency of CD117 expression among GT genotype (17%). Additionally, a significant relation between IL18 (607C > A) rs1946518 genotype and bilirubin (p = 0.049) with higher median bilirubin among AC genotype followed by CC and the least for AA. Median platelet count was higher among AA genotype followed by CC and the least for AC genotype with statistically significant relation platelet count (p = 0.038). Moreover, a significant association between the IL18 (−137G > C) rs187238 genotype and the presence of bone pain (p = 0.002), with a higher frequency of bone affection observed in cases with the GG genotype (81.5%), followed by the GC genotype (61.8%). A statistically significant association was also found with CD58 (p = 0.030) (Table 8).
Table 8.
Comparison of MDR1 (G2677T) rs2032582, IL18 (607C>A) rs1946518, IL18 (−137G>C) rs187238 genotypes and clinical, laboratory findings of studied cases
| Variable | Genotype | P value |
|---|---|---|
| MDR1 (G2677T) rs2032582 | ||
| CD117 |
GG: 0 (0%) GT: 8 (17%) TT: 0 (0%) |
0.007* |
| IL18 (607C > A) rs1946518 | ||
| Bilirubin |
CC: 0.7 (0.2–3) AC: 0.7 (0.2–4.3) AA: 0.4 (0.3–0.6) |
0.049* |
| Platelet count |
CC: 242 (18–601) AC: 174 (11–556) AA: 333 (1375–400) |
0.038* |
| IL18 (−137G > C) rs187238 | ||
| Bone pain |
GG: 22 (81.5%) GC: 42 (61.8%) CC: 0 (0%) |
0.002* |
| CD58 |
GG: 20 (74.1%) GC: 32 (47.1%) CC: 4 (80%) |
0.030* |
Used tests: Chi-Square test, One Way ANOVA test, Kruskal Wallis test *statistically significant, data expressed as number (%), median (range).
Discussion
One of the most important MDR1 gene polymorphisms is the G2677T SNP. This polymorphism has been significantly associated with variations in plasma concentrations of P-gp substrates, impacting drug absorption and efficacy [27]. To be more specific, individuals who have the G2677T variation may have either higher or decreased levels of these substrates in their plasma, which can have an impact on the treatment responses and drug resistance that occur in cancer therapy [28]. Variants in the MDR1 gene, such as the G2677T polymorphism (rs2032582), have been investigated to determine the extent to which they operate as a risk factor for leukemia in Egyptian children.
The distribution of genotypes and no significant differences between cases and controls are the main concerns of this study. Comparing all cases with the control group, no significant difference in the distribution of the genotypes and allele frequencies could be shown for MDR1(G2677T) rs2032582 genotype (p = 0.051) and allele frequency (p = 0.217). Therefore, the MDR1 (G2677T) SNP may be a weak predictor of disease with consideration to all patients. The findings of this investigation demonstrated a strong relationship of the TT genotype. The large discrepancy in the frequency of the TT genotype indicates a recessive nature, this variant may confer the risk of a disease. Therefore, further research is needed to elucidate the effects of the MDR1 (G2677T) rs2032582 genotype in other populations and its potential role in the development of the disease and the strategies used for treatment. This is consistent with the results of Ammar et al. [29] in Tunisia, which show a significant difference in the distribution of MDR1 G2677T genotype between cancer patients and healthy individuals. A higher frequency of the TT genotype in patients with leukemia was noted when compared with controls, and the patent association of TT genotype with disease susceptibility is indicated.
Among Serbian patients with ulcerative colitis, carriers of the T allele of the G2677T SNP in the MDR1 gene are more frequent in comparison to healthy controls based on the study [30]. The findings of this study suggest the role of the T allele and susceptibility to ulcerative colitis in the population. This evidence tends to confirm that these polymorphisms have an etiologic predisposing role in inflammatory bowel disease. Consistent with the report of Fu et al. [31], which assessed the association of MDR1 gene polymorphisms with cardiovascular diseases, there was no significant association between the G2677T polymorphism and susceptibility to the disease; it seems that the risk of this polymorphism in the occurrence of cardiovascular diseases in these people is not considerable. According to the findings of the research carried out by Yan et al. [32], which conducted a meta-analysis of the association between the MDR1 G2677T polymorphism and the risk of leukemia, the investigation did not uncover any significant association in the general population. More specifically, the results indicated that the TT genotype did not show a statistically significant increase in leukemia risk compared to the TG and GG genotypes across different analytical models.
Our findings for the MDR1 (G2677T) rs2032582 gene show significant associations with disease susceptibility in both female and male patients, particularly for the TT genotype. While many studies support these findings, some contradict them, highlighting the complexity of genetic influences on health. Further research is needed to explore the nuances of these associations and their implications for clinical practice. Our study also shows a statistically significant association between the MDR1 (G2677T) rs2032582 genotype and CD117 (p = 0.007) a tyrosine kinase receptor involved in cell signaling and hematopoiesis with a higher frequency of CD117 expression among the GT genotype (17%). This finding helps us understand functional gene interactions in cell biology, especially in hematopoiesis and related disorders such as acute leukemia in children.
The IL18 cytokine is integral to the immune response, which plays a critical role in activating immune cells, particularly T cells and natural killer cells [33]. Genetic variations in IL18 can lead to altered immune responses, potentially impacting the development of lymphoid malignancies such as ALL [34]. Insufficient immune surveillance, stemming from genetic predispositions, may facilitate the proliferation of malignant cells [35]. The present study of the IL18 (607C >A) rs1946518 genotype distribution among case and control groups reveals significant differences. A statistically significant higher frequency of the A allele (either the heterozygous AC or homozygous AA form) may have an increased susceptibility to the disease among cases compared to controls, indicating a potential risk factor associated with the A allele. The AA genotype, although relatively rare, appeared more frequently in female cases (7.1%) than in any control group. A significant difference was noted in dominant gene distribution (CC + AC) and overdominance gene distribution (AC), with higher percentages in the case groups compared to controls.
The AC genotype may result in altered IL18 expression or receptor signaling, which can impact immune responses and potentially play a role in the development of disease [36]. The frequency of the CC genotype was notably greater in the control groups than in the case groups (p = 0.001). This observation suggests that individuals possessing this genotype might have an inherent protective advantage against diseases associated with immune responses. Confirming the results of our study is the study conducted by Al-ardawy et al. [37] as their study demonstrated the presence of statistically significant differences in the genetic and allelic frequencies of IL18 rs1946518, which are associated with the likelihood of developing ulcerative colitis. The current findings, supported by the study of Yang et al. [38], show that the meta-analysis results indicate that the IL18 gene promoter − 607C >A polymorphism is significantly associated with an increased risk of cancer in general, particularly in cases of nasopharyngeal cancer and gastrointestinal cancer.
The data indicate that the IL18 (−137G >C) variation may contribute to an elevated risk of pediatric leukemia development. The observed increased prevalence of the GC genotype in patients relative to controls suggests that this genotype may heighten the risk of leukemia, as shown by an odds ratio, whereas the frequency of the GG genotype was significantly higher in the control groups than in the case groups. According to Chen et al. [39], the statistical rise in the prevalence of the C allele among cases (either in the heterozygous GC or homozygous CC) further substantiates the concept that this allele may contribute to the etiology of juvenile leukemia. The presence of the C allele may be associated with altered IL18 expression, which is crucial for immune regulation and inflammation, both of which are vital in cancer progression. Regarding dominant and overdominant gene distribution, 51% of the control group exhibit GG genotypes, in contrast to 27% in the case group (odds ratio = 0.355). This finding indicates that possessing the GG genotype as a preventive agent reduces the risk of leukemia in patients. The overdominance effect is further highlighted by the 68% prevalence of the GC genotype, which substantially increases the risk of pediatric leukemia, reinforcing the notion of heightened susceptibility linked to this genotype to be infected with malignant diseases [40].
The results of the study conducted by Lau et al. [41] revealed that the IL18 (−137G >C) polymorphism is strongly correlated with an elevated risk of hepatocellular carcinoma, but the (607C >A) rs1946518 polymorphism did not show a significant association with hepatocellular carcinoma susceptibility. The data indicate that IL18 polymorphisms do not consistently influence cancer risk. The study’s results indicate significant disparities in the distribution of the IL18 (−137G >C) rs187238 genotypes between children with leukemia and the control group. There is a notable disparity in genotype distributions between these two populations. Gene dominance and overdominance both exhibit a statistically significant difference.
These findings suggest that the IL18 polymorphism may influence bilirubin metabolism and play a role in platelet production. That means it may have a role in several blood diseases and in how the body reacts to inflammation. The results of our study revealed the presence of a significant association between the IL18 (607C >A) rs1946518 and bilirubin (p = 0.049). Median bilirubin was highest in the AC genotype, followed by the CC genotype, and was lowest in the AA genotype. Median platelet count was higher in AA than in CC and AC genotypes with a statistically significant association (p = 0.038). Such findings suggest that the IL18 polymorphism might be involved in the catabolism of bilirubin and in the genesis of platelets. Meaning it might be involved in a variety of blood disorders and the body’s response to inflammation [42].
In contrast, the distribution of the 1L18 (−137G >C) rs187238 genotype and allele frequency did not differ in males. This suggests a lack of association between IL18 and leukemia, possibly indicating that IL18 demonstrates a more pronounced genetic influence in females than males. This may be because males and females have different hormones or immunological responses. The IL18 (−137G >C) polymorphism is associated with several diseases, particularly in Asian populations. This genetic variant is linked to an increased risk of nasopharyngeal carcinoma. Studies on head and neck cancer (HNC) have shown a connection between IL18 genetic variation and a predisposition to developing cancer [43]. The IL18 (−137G >C) polymorphism is also associated with an increased risk of developing type 1 diabetes in the Egyptian population. This finding suggests that variations in the IL18 gene may be critical in the development of autoimmune diseases such as type 1 diabetes [44]. This study found that there is a correlation between the IL18 (−137G >C) rs187238 genotype and the number of bone lesions, and that this correlation is statistically significant (p = 0.002). There was a significantly higher incidence of bone lesions among those with the GG genotype compared to those with the GC genotype (81.5% and 61.8%, respectively).
Conclusions
This study highlights the potential genetic influence of IL18 and MDR1 polymorphisms on pediatric leukemia susceptibility. While the MDR1 (G2677T) rs2032582 genotype showed no statistically significant association with disease risk, a possible weak predictive value cannot be entirely ruled out. In contrast, significant associations were observed for IL18 gene variants. The IL18 (607C > A) rs1946518 A allele—particularly in AC and AA genotypes—was more prevalent among cases, suggesting an increased susceptibility to leukemia. Furthermore, the IL18 (−137G > C) GC genotype demonstrated a strong association with heightened disease risk, whereas the GG genotype appeared to offer a protective effect. These findings support the role of IL18 gene variations as potential genetic markers for increased pediatric leukemia risk.
Supplementary Information
Acknowledgements
We express our sincere gratitude to the Hematology and Oncology Unit, Faculty of Medicine, Mansoura University, for their support in facilitating the collection of blood samples from Egyptian children.
Abbreviations
- ALL
Acute Lymphoblastic Leukemia
- MDR1
Multidrug Resistance Gene
- P-gp
P-glycoprotein
- IL18
Interleukin 18
- TLC
Total Leukocyte Count
- HB
Hemoglobin
- GPT
Glutamate Pyruvate Transaminase
- GOT
Glutamate Oxaloacetate Transaminase
- T-ARMS-PCR
Tetra-Primer Amplification Refractory Mutation System-Polymerase Chain Reaction
- HWE
Hardy-Weinberg Equilibrium
- SNP
Single Nucleotide Polymorphism
Authors’ contributions
A.M.E., M.A.M., M.M.M., and A.F.A. contributed to the design of the study, supervision, writing of the original manuscript, and reviewing and editing the manuscript. A.N.M. contributed to methodology, data collection, analysis, and investigation. All the authors have read and approved the manuscript for publication.
Funding
Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). Open access funding was provided by the Science, Technology & Innovation Funding Authority (STDF), in cooperation with the Egyptian Knowledge Bank (EKB). This research did not receive any additional external funding from community, commercial, or non-profit sectors.
Data availability
All the data analyzed during the current study are available from the corresponding author on reasonable request (Mai M. Madkour).
Declarations
Ethics approval and consent to participate
This study was approved by the Institutional Research Board of the Faculty of Medicine, Mansoura University. Approval was granted by the Ethics Committee of Mansoura University (Code number: MDP.24.07.160). The study adhered to the guidelines of the Declaration of Helsinki by the World Medical Association, and informed consent was obtained from the subjects’ parents or guardians.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Mai M. Madkour, Email: maimadkour211@mans.edu.eg
A.F. Abdel-Aziz, Email: afaziz2012@hotmail.com
References
- 1.Zehtab S, Sattarzadeh Bardsiri M, Mirzaee Khalilabadi R, Ehsan M, Fatemi A. Association of DNA repair genes polymorphisms with childhood acute lymphoblastic leukemia: a high-resolution melting analysis. BMC Res Notes. 2022;15:46. 10.1186/s13104-022-05918-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Deng Q, Yue S, You F, Zhai Z, Sun H, Liang L, et al. Vincristine/Volasertib polymersome injection enables high-efficiency synergistic treatment of acute lymphoblastic leukemia. Acta Biomater. 2025;200:641–52. 10.1016/j.actbio.2025.05.041. [DOI] [PubMed] [Google Scholar]
- 3.Ekpa QL, Akahara PC, Anderson AM, Adekoya OO, Ajayi OO, Alabi PO, et al. A review of acute lymphocytic leukemia (ALL) in the pediatric population: evaluating current trends and changes in guidelines in the past decade. Cureus. 2023;15:e49930. 10.7759/cureus.49930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Abobakr A, Osman RA, Kamal MA, Abdelhameed S, Ismail H, Kamel MM, et al. Clinical and prognostic significance of CD27 and CD44 expression patterns in Egyptian pediatric patients with B-precursor acute lymphoblastic leukemia. Hematol Transfus Cell Ther. 2024;46:S27–35. 10.1016/j.htct.2023.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hassib AE, Abdulhafeez DM, Atef NA, Ameen OM. The role of miRNA-196a2 genotypes in the susceptibility of acute lymphoblastic leukemia in Egyptian children. Gene Rep. 2021;24:101237. 10.1016/j.genrep.2021.101237. [Google Scholar]
- 6.Zhu J, Lu J, He Y, Shen X, Xia H, Li W, et al. Association of ABCB1 polymorphisms with efficacy and adverse drug reactions of valproic acid in children with epilepsy. Pharmaceuticals. 2023;16:1536. 10.3390/ph16111536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Skinner KT, Palkar AM, Hong AL. Genetics of ABCB1 in cancer. Cancers (Basel). 2023;15:4236. 10.3390/cancers15174236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zintzaras E. Is there evidence to claim or deny association between variants of the multidrug resistance gene (MDR1 or ABCB1) and inflammatory bowel disease? Inflamm Bowel Dis. 2012;18:562–72. 10.1002/ibd.21728. [DOI] [PubMed] [Google Scholar]
- 9.Gregers J, Green H, Christensen IJ, Dalhoff K, Schroeder H, Carlsen N, et al. Polymorphisms in the ABCB1 gene and effect on outcome and toxicity in childhood acute lymphoblastic leukemia. Pharmacogenomics J. 2015;15:372–9. 10.1038/tpj.2014.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sági JC, Gézsi A, Egyed B, Jakab Z, Benedek N, Attarbaschi A, et al. Pharmacogenetics of the central nervous system—toxicity and relapse affecting the CNS in pediatric acute lymphoblastic leukemia. Cancers (Basel). 2021;13:2333. 10.3390/cancers13102333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Khosravi M, Khalaj Z, Nouri N, Najaflu M, Mehrzad V, Forat-Yazdi M, et al. Lack of association between c1236t, g2677t/a and c3435t variants of the abcb1 gene and Imatinib response in Iranian chronic myeloid leukemia patients. J Sci I R I. 2021;32:121–30. 10.22059/jsciences.2021.313865.1007595. [Google Scholar]
- 12.Alkanli N, Ay A, Cevik G. Investigation of the roles of IL-18 (-607 C > A) and IL-18 (-137 G > C) gene variations in bladder cancer development: case–control study. J Cancer Res Clin Oncol. 2021;147:3627–37. 10.1007/s00432-021-03808-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Aghajani R, Saeidi M, Amiriani T, Marjani M, Amiriani AH, Akhavan Tabib A, Marjani A. Genetic polymorphisms – 137 (G > C)(rs187238) and – 607 (C > A)(rs1946518) and serum level of Interleukin 18 in Fars ethnic groups with metabolic syndrome in Northern Iran. Arch Physiol Biochem. 2022;128:1596–602. 10.1080/13813455.2020.1784954. [DOI] [PubMed] [Google Scholar]
- 14.Wadea FM, Abdou AE, Abd-El Monem DM, Sharafeddin MA. Clinical significance of Interleukin 18 in chronic liver disease. J Hosp Med. 2022;89:4430–3. 10.21608/ejhm.2022.258456. [Google Scholar]
- 15.Shen J, Zhang Y, Tang W, Yang M, Cheng T, Chen Y, et al. Short IL-18 generated by caspase-3 cleavage mobilizes NK cells to suppress tumor growth. Nat Immunol. 2025;26:416–28. 10.1038/s41590-024-02074-7. [DOI] [PubMed] [Google Scholar]
- 16.Qu R, Zhao Y, Zhang Y. The mechanism of cytokine regulation of cancer occurrence and development in the tumor microenvironment and its application in cancer treatment: a narrative review. Transl Cancer Res. 2024;13:5649–63. 10.21037/tcr-24-679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ma T, Kong M. Interleukin-18 and – 10 may be associated with lymph node metastasis in breast cancer. Oncol Lett. 2021;21:253. 10.3892/ol.2021.12515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhang Z, Wang J, Teng M, Yan X, Liu Q. The role of serum interleukins in cancer: a multi-center Mendelian randomization study. Int Immunopharmacol. 2024;137:112520. 10.1016/j.intimp.2024.112520. [DOI] [PubMed] [Google Scholar]
- 19.Sakharkar P, Deb S, Mashayekhi N. Association between polymorphisms in cytokine gene and viral infections in renal and liver transplant recipients: a systematic review. J Pharm Pharm Sci. 2020;23:109–31. 10.18433/jpps30961. [DOI] [PubMed] [Google Scholar]
- 20.Martinez Valenzuela L, Vidal-Alabró A, Rubio B, Antón-Pàmpols P, Gómez-Preciado F, Fulladosa X, et al. Evaluating single-nucleotide polymorphisms in inflammasome proteins and serum levels of IL-18 and IL-1β in kidney interstitial damage in anti-neutrophilic cytoplasmic antibody-associated vasculitis. Int J Mol Sci. 2024;25:6479. 10.3390/ijms25126479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Solati H, Zareinejad M, Ghavami A, Ghasemi Z, Amirghofran Z. IL-35 and IL-18 serum levels in children with acute lymphoblastic leukemia: the relationship with prognostic factors. J Pediatr Hematol Oncol. 2020;42:281–6. 10.1097/MPH.0000000000001667. [DOI] [PubMed] [Google Scholar]
- 22.Elmrghni S. DNA extraction from blood stored on FTA cards. European Journal of Medical and Health Research. 2024;2:4–8. 10.59324/ejmhr.2024.2(1).01. [Google Scholar]
- 23.Rahaman M, Mukherjee M, Chakravorty N, Genetic, Disorders. Genotyping techniques and the emerging role of Tetra-ARMS-PCR as a diagnostic tool. Resonance. 2021;26:1229–40. 10.1007/s12045-021-1225-x. [Google Scholar]
- 24.Nguyen TP, Tran AN, Nguyen TP, Cao NT, Khang T, Tran KT. Optimized T-ARMS PCR for detecting CYP2C19*2 polymorphism in the Mekong delta Khmer population. Arch Balk Med Union. 2024;59:343–51. 10.31688/ABMU.2024.59.4.03. [Google Scholar]
- 25.Hasan LO, Rasheed TK. Association of Interleukin-12 and Interleukin-18 polymorphisms with acute lymphoblastic leukemia disease in Iraqi patients. Iraqi J Sci. 2024;675–83. 10.24996/ijs.2024.65.2.8.
- 26.Birbian N, Singh J, Jindal SK. Protective role of IL-18 – 137G > C polymorphism in a North Indian population with asthma: A pilot study. Cytokine. 2013;61:188–93. 10.1016/j.cyto.2012.09.015. [DOI] [PubMed] [Google Scholar]
- 27.Álvarez-Carrasco P, Morales-Villamil F, Maldonado-Bernal C. P-glycoprotein as a therapeutic target in hematological malignancies: a challenge to overcome. Int J Mol Sci. 2025;26:4701. 10.3390/ijms26104701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ohsawa M, Ikura Y, Fukushima H, Shirai N, Sugama Y, Suekane T, et al. Immunohistochemical expression of multidrug resistance proteins as a predictor of poor response to chemotherapy and prognosis in patients with nodal diffuse large B-cell lymphoma. Oncology. 2005;68:422–31. 10.1159/000086984. [DOI] [PubMed] [Google Scholar]
- 29.Ammar M, Ktari S, Medhaffar M, Ghozzi H, Elloumi M, Hammami A, et al. MDR1 haplotypes and G2677T/A polymorphism predict Imatinib response in Tunisian patients with chronic myeloid leukemia. J Biosci Med. 2022;10:118–31. 10.4236/jbm.2022.109009. [Google Scholar]
- 30.Mijac D, Vukovic-Petrovic I, Mijac V, Perovic V, Milic N, Djuranovic S, et al. MDR1 gene polymorphisms are associated with ulcerative colitis in a cohort of Serbian patients with inflammatory bowel disease. PLoS ONE. 2018;13:e0194536. 10.1371/journal.pone.0194536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Fu R, Tajima S, Suetsugu K, Watanabe H, Egashira N, Masuda S. Biomarkers for individualized dosage adjustments in immunosuppressive therapy using calcineurin inhibitors after organ transplantation. Acta Pharmacol Sin. 2019;40:151–9. 10.1038/s41401-018-0070-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yan Y, Liang H, Xie L, He Y, Li M, Li R, et al. Association of MDR1 G2677T polymorphism and leukemia risk: evidence from a meta-analysis. Tumor Biol. 2014;35:2191–7. 10.1007/s13277-013-1291-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ihim SA, Abubakar SD, Zian Z, Sasaki T, Saffarioun M, Maleknia S, et al. Interleukin-18 cytokine in immunity, inflammation, and autoimmunity: biological role in induction, regulation, and treatment. Front Immunol. 2022;13:919973. 10.3389/fimmu.2022.919973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Terwilliger T, Abdul-Hay MJ. Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer J. 2017;7:e577. 10.1038/bcj.2017.53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Landy E, Carol H, Ring A, Canna S. Biological and clinical roles of IL-18 in inflammatory diseases. Nat Rev Rheumatol. 2024;20:33–47. 10.1038/s41584-023-01053-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Arumugam D, Semalaiyappan J, Mookiah B, Kuttiatt VS. Genetic polymorphisms of IL-18 and their association with infectious Diseases–An update. Curr Genet Med Rep. 2025;13:1–2. 10.1007/s40142-025-00215-4.40012965 [Google Scholar]
- 37.Al-ardawy YJ, Al-Saadi AH, Alkindy MA, Al-Lsawi AM, Fadheel MA. Study of the relationship between genetic variants of IL-18 and the occurrence of inflammatory bowel disease. Egypt J Med Hum Genet. 2024;25:81. 10.1186/s43042-024-00555-w. [Google Scholar]
- 38.Yang X, Qiu MT, Hu JW, Jiang F, Li M, Wang J, et al. Association of interleukin-18 gene promoter – 607 C > A and – 137G > C polymorphisms with cancer risk: a meta-analysis of 26 studies. PLoS ONE. 2013;8:e73671. 10.1371/journal.pone.0073671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Chen CC, Tzeng HE, Kuo CC, Lim SN, Hsu PC, Hsu YN, et al. Significant contribution of interleukin-18 genotypes to childhood acute lymphocytic leukemia risk in Taiwanese. Anticancer Res. 2022;42:5283–90. 10.21873/anticanres.16035. [DOI] [PubMed] [Google Scholar]
- 40.Yalçın S, Mutlu P, Çetin T, Sarper M, Özgür G, Avcu F. The-137G > C polymorphism in interleukin-18 gene promoter contributes to chronic lymphocytic and chronic myelogenous leukemia risk in Turkish patients. Turk J Haematol. 2015;32:311–6. 10.4274/tjh.2014.0126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lau HK, Hsieh MJ, Yang SF, Wang HL, Kuo WH, Lee HL, et al. Association between interleukin-18 polymorphisms and hepatocellular carcinoma occurrence and clinical progression. Int J Med Sci. 2016;13:556–61. 10.7150/ijms.15853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Zhu M, Rong X, Li M, Wang S. IL-18 and IL-35 in the serum of patients with sepsis thrombocytopenia and the clinical significance. Exp Ther Med. 2020;19:1251–8. 10.3892/etm.2019.8347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Wang Z, Gao ZM, Huang HB, Sun LS, Sun AQ, Li K. Association of IL-8 gene promoter – 251 A/T and IL-18 gene promoter – 137 G > C polymorphisms with head and neck cancer risk: a comprehensive meta-analysis. Cancer Manag Res. 2018;2589–604. 10.2147/CMAR.S165631. [DOI] [PMC free article] [PubMed]
- 44.Ali YB, El-Gahel HE, Abdel-Hakem NE, Gadalla ME, El-Hefnawy MH, El-Shahat M. Association between IL-18 and IL-6 gene polymorphisms and the risk of T1D in Egyptian children. J Diabetes Metab Disord. 2021;20:439–46. 10.1007/s40200-021-00763-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All the data analyzed during the current study are available from the corresponding author on reasonable request (Mai M. Madkour).